Skip to main content
Frontiers in Microbiology logoLink to Frontiers in Microbiology
. 2015 Aug 6;6:807. doi: 10.3389/fmicb.2015.00807

RETRACTED: The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

Miguel A De la Cruz 1,, Deyanira Pérez-Morales 2,, Irene J Palacios 2, Marcos Fernández-Mora 2, Edmundo Calva 2, Víctor H Bustamante 2,*
PMCID: PMC4526804  PMID: 26300871

Abstract

Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella.

Keywords: Salmonella, SPI, CpxR/A, HilD, Lon, regulation, RpoH, virulence

Introduction

Salmonella enterica groups Gram-negative bacteria comprising around 2500 serotypes, which can infect a wide variety of hosts ranging from humans to birds (Haraga et al., 2008; Sánchez-Vargas et al., 2011). Acquisition of DNA fragments by horizontal transfer and the ensuing adaptation of regulatory mechanisms to control the expression of the newly acquired genes have been pivotal events in the Salmonella pathogenicity evolution (Schmidt and Hensel, 2004; Fàbrega and Vila, 2013). Around 30% of the S. enterica genome has been shaped by horizontal transfer events; most of the acquired genes are clustered in regions denominated islands (Mcclelland et al., 2001; Porwollik and Mcclelland, 2003). Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2), which are chromosomal regions composed of 39 and 44 genes, respectively, have crucial roles in the pathogenesis of Salmonella (Hansen-Wester and Hensel, 2001; Haraga et al., 2008; Fàbrega and Vila, 2013). SPI-1 is conserved in the two Salmonella species, enterica and bongori, whereas SPI-2 is only present in S. enterica, suggesting that SPI-1 was acquired earlier than SPI-2 during the evolution of Salmonella pathogenicity (Groisman and Ochman, 1997; Porwollik and Mcclelland, 2003). Both SPI-1 and SPI-2 encode a type 3 secretion system (T3SS), different effector proteins, chaperones, and transcriptional regulators that control the expression of the genes within each island (Hansen-Wester and Hensel, 2001; Haraga et al., 2008; Fàbrega and Vila, 2013). The T3SSs are highly complex needle-like nanomachines formed by more than 20 proteins, which span the inner and outer membrane of the bacteria and thus are able to inject effector proteins from the bacterial cytoplasm into the eukaryotic cytosol; once inside the host cell, effector proteins translocated by their cognate T3SS manipulate different signal transduction pathways and induce rearrangement of the host cell cytoskeleton (Moest and Méresse, 2013; Abrusci et al., 2014; Diepold and Wagner, 2014). The T3SS-1 and effector proteins encoded in SPI-1 are necessary for Salmonella invasion of intestinal epithelial cells, and thus for the intestinal colonization leading to enteritis; whereas the T3SS-2 and effector proteins encoded in SPI-2 are mainly required for Salmonella survival and replication inside macrophages, and hence for the systemic disease (Hansen-Wester and Hensel, 2001; Haraga et al., 2008; Fàbrega and Vila, 2013; Moest and Méresse, 2013). Different studies have shown that the SPI-2 genes also induce a Salmonella non-proliferative life style inside phagocytes and non-phagocytic cells (Grant et al., 2012; Núñez-Hernández et al., 2014) and that they contribute to the development of the intestinal inflammatory disease (Bispham et al., 2001; Coburn et al., 2005; Coombes et al., 2005). S. enterica serovar Typhimurium (S. Typhimurium) can cause self-limiting enteritis in humans, chickens and calves, while in mice it produces a systemic infection similar to the typhoid fever caused by S. Typhi in humans (Haraga et al., 2008; Sánchez-Vargas et al., 2011). Since S. Typhimurium can cause both intestinal and systemic infections in different hosts, it is widely used as a model to study the molecular virulence mechanisms of Salmonella.

