Abstract
Target: To investigate the association between the interactions of murine double minute 2 (MDM2) polymorphisms (rs769412 and rs937283) with alcohol drinking and laryngeal carcinoma. Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to detect the genotypes status of MDM2 rs769412 and rs937283 polymorphisms among 126 cases and 120 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by the chi-squared test, which was adopted to analyze the association between MDM2 rs769412 and rs937283 polymorphisms and the susceptibility to larynx carcinoma in the drinking population. Results: Genotypes distributions of MDM2 rs769412 and rs937283 polymorphisms in the control group were in accordance with Hardy-Weinberg equilibrium (HWE). MDM2 rs769412 GG genotype and G allele significantly increased laryngeal carcinoma risk (GG vs. AA: OR=3.17, 95% CI=1.25-8.04; G vs. A: OR=1.88, 95% CI=1.24-2.84). Furthermore, the mutant genotypes of MDM2 rs937283and rs769412 were remarkablely associated with the increased risk for laryngeal carcinoma in drinking population (rs937283: OR=2.67, 95% CI=1.40-5.07; rs769412: OR=3.76, 95% CI=1.62-8.75). Conclusion: MDM2 polymorphisms are correlated with the onset of laryngeal carcinoma. The relationship is strengthened by alcohol drinking.
Keywords: Laryngeal carcinoma, MDM2, polymorphisms, alcohol drinking
Introduction
Larynx carcinoma is one of the common malignant tumors on head and neck. Its incidence is only lower than nasopharyngeal carcinoma in head and neck tumors, which accounts for 1%~5% of body tumors. Laryngeal carcinoma generally occurs among people aged 50~70 years old, especially in males. In recent years, the incidence of laryngeal carcinoma is increasing yearly because of multiple carcinogenic factors [1-3]. Among the factors, genes play vital roles in the occurrence of laryngeal carcinoma [4-6].
Previous studies have indicated that murine double minute 2 (MDM2, also known as HDMX and ACTFS), located at chromosome 12q14.3-q15, is a newly proto-oncogene encoding a apoptosis inhibiting protein [7]. As a new member in the family of the inhibitor of apoptosis protein (IAP), MDM2 can extend the survival time of cells and promote the cell proliferation and tumor growth by a feedback loop with P53 [8]. Multiple researches in recent years show that MDM2 takes part in the emergence and development of many tumors, especially digestive carcinomas [9-11] and is associated with the infiltration, metastasis and poor prognosis of malignancies [12,13]. However, the relationship of MDM2 rs937283A/G and rs769412A/G polymorphisms with laryngeal carcinoma risk was hardly reported.
To our knowledge, with the improvement of people’s living, cigarette and alcohol are excessively consumed, which leads to some diseases indirectly. Therefore, the association of MDM2 polymorphisms with the environmental factors and laryngeal carcinoma susceptibility was analyzed in 126 patients with larynx carcinoma and 120 healthy controls. The results may provide evidence for exploring the pathogenesis of laryngeal carcinoma.
Materials and methods
Research objects
126 patients with laryngeal carcinoma hospitalized in Affiliated Hospital of Weifang Medical College were enrolled as cases. All patients (82 males and 44 females) got neither radiotherapy nor chemotherapy, and they were confirmed by two pathologists. They were aged 46-78 with an average age of 60.3. At the same period, 120 healthy people frequency-matched by age and gender with cases carried out physical examination in the same hospital were enrolled as the control group. Among them, there were 64 males and 56 females aged 41-82 with a median age of 59.8. All participators were unrelated Chinese Han population and had no other malignancy histories. Written consents were obtained from all subjects and this project was supported by the Research Ethics Committee of the hospital.
Blood collection and DNA extraction
5 mL peripheral venous blood was collected from every participator and then undergone anticoagulant operation by ethylene diamine tetraacetic acid (EDTA). Genomic DNA was extracted using proteinase K digestion-saturation sodium chloride method from all samples and stored at -20°C refrigerator.
Genotyping
Genotypings of MDM2 rs769412 and rs937283 polymorphisms were carried out by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). PCR primers were designed by Primer premier 5.0 software and primers sequences were shown in Table 1. PCR reaction system was a volume of 25 µL solution, including 100 ng genomic DNA, 1.0 µL forward primer and reverse primer, respectively, 12.5 µL Master Mix and 10.5 µL redistilled water. PCR reaction program was as follows: initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 45 s and extension at 72°C for 1 min, at last final extension at 72°C for 5 min. PCR amplification products were digested by HpaII and MboI, respectively. The enzyme-digested products were seperated by 2% agarose gel electrophoresis.