The expression of the SPI-1 and SPI-2 genes is induced in different in vivo and in vitro growth conditions. In vivo, the SPI-1 genes are mainly expressed when Salmonella is in the intestinal lumen, associated with the epithelium or with extruding enterocytes (Laughlin et al., 2014), and also in a Salmonella subpopulation that replicates in the cytosol of epithelial cells (Knodler et al., 2010). In contrast, the SPI-2 genes are mainly expressed when Salmonella is inside epithelial cells or macrophages, within vacuoles (Cirillo et al., 1998; Deiwick et al., 1999; Eriksson et al., 2003; Knodler et al., 2010), and also when Salmonella is in the intestinal lumen (Brown et al., 2005), in the lamina propria or in the underlying mucosa (Laughlin et al., 2014). In vitro, the SPI-1 and SPI-2 genes are both expressed when Salmonella is grown in nutrient-rich media, such as the Luria-Bertani (LB) medium, albeit they are differentially regulated by growth phase (Lundberg et al., 1999; Miao and Miller, 2000; Bustamante et al., 2008; Kröger et al., 2013). Moreover, the expression of the SPI-2 genes is also induced when Salmonella is grown in acidic minimal media containing low concentrations of phosphate, calcium, and magnesium (Deiwick et al., 1999; Miao and Miller, 2000; Kröger et al., 2013).

SPI-1 encodes the transcriptional regulators HilD, HilA and InvF, which induce the expression of the genes within this island in a cascade fashion (Golubeva et al., 2012; Fàbrega and Vila, 2013). HilD, a member of the AraC family of transcriptional regulators, induces the expression of HilA (Schechter et al., 1999; Schechter and Lee, 2001; Ellermeier et al., 2005), an OmpR/ToxR-like transcriptional regulator, which in turn, activates the expression of InvF (Lostroh et al., 2000; Lostroh and Lee, 2001), another AraC-like regulator. HilA directly activates the expression of genes encoding T3SS-1 components, whereas InvF induces the expression of SPI-1 genes encoding effector proteins (Golubeva et al., 2012; Fàbrega and Vila, 2013). Furthermore, HilD regulates directly, or indirectly, through HilA and InvF, the expression of several other genes located outside SPI-1, including acquired and ancestral genes (Bustamante et al., 2008; Golubeva et al., 2012; Fàbrega and Vila, 2013; Petrone et al., 2014; Singer et al., 2014). Interestingly, when S. Typhimurium is grown to late stationary phase in LB medium, HilD directly induces the expression of the ssrAB operon that is located in SPI-2 and codes for the SsrA/B two-component system, the central positive regulator of the SPI-2 genes, thus establishing a transcriptional cross talk between SPI-1 and SPI-2 (Bustamante et al., 2008; Martínez et al., 2014).

Many Salmonella-specific and global regulators have been involved in the expression of the SPI-1 and SPI-2 genes, which mainly act on the expression of hilD, hilA, or ssrAB (Fass and Groisman, 2009; Martínez et al., 2011; Golubeva et al., 2012; Fàbrega and Vila, 2013). Notably, according to its role as a central regulator of the SPI-1 and several other virulence genes, the expression, concentration and activity of HilD is highly controlled. At the transcriptional level, the expression of hilD is positively autoregulated and modulated by a feed-forward regulatory loop involving HilD itself and the AraC-like regulators HilC and RtsA (Olekhnovich and Kadner, 2002; Ellermeier et al., 2005; Golubeva et al., 2012), while post-transcriptionally it is positively controlled by a regulatory cascade integrated by the SirA/BarA and Csr global regulatory systems (Martínez et al., 2011). On the other hand, HilD activity is positively regulated by FliZ and Fur, through still unknown mechanisms (Ellermeier and Slauch, 2008; Chubiz et al., 2010), as well as negatively regulated by HilE, through protein-protein interactions (Baxter et al., 2003). Moreover, the cellular concentration of HilD is controlled by the Lon protease (Takaya et al., 2005).