Table 1.
Primers sequences and amplification lengths of MDM2 rs769412 and rs937283 polymorphisms
| SNP | Forward/Reverse | Primer sequence | Fragment length |
|---|---|---|---|
| rs769412 A/G | Forward | 5’ ACAGATGTTGGGCCCTTCGT 3’ | 279 bp |
| Reverse | 5’ GCAATGTGATGGAAGGGGGG 3’ | ||
| rs937283 A/G | Forward | 5’ GAGCAAGAAGCCGAGCCCGA 3’ | 261 bp |
| Reverse | 5’ CTCGGGCTCGGCTTCTTGCT 3’ |
Statistical analysis
The genotypes distributions of MDM2 rs769412 and rs937282 polymorphisms in control group were evaluated by Hardy-Weinberg equilibrium (HWE). Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated by χ2 test to evaluate the relationship strength between MDM2 polymorphisms or MDM2 with alcohol drinking and larynx carcinoma risk. SPSS18.0 software was applied for statistical analysis. Statistically significant level was P<0.05.
Results
Basic characteristics of objects
Genotypes distributions of MDM2 rs769412 and rs937283 polymorphisms in the control group were satisfied with HWE, indicated that control samples were representative. There were no distinct differences of sex, age and smoking between two groups (P>0.05). However, significant difference was found in alcohol drinking (P<0.05) (Table 2).
Table 2.
Basic characteristics of cases and controls
| Basic characteristics | Cases (n=126, %) | Controls (n=120, %) | P value |
|---|---|---|---|
| Sex | 0.80 | ||
| Male | 78 (61.9) | 72 (60.0) | |
| Female | 48 (38.1) | 48 (40.0) | |
| Age | 0.07 | ||
| ≤50 | 29 (23.0) | 41 (34.2) | |
| >50 | 97 (77.0) | 79 (65.8) | |
| Smoking status | 0.16 | ||
| Smoking | 70 (55.6) | 55 (45.8) | |
| Non-smoking | 56 (44.4) | 65 (54.2) | |
| Drinking status | 0.01 | ||
| Drinking | 85 (67.5) | 62 (51.7) | |
| Non-smoking | 41 (32.5) | 58 (48.3) |
Correlation analysis between MDM2 polymorphisms and the risk of larynx carcinoma
The results indicated that (Table 3) the frequency of MDM2 rs937283 GG genotype in case group was obviously higher than in control group (P<0.05). The risk of laryngeal carcinoma was 3.17 times higher in people with GG genotype than AA genotype (OR=3.17, 95% CI=1.25-8.04). Also, the G allele was associated with increased risk of larynx carcinoma (OR=1.88, 95% CI=1.24-2.84). Rs769412 polymorphism had no significant relevance with the occurrence of larynx carcinoma. Meanwhile, further study about the association between MDM2 polymorphisms with alcohol drinking and larynx carcinoma susceptibility was carried out. As shown in Table 4, the results showed that both of rs937283 and rs769412 polymorphisms remarkablely increased larynx carcinoma risk in people who drink all the time (rs937283: OR=2.67, 95% CI=1.40-5.07; rs769412: OR=3.76, 95% CI=1.62-8.75).
Table 3.
Comparison of genotypes and alleles distributions in two groups
| Genotypes/-Alleles | Cases-(n, %) | Controls-(n, %) | P | OR (95% CI) |
|---|---|---|---|---|
| rs937283 A/G | ||||
| AA | 65 (51.6) | 80 (66.7) | - | 1.00 |
| AG | 43 (34.1) | 33 (27.5) | 0.12 | 1.60 (0.92-2.81) |
| GG | 18 (14.3) | 7 (5.8) | 0.02 | 3.17 (1.25-8.04) |
| A | 173 (68.7) | 193 (80.4) | - | 1.00 |
| G | 79 (31.3) | 47 (19.6) | 0 | 1.88 (1.24-2.84) |
| rs769412 A/G | ||||
| AA | 92 (73.0) | 99 (82.5) | - | 1.00 |
| AG | 30 (23.8) | 19 (15.8) | 0.11 | 1.70 (0.90-3.23) |
| GG | 4 (3.2) | 2 (1.7) | 0.46 | 2.15 (0.39-12.03) |
| A | 214 (84.9) | 217 (90.4) | - | 1.00 |
| G | 38 (15.1) | 23 (9.6) | 0.08 | 1.68 (0.97-2.91) |
Table 4.