One of the regulators that have been involved in the expression of the SPI-1 genes is CpxA, the sensor histidine kinase of the Cpx-envelope stress two-component system (Nakayama et al., 2003). CpxA phosphorylates its cognate response regulator CpxR in response to a broad range of stimuli that cause perturbations in the cell envelope, such as pH, salt, metals, lipids and misfolded proteins; whereas in the absence of these activating signals CpxA has phosphatase activity on CpxR (Hunke et al., 2012; Vogt and Raivio, 2012; Raivio, 2014). CpxR can also be phosphorylated independently of CpxA by acetyl phosphate, which is generated in vivo from acetyl-CoA by the phosphotransacetylase (Pta) and acetate kinase (AckA) enzymes (Raivio and Silhavy, 1997; Wolfe et al., 2008). Phosphorylated CpxR (CpxR-P) positively or negatively regulates many genes encoding protein folding and degrading factors, peptidoglycan metabolic enzymes, inner membrane proteins, envelope-localized protein complexes, and other cellular regulators (Hunke et al., 2012; Vogt and Raivio, 2012; Raivio, 2014). Additionally, the Cpx system has been involved in the expression of virulence genes in different pathogenic bacteria, such as enteropathogenic and uropathogenic Escherichia coli, Yersinia, Shigella, Legionella, Haemophilus and Salmonella (Hunke et al., 2012; Vogt and Raivio, 2012; Raivio, 2014). In S. Typhimurium, deletion of cpxA, but not cpxR, decreases the expression of the SPI-1 genes and, as a consequence, reduces Salmonella invasion into host cells (Nakayama et al., 2003). Therefore, on the basis of these results, it was suggested that CpxA positively regulates the SPI-1 genes through regulator(s) other than CpxR (Nakayama et al., 2003).

In this work, we determined that the absence of CpxA renders activation of CpxR via the AckA-Pta pathway, which represses the expression of the SPI-1 genes. Consistently, it was found that CpxR-P generated by the activation of CpxA, or the overexpression of CpxR, also represses the expression of these genes. Our results indicate that CpxR negatively controls the expression of the SPI-1 genes, as well as genes located in SPI-2, by repressing the autoregulation of HilD, a central positive regulator for the expression of the genes within SPI-1 and SPI-2 and other virulence genes. Furthermore, we found that activation of CpxR decreases the stability of HilD and that, in the absence of the Lon protease, which degrades HilD, the CpxR-mediated repression of the SPI-1 genes is mostly lost. Thus, our data clarify and expand the regulatory role of the two-component system CpxR/A for the expression of S. Typhimurium virulence genes.

Materials and methods

Bacterial strains, media, and culture conditions

Bacterial strains used in this study are listed in Table 1. Bacterial cultures were grown at 37°C in LB medium containing 1% tryptone, 0.5% yeast agar and 1% NaCl, pH 7.5. When necessary, media were supplemented with ampicillin (200 μg ml−1), kanamycin (20 μg ml−1) or chloramphenicol (30 μg ml−1). Cultures for chloramphenicol acetyltransferase (CAT), Western blot and protein secretion assays were performed as we described previously (Bustamante et al., 2008; Martínez et al., 2011).

Table 1.

Bacterial strains and plasmids used in this study.

Strain or plasmid Genotype or description References or sources
S. TYPHIMURIUM STRAINS
14028s Wild-type ATCC
DTM48 ΔcpxR::kan This study
DTM49 ΔcpxR This study
DTM50 ΔcpxA::kan This study
DTM51 ΔcpxA This study
DTM52 ΔcpxRA::kan This study
DTM53 ΔcpxRA This study
DTM54 ΔackA-pta::kan This study
DTM55 ΔcpxA ΔackA-pta::kan This study
DTM56 ΔhilE::kan This study
DTM57 ΔhilE This study
DTM58 ΔcpxA ΔhilE::kan This study
DTM59 ΔcpxA ΔhilE This study
DTM60 Δlon::kan This study
DTM61 Δlon This study
DTM62 ΔcpxA Δlon::kan This study
DTM63 ΔcpxA Δlon This study
JPTM5 SL1344 ΔhilD::kan Bustamante et al., 2008
DTM64 14028s ΔhilD::kan This study
DTM65 ΔhilD This study
DTM66 ΔhilD ΔcpxA::kan This study
DTM67 ΔhilD Δlon::kan This study
JPTM7 SL344 hilA::3XFLAG-kan Bustamante et al., 2008
DTM68 14028s hilA::3XFLAG-kan This study
DTM69 ΔcpxR hilA::3XFLAG-kan This study
DTM70 ΔcpxA hilA::3XFLAG-kan This study
DTM71 ΔcpxRA hilA::3XFLAG-kan This study
JPTM30 SL1344 ssrB::3XFLAG-kan Martínez et al., 2011
DTM72 14028s ssrB::3XFLAG-kan This study
DTM73 ΔcpxR ssrB::3XFLAG-kan This study
DTM74 ΔcpxA ssrB::3XFLAG-kan This study
DTM75 ΔcpxRA ssrB::3XFLAG-kan This study
DTM76 14028s invF::3XFLAG-kan This study
DTM77 ΔcpxR invF::3XFLAG-kan This study
DTM78 ΔcpxA invF::3XFLAG-kan This study
DTM79 ΔcpxRA invF::3XFLAG-kan This study
DTM80 ΔhilE invF::3XFLAG-kan This study
DTM81 ΔcpxA ΔhilE invF::3XFLAG-kan This study
DTM82 Δlon invF::3XFLAG-kan This study
DTM83 ΔcpxA Δlon invF::3XFLAG-kan This study
MF100 14028s ΔCthns::kan (lacking codons 99–136 of hns) Fernández-Mora, personal communication
DTM84 ΔhilD ΔCthns::kan This study
E.COLI K12 STRAIN
DH10β Laboratory strain Invitrogen
PLASMIDS
pKK232-8 pBR322 derivative containing a promoterless chloramphenicol acetyltransferase (cat) gene, ApR Brosius, 1984
philD-cat pKK232-8 derivative containing a hilD-cat transcriptional fusion from nucleotides −364 to +88 Bustamante et al., 2008
philA-cat pKK232-8 derivative containing a hilA-cat transcriptional fusion from nucleotides −410 to +446 Bustamante et al., 2008
pinvF-cat pKK232-8 derivative containing a invF-cat transcriptional fusion from nucleotides −306 to +213 Bustamante et al., 2008
psirA-cat pKK232-8 derivative containing a sirA-cat transcriptional fusion from nucleotides −563 to +98 Martínez et al., 2011
plon-cat pKK232-8 derivative containing a lon-cat transcriptional fusion from nucleotides −296 to +61 This study
pclpX-cat pKK232-8 derivative containing a clpX-cat transcriptional fusion from nucleotides −330 to +76 This study
pclpP-cat pKK232-8 derivative containing a clpP-cat transcriptional fusion from nucleotides −335 to +57 This study
pcpxRA-cat pKK232-8 derivative containing a cpxRA-cat transcriptional fusion from nucleotides −544 to +57 This study
pCA24N High-copy-number cloning vector, lac promoter, lacIq, CmR Kitagawa et al., 2005
pCA-NlpE pCA24N derivative expressing E. coli K12 NlpE from the lac promoter Kitagawa et al., 2005
pCA-CpxR pCA24N derivative expressing E. coli K12 CpxR from the lac promoter Kitagawa et al., 2005
pMPM-K3 p15A derivative low-copy-number cloning vector, lac promoter, KanR Mayer, 1995
pK3-CpxR pMPM-K3 derivative expressing S. Typhimurium 14028s CpxR from the lac promoter This study
pK3-RpoH pMPM-K3 derivative expressing S. Typhimurium 14028s RpoH from the lac promoter This study
pBAD-HilD pBADMycHis derivative expressing HilD-MycHis from the ara promoter Martínez et al., 2011
pKD46 pINT-ts derivative containing red recombinase system under an arabinose-inducible promoter, ApR Datsenko and Wanner, 2000
pKD4 pANTsγ derivative template plasmid containing the kanamycin cassette for λ Red recombination, ApR Datsenko and Wanner, 2000
pCP20 Plasmid expressing FLP recombinase from a temperature-inducible promoter, ApR Datsenko and Wanner, 2000
pSUB11 pGP704 derivative template plasmid for FLAG epitope tagging Uzzau et al., 2001

The coordinates for the cat fusions are indicated with respect to the transcriptional start site for each gene. ApR, ampicillin resistance; CmR, chloramphenicol resistance; KanR, kanamycin resistance.