The association of MDM2 rs937283 and rs769412 polymorphisms with alcohol drinking with larynx carcinoma risk
| SNPs | Variates | Cases | Controls | P | OR (95% CI) |
|---|---|---|---|---|---|
| rs937283 | |||||
| + | + | 30 | 48 | 1.00 | |
| + | - | 35 | 32 | 1.31 | 1.75 (0.90-3.39) |
| - | + | 11 | 10 | 0.32 | 1.76 (0.67-4.64) |
| - | - | 50 | 30 | 0.00 | 2.67 (1.40-5.07) |
| rs769412 | |||||
| + | + | 35 | 47 | 1.00 | |
| + | - | 57 | 52 | 0.24 | 1.47 (0.83-2.62) |
| - | + | 6 | 11 | 0.79 | 0.73 (0.25-2.17) |
| - | - | 28 | 10 | 0.00 | 3.76 (1.62-8.75) |
Note: “+” and “-” represents wild and mutant genotypes in SNP column, respectively. In variate column, “+” and “-” represents no drinking and alcohol drinking, respectively.
Discussion
Laryngeal carcinoma is one of serious diseases affecting human health and life. Because of different carcinogenic factors and accumulated exposure to various carcinogenic conditions, the incidence of larynx carcinoma has increased year by year during the past 10 years. Recent studies showed that the occurrence of laryngeal carcinoma was the combined effects of environmental and genetic factors [14,15].
The relationship of genetic factors, especially genetic variant and laryngeal carcinoma attracts a lot of attention. A meta-analysis of Li et al. showed that GSTT1 null genotype significantly increased laryngeal carcinoma risk [16]. A DNA repair gene XRCC1 Arg399Gln polymorphism was proved to be associated with the increased risk of laryngeal carcinoma in Xinjiang by Ayiheng and Bogela [17]. While genetic factors are not the decisive elements. Mostly they work together with some environmental factors, such as smoking, alcohol drinking and air pollution to promote the tumors development. According to the results of Li et al., ERCC1 rs11615 and XPG/ERCC5 rs17655 polymorphisms are not the independent risk factors for larynx cancer, but could increase larynx cancer risk in smokers and drinkers [18].
MDM2 can extend cell survival time, and promote cell proliferation and tumor growth. It can block cell cycle, induce cell apoptosis and contribute to DNA repair via MDM2-p53-p21 pathway [19,20]. Additionally, MDM2 forms a feedback system with p53 and a complex regulatory network with other signal transduction pathways to take part in the processes of cell growth inhibition, apoptosis and cell cycle regulation and is related to the occurrence and development of tumors as well as embryonic development and tissue differentiation. MDM2 gene is highly expressed in various tumors [21,22] and it appears to be a biomarker for highly malignant tumor and poor prognosis [23]. Since Bond et al. reported that MDM2 309T/G polymorphism might increase MDM2 protein expression and inhibit the expression of p53 in 2004 [24], the relevance of MDM2 polymorphisms and various tumors has been studied widely [25-27].
Based on the above researches, our research chose MDM2 rs769412 and rs937283 polymorphisms to discuss their relationships with the onset of larynx carcinoma. The GG genotype and G allele of MDM2 rs937283 polymorphism were found in the study to have correlations with the risk of larynx carcinoma in Chinese Han population, while rs769412 had no association with the risk of larynx carcinoma. In present study, the interaction between MDM2 polymorphisms and alcohol drinking was analyzed at the same time. The results showed that both of MDM2 rs937283 and rs769412 were associated the significantly increased risk of larynx carcinoma among drinkers. This result is consistent with previous studies that environmental factors can affect phenotypes based on gene-environment interactions.
In conclusion, MDM2 might be an important candidate proto-oncogene for larynx carcinoma. Like other tumors, laryngeal carcinoma is also a multiplegenes and multi-factor disease, so the mutation of a single locus is not enough to reveal the susceptibility to tumors completely. Our research is the first one to discuss the relationships between MDM2 rs769412 and rs937283 polymorphisms and the susceptibility to laryngeal carcinoma. Also, our study demonstrated that MDM2 polymorphism may work together with environmental factors to promote the occurrence of laryngeal carcinoma. However, the limited SNP locus, ethnic group and sample size may affect the reliability and veracity of results. Therefore, more experiments with multiple genes and larger sample size need to be operated in multi-region to deeply assist the study and explore the pathogenesis of laryngeal carcinoma.