Construction of plasmids

Plasmids and primers used in this study are listed in Tables 1, 2, respectively. To construct the plasmids containing the transcriptional fusions lon-cat, clpX-cat, clpP-cat and cpxRA-cat, the regulatory regions of lon, clpX, clpP, and cpxRA were amplified by PCR with the primer pairs promlon-Fw1/promlon-Rv1, pClpX-Bam/pClpX-Hind, pClpXP-Bam/pClpXP-Hind and CpxR-Bam-5′/CpxR-Hind-3′, respectively. The PCR products were digested with BamHI and HindIII restriction enzymes and then cloned into the BamHI and HindIII sites of the vector pKK232-8, which carries a promoterless cat gene (Amersham Pharmacia LKB Biotechnology), generating plasmids plon-cat, pclpX-cat, pclpP-cat, and pcpxRA-cat. To construct the plasmids pK3-CpxR and pK3-RpoH, the cpxR and rpoH genes were amplified by PCR using primer pairs CpxR-Fw1/CpxR-Rv1 and RpoH-FwKpn/RpoH-RvBam, respectively. The PCR products were digested with HindIII and BamHI (cpxR gene) or KpnI and BamHI (rpoH gene) restriction enzymes and then cloned into the vector pMPM-K3 (Mayer, 1995) digested with the respective restriction enzymes. pK3-CpxR and pK3-RpoH constitutively express CpxR and RpoH, respectively, under a lac promoter, since Salmonella and the vector pMPM-K3 lack the gene encoding LacI, the repressor of lac.

Table 2.

Primers used in this study.

Primer Sequence (5′-3′) Target gene RE
FOR CAT TRANSCRIPTIONAL FUSIONS
promlon-Fw1 GTCGGATCCTGCCGGTCAGAGTAAGCCG lon BamHI
promlon-Rv1 TACAAGCTTGGGTATGACCATGTGCGG HindIII
pClpX-Bam TCAGGATCCTGAGCAGATTGAACGTGATAC clpX BamHI
pClpX-Hind GAAAGCTTCGGATGGACCGGCAATCAG HindIII
pClpXP-Bam GATGGATCCTATGCGTAACGTCGCTCTGG clpP BamHI
pClpXP-Hind GAGAAGCTTTATCAAAAGAGCGCTCACCG HindIII
CpxR-Bam-5′ TTGGGATCCCGCCACGTCGCGC cpxRA BamHI
CpxR-Hind-3′ ATCAAGCTTCTTTAACAGGATTTTATTC HindIII
FOR GENE CLONING
CpxR-Fw1 TGAAAGCTTTTTCTGCCTCGGAGGTACG cpxR HindIII
CpxR-Rv1 CAGGGATCCCGTCAACCAGAAGATGGCG BamHI
RpoH-FwKpn ACGGTACCAGGCAATACTGATTGA rpoH KpnI
RpoH-RvBam CATGGATCCAACAGATTTGTGTCGGTGGG BamHI
FOR GENE DELETIONS
ScpxR-H1PI GATGACCGAGAGCTGACTTCCCTGTT
AAAAGAGCTCCTCGAATGTAGGCTGG
AGCTGCTTCG cpxR
ScpxR-H2P2 TGTTTTAAACCACGGGTGACCGTCTTT
GCGTTCCGGCAGTTTCATATGAATATC
CTCCTTAG
ScpxA-H1P1 CTATCTGATGGTTTCCGCTTCATGATAG
GAAGTTTAACCGCGTGTAGGCTGGAGC
TGCTTCG cpxA
ScpxA-H2P2 GCATTCGCAGGCCGATGGTTTTTAGGTT
CGCTTGTACAGCGGCATATGAATATCCT
CCTTAG
SackA-pta-H1P1 GTATCATAAATAGGTACTTCCATGTCGA
GTAAGTTAGTACTGTGTAGGCTGGAGCT
GCTTCG ackA-pta
SackA-pta-H2P2 ATCCGGCATTAGCTTTTACTGTTACTGC
TGCTGCTGAGAAGCCATATGAATATCCT
CCTTAG
ShilE-H1P1 TACAGAGACACCAACGAAATGGCTGG
AAAATGGAACGTTCTTTGTAGGCTGGA
GCTGCTTCG hilE
ShilE-H2P2 CGCAAGCTTGTTTTGTCCTCATCGCCA
CAGCGCCTGTCGGTGCATATGAATATC
CTCCTTAG
SlonH1P1 AAACTAAGAGAGAGCTCTATGAATCCT
GAGCGTTCTGAACGCTGTAGGCTGGA
GCTGCTTCG lon
SlonH2P2 GTCATTTGCGCGAGGTCACTATTTTGC
GGTTACAACCTGCATCATATGAATATC
CTCCTTAG
FOR GENE FLAG TAGGING
invFflag-F CCGCGGAAATTATCAAATATTATTCAAT
TGGCAGACAAAGACTACAAAGACCATG
ACGGT invF
invFflag-R CGGCACATGCCAGCACTCTGGCCAAAA
GAATATGTGTCTCATATGAATATCCTCCT
TAGTTC

Italic letters indicate the respective restriction enzyme site in the primer. The sequence corresponding to the template plasmids pKD4 or pSUB11 is underlined. RE, restriction enzyme for which a site was generated in the primer.

Construction of deletion mutants and strains expressing FLAG-tagged proteins

Non-polar gene-deletion mutant strains were generated by the λRed recombinase system, as reported previously (Datsenko and Wanner, 2000), using the respective primers described in Table 2. The genes cpxR, cpxA, cpxRA, ackA-pta, hilE, or lon were replaced with a selectable kanamycin resistance cassette in the S. Typhimurium strain 14028s, generating the ΔcpxR::kan (DTM48), ΔcpxA::kan (DTM50), ΔcpxRA::kan (DTM52), ΔackA-pta::kan (DTM54), ΔhilE::kan (DTM56) and Δlon::kan (DTM60) mutants, respectively. The kanamycin resistance cassette was excised from the ΔcpxR::kan (DTM48), ΔcpxA::kan (DTM50), ΔcpxRA::kan (DTM52), ΔhilE::kan (DTM56), ΔcpxA ΔhilE::kan (DTM58), Δlon::kan (DTM60), ΔcpxA Δlon::kan (DTM62) and ΔhilD::kan (DTM64) mutants, by using helper plasmid pCP20, expressing the FLP recombinase, as described previously (Datsenko and Wanner, 2000), generating the ΔcpxR (DTM49), ΔcpxA (DTM51), ΔcpxRA (DTM53), ΔhilE (DTM57), ΔcpxA ΔhilE (DTM59), Δlon (DTM61), ΔcpxA Δlon (DTM63) and ΔhilD (DTM65) mutants, respectively. P22 transduction was used to transfer the ΔhilD::kan allele from strain JPTM5 into strain 14028s, generating strain DTM64, to transfer the ΔackA-pta::kan, ΔhilE::kan or Δlon::kan alleles from strains DTM54, DTM56 and DTM60 into strain DTM51, generating the ΔcpxA ΔackA-pta::kan (DTM55), ΔcpxA ΔhilE::kan (DTM58) and ΔcpxA Δlon::kan (DTM62) mutants, respectively, to transfer the ΔcpxA::kan or Δlon::kan alleles from strains DTM50 or DTM60 into strain DTM65, generating the ΔhilD ΔcpxA::kan (DTM66) and ΔhilD Δlon::kan (DTM67) mutants, respectively, and to transfer the ΔCthns::kan allele from strain MF100 into strain DTM65, generating the ΔhilD ΔCthns::kan (DTM84) mutant.

The chromosomal invF gene was FLAG-tagged in S. Typhimurium strain 14028s, using a modification of the λ Red recombinase system for gene replacement, as described previously (Uzzau et al., 2001), and the respective primers described in Table 2, generating strain DTM76. P22 transduction was used to transfer the invF::3XFLAG-kan allele from strain DTM76 into strains DTM49, DTM51, DTM53, DTM57, DTM59, DTM61 and DTM63, generating the ΔcpxR invF::3XFLAG-kan (DTM77), ΔcpxA invF::3XFLAG-kan (DTM78), ΔcpxRA invF::3XFLAG-kan (DTM79), ΔhilE invF::3XFLAG-kan (DTM80), ΔcpxA ΔhilE invF::3XFLAG-kan (DTM81), Δlon invF::3XFLAG-kan (DTM82) and ΔcpxA Δlon invF::3XFLAG-kan (DTM83) mutants, respectively, to transfer the hilA::3XFLAG-kan allele from strain JPTM7 into strains 14028s, DTM49, DTM51 and DTM53, generating the hilA::3XFLAG-kan (DTM68), ΔcpxR hilA::3XFLAG-kan (DTM69), ΔcpxA hilA::3XFLAG-kan (DTM70) and ΔcpxRA hilA::3XFLAG-kan (DTM71) mutants, respectively, and to transfer the ssrB::3XFLAG-kan allele from strain JPTM30 into strains 14028s, DTM49, DTM51 and DTM53, generating the ssrB::3XFLAG-kan (DTM72), ΔcpxR ssrB::3XFLAG-kan (DTM73), ΔcpxA ssrB::3XFLAG-kan (DTM74) and ΔcpxRA ssrB::3XFLAG-kan (DTM75) mutants, respectively. All mutant strains were verified by PCR amplification and sequencing.