Disclosure of conflict of interest
None.
References
- 1.Mallis A, Jelastopulu E, Mastronikolis NS, Naxakis SS, Kourousis C, Papadas TA. Laryngeal cancer and passive smoking: the neglected factor? Eur Arch Otorhinolaryngol. 2011;268:727–31. doi: 10.1007/s00405-010-1403-z. [DOI] [PubMed] [Google Scholar]
- 2.Leon X, Quer M, Diez S, Orus C, Lopez-Pousa A, Burgues J. Second neoplasm in patients with head and neck cancer. Head Neck. 1999;21:204–10. doi: 10.1002/(sici)1097-0347(199905)21:3<204::aid-hed4>3.0.co;2-7. [DOI] [PubMed] [Google Scholar]
- 3.Tomasino RM, Bazan V, Daniele E, Nuara R, Morello V, Tralongo V, Leto G, Russo A. Biological characterization of laryngeal squamous-cell carcinoma. Anticancer Res. 1996;16:2257–67. [PubMed] [Google Scholar]
- 4.Simsek H, Han U, Onal B, Simisek G. The expression of EGFR, cerbB2, p16, and p53 and their relationship with conventional parameters in squamous cell carcinoma of the larynx. Turk J Med Sci. 2014;44:411–6. [PubMed] [Google Scholar]
- 5.Shen Z, Zhan G, Deng H, Kang C, Guo J. [Growth inhibitory effect of microRNA-519b-3p on larynx squamous Hep-2 cells] . Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 2014;49:151–6. [PubMed] [Google Scholar]
- 6.Chai D, Bao Z, Hu J, Ma L, Feng Z, Tao Y. [Aberrant expression of CyclinE and p27 in laryngeal squamous cell carcinoma and the clinical significance] . Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 2014;28:165–9. 174. [PubMed] [Google Scholar]
- 7.Freedman DA, Wu L, Levine AJ. Functions of the MDM2 oncoprotein. Cell Mol Life Sci. 1999;55:96–107. doi: 10.1007/s000180050273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Yoon YJ, Chang HY, Ahn SH, Kim JK, Park YK, Kang DR, Park JY, Myoung SM, Kim do Y, Chon CY, Han KH. MDM2 and p53 polymorphisms are associated with the development of hepatocellular carcinoma in patients with chronic hepatitis B virus infection. Carcinogenesis. 2008;29:1192–6. doi: 10.1093/carcin/bgn090. [DOI] [PubMed] [Google Scholar]
- 9.Chen B, Xiong MM, Meng XL. Current evidence on the relationship between murine double minute 2 T309G polymorphism and esophageal cancer susceptibility. Dis Esophagus. 2014 doi: 10.1111/dote.12240. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
- 10.Abderrahmane R, Louhibi L, Moghtit FZ, Boubekeur A, Benseddik K, Boudjema A, Benrrahal F, Aberkane M, Fodil M, Saidi-Mehtar N. TP53 Arg 72Pro and MDM2 SNP309 polymorphisms and colorectal cancer risk: a west algerian population study. Pathol Oncol Res. 2014;21:629–635. doi: 10.1007/s12253-014-9867-6. [DOI] [PubMed] [Google Scholar]
- 11.Wang BY, Cao J, Chen JW, Liu QY. Triptolide induces apoptosis of gastric cancer cells via inhibiting the overexpression of MDM2. Med Oncol. 2014;31:270. doi: 10.1007/s12032-014-0270-7. [DOI] [PubMed] [Google Scholar]
- 12.Mairinger FD, Walter RF, Ting S, Vollbrecht C, Kollmeier J, Griff S, Hager T, Mairinger T, Christoph DC, Theegarten D, Kurt Werner S, Wohlschlaeger J. Mdm2 protein expression is strongly associated with survival in malignant pleural mesothelioma. Future Oncol. 2014;10:995–1005. doi: 10.2217/fon.13.261. [DOI] [PubMed] [Google Scholar]
- 13.Kong Q, Li P, Tian Q, Ha MW. Role of MDM2 T309G polymorphism in susceptibility and prognosis of nonsmall cell lung cancer: a meta-analysis. Genet Test Mol Biomarkers. 2014;18:357–65. doi: 10.1089/gtmb.2013.0506. [DOI] [PubMed] [Google Scholar]