CAT assays

The CAT assays and protein quantification to calculate CAT specific activities were performed as described previously (Puente et al., 1996).

Statistical analysis

Results from chloramphenicol acetyltransferase (CAT) assays were analyzed using One-Way analysis of variance (ANOVA) with the Dunnett multiple comparison test for Figures 1A,D, or t-Test with the Mann–Whitney test for Figures 4A–D, 7B,C. A P-value of < 0.05 was considered significant. This statistical analysis was performed using Prism 5 program version 5.04 (GraphPad Software, San Diego, CA).

Figure 1.

Figure 1

The absence of CpxA represses SPI-1 genes by the activation of CpxR via the AckA and Pta enzymes. (A) Expression of the invF-cat and sirA-cat transcriptional fusions, carried by plasmids pinvF-cat and psirA-cat, respectively, was tested in the WT S. Typhimurium 14028s strain and its isogenic ΔcpxA, ΔcpxR, ΔcpxRA, ΔackA-pta, and ΔcpxA ΔackA-pta mutants. (B) Secretion analysis of the SPI-1-encoded proteins SipA, SipB, SipC, and SipD was tested in the WT S. Typhimurium strain 14028s and its isogenic ΔcpxA, ΔcpxR, ΔcpxRA, ΔackA-pta, and ΔcpxA ΔackA-pta mutants grown for 9 h in LB medium at 37°C. FliC is a flagellar protein whose secretion is SPI-1-independent. (C) Expression of the SPI-1-encoded HilA-FLAG and InvF-FLAG and the SPI-2-encoded SsrB-FLAG and SseB, in the WT S. Typhimurium strain and its isogenic ΔcpxR, ΔcpxA and ΔcpxRA mutants, carrying the respective chromosomal FLAG-tagged gene, was analyzed by Western blotting using monoclonal anti-FLAG or polyclonal anti-SseB antibodies. Whole cell lysates were prepared from samples of bacterial cultures grown in LB medium at 37°C for 5 or 9 h, for detection of SPI-1- and SPI-2-encoded proteins, respectively. As a loading control, the expression of DnaK was also determined using monoclonal anti-DnaK antibodies. (D) Expression of the cpxRA-cat transcriptional fusion, carried by plasmid pcpxRA-cat, was tested in the WT S. Typhimurium 14028s strain and its isogenic ΔcpxR, ΔcpxA, ΔcpxRA, and ΔhilD ΔcpxA mutants. CAT-specific activity of cat fusions was determined from samples collected of bacterial cultures grown for 5 h in LB medium at 37°C. The data are the averages of three different experiments performed in duplicate. Bars represent the standard deviations. *Expression statistically different with respect to that shown by the same fusion in the WT strain.

Protein secretion analysis

Protein secretion assays were performed as we described previously (Martínez et al., 2011). Samples were subjected to SDS-PAGE analysis using 12% polyacrylamide gels and stained with Coomassie Brilliant Blue R-250.