- 14.Olshan AF, Weissler MC, Watson MA, Bell DA. GSTM1, GSTT1, GSTP1, CYP1A1, and NAT1 polymorphisms, tobacco use, and the risk of head and neck cancer. Cancer Epidemiol Biomarkers Prev. 2000;9:185–91. [PubMed] [Google Scholar]
- 15.Cui Y, Morgenstern H, Greenland S, Tashkin DP, Mao J, Cao W, Cozen W, Mack TM, Zhang ZF. Polymorphism of Xeroderma Pigmentosum group G and the risk of lung cancer and squamous cell carcinomas of the oropharynx, larynx and esophagus. Int J Cancer. 2006;118:714–20. doi: 10.1002/ijc.21413. [DOI] [PubMed] [Google Scholar]
- 16.Li Q, Liu M. Glutathione S-transferase T1 null genotype and laryngeal cancer risk: a meta-analysis. Tumour Biol. 2014;35:8781–5. doi: 10.1007/s13277-014-2121-8. [DOI] [PubMed] [Google Scholar]
- 17.Ayiheng Q, Bogela A. [Study on laryngeal cancer related on polymorphism of the Arg399Gln of XRCC1 DNA repair gene in different nationalities in Xinjiang] . Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 2013;27:948–51. 954. [PubMed] [Google Scholar]
- 18.Li X, Xu J, Yang X, Wu Y, Cheng B, Chen D, Bai B. Association of single nucleotide polymorphisms of nucleotide excision repair genes with laryngeal cancer risk and interaction with cigarette smoking and alcohol drinking. Tumour Biol. 2014;35:4659–65. doi: 10.1007/s13277-014-1610-0. [DOI] [PubMed] [Google Scholar]
- 19.Wang X, Jiang X. Mdm2 and MdmX partner to regulate p53. FEBS Lett. 2012;586:1390–6. doi: 10.1016/j.febslet.2012.02.049. [DOI] [PubMed] [Google Scholar]
- 20.Kamal A, Mohammed AA, Shaik TB. p53-Mdm2 inhibitors: patent review (2009-2010) Expert Opin Ther Pat. 2012;22:95–105. doi: 10.1517/13543776.2012.656593. [DOI] [PubMed] [Google Scholar]
- 21.Qi XW, Wu HR, Yin Y, Xia SH, Feng JJ, Pu Y, Jin LF. Studies on expression of p14ARF and MDM2 in human thyroid neoplasms. Panminerva Med. 2015;57:43–7. [PubMed] [Google Scholar]
- 22.Chang YT, Huang CS, Yao CT, Su SL, Terng HJ, Chou HL, Chou YC, Chen KH, Shih YW, Lu CY, Lai CH, Jian CE, Lin CH, Chen CT, Wu YS, Lin KS, Wetter T, Chang CW, Chu CM. Gene expression profile of peripheral blood in colorectal cancer. World J Gastroenterol. 2014;20:14463–71. doi: 10.3748/wjg.v20.i39.14463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ohmiya N, Taguchi A, Mabuchi N, Itoh A, Hirooka Y, Niwa Y, Goto H. MDM2 promoter polymorphism is associated with both an increased susceptibility to gastric carcinoma and poor prognosis. J. Clin. Oncol. 2006;24:4434–40. doi: 10.1200/JCO.2005.04.1459. [DOI] [PubMed] [Google Scholar]
- 24.Bond GL, Hu W, Bond EE, Robins H, Lutzker SG, Arva NC, Bargonetti J, Bartel F, Taubert H, Wuerl P, Onel K, Yip L, Hwang SJ, Strong LC, Lozano G, Levine AJ. A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell. 2004;119:591–602. doi: 10.1016/j.cell.2004.11.022. [DOI] [PubMed] [Google Scholar]
- 25.Meng X, Franklin DA, Dong J, Zhang Y. MDM2-p53 pathway in hepatocellular carcinoma. Cancer Res. 2014;74:7161–7. doi: 10.1158/0008-5472.CAN-14-1446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Zhang X, Pageon L, Post SM. Impact of the Mdm2 allele on a murine model of colorectal cancer. Oncogene. 2014 doi: 10.1038/onc.2014.377. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
- 27.Sheng W, Dong M, Zhou J, Li X, Liu Q, Dong Q, Li F. [The relationship and clinicopathological significance of Numb,MDM2 and p53 expression in human pancreatic cancer] . Zhonghua Wai Ke Za Zhi. 2014;52:675–81. [PubMed] [Google Scholar]