Western blotting

Whole-cell extracts were prepared from samples collected at the indicated time points of bacterial cultures. Ten micrograms of each extract were subjected to electrophoresis in SDS-12% polyacrylamide gels, and then transferred to 0.45 μm pore size nitrocellulose membranes (Bio-Rad), using a semidry transfer apparatus (Bio-Rad). Membranes were blocked with 5% nonfat milk and then incubated with anti-c-Myc (Sigma), anti-FLAG M2 (Sigma) or anti-DnaK (StressGen) monoclonal antibodies, or anti-SseB polyclonal antibody (Coombes et al., 2004), at 1:3000, 1:4000, 1:20,000 and 1:2000 dilutions, respectively. Horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Pierce), at a dilution of 1:10,000, were used as the secondary antibodies. Bands on the blotted membranes were developed by incubation with the Western Lightning Chemiluminescence Reagent Plus (Perkin-Elmer) and exposed to Kodak X-Omat films.

HilD protein stability assays

Bacterial strains were grown in LB medium at 37°C to an OD600 equal to 0.8. Then, the expression of HilD-Myc from plasmid pBAD-HilD was induced by adding 0.05% L-arabinose for 45 min. After this time, antibiotics streptomycin, rifampicin and chloramphenicol, at final concentrations of 200, 100 and 200 μg ml−1, respectively, were added to the cultures to prevent transcription and translation. To ensure repression of the ara promoter expressing HilD-Myc, 2% glucose was also added. The bacterial cultures were further incubated at 37°C and samples were taken at 0, 15, 30, 60, 90 and 120 min, and analyzed by Western blotting as described above. Intensity of protein bands from the blots was quantified by using ImageJ software (Image Processing and Analysis in Java), version 1.48 (National Institutes of Health, USA). Values for HilD-Myc bands were normalized with those respective of DnaK bands and then the relative percentage of HilD-Myc at each time with respect to time 0 was calculated. The HilD half-life (t1∕2) was calculated by linear regression.

Results

AckA-Pta-dependent activation of CpxR represses the SPI-1 genes

Intriguingly, the absence of the histidine kinase CpxA, but not its cognate response regulator CpxR, negatively affects the expression of SPI-1 genes, which could suggest that CpxA positively regulates the SPI-1 genes by interacting with regulator(s) other than CpxR (Nakayama et al., 2003). However, there was the possibility that the absence of CpxA, and thus of its phosphatase activity, could lead to the phosphorylation of CpxR, mainly by acetyl phosphate produced by the AckA and Pta enzymes, as described previously (Batchelor et al., 2005; Spinola et al., 2010; Liu et al., 2012). Therefore, an alternative to the proposed positive regulatory role of CpxA on SPI-1 genes, was that CpxR-P generated in the absence of CpxA could actually repress these genes. To investigate this possibility, we tested the expression of a transcriptional fusion of the SPI-1 gene invF with the cat (chloramphenicol acetyl transferase) reporter gene, in wild-type (WT) S. Typhimurium strain 14028s, as well as in different derivative mutants containing single, double or triple deletions of cpxA, cpxR, ackA, or pta genes. As a control, the expression of a cat transcriptional fusion of sirA, which encodes a positive regulator of the SPI-1 genes that is located outside SPI-1, was also assessed. In agreement with the results reported previously (Nakayama et al., 2003), the expression of the invF-cat fusion was reduced in the ΔcpxA mutant, but was not affected in the ΔcpxR mutant (Figure 1A). Additionally, the expression of this fusion was not affected in the ΔcpxRA or ΔackA-pta double mutants neither in the ΔcpxA ΔackA-pta triple mutant, whereas the sirA-cat fusion was expressed at a similar level in all strains tested (Figure 1A). Consistently, protein secretion analyses showed that the secretion/expression of the SPI-1-encoded proteins SipA, SipB, SipC, and SipD was drastically diminished in the ΔcpxA mutant, but not in the ΔcpxR, ΔcpxRA, ΔackA-pta or ΔcpxA ΔackA-pta mutants (Figure 1B). Furthermore, the expression of the 3xFLAG-tagged regulators HilA (HilA-FLAG) and InvF (InvF-FLAG), which are encoded in SPI-1, was reduced in the ΔcpxA mutant, but not in the ΔcpxR or ΔcpxRA mutants (Figure 1C). These results show that deletion of cpxR or the ackA-pta genes restores the expression of the SPI-1 genes in the ΔcpxA mutant, indicating that the absence of CpxA actually represses these genes through CpxR and the AckA/Pta enzymes.

Previous studies have shown that CpxR-P activates the expression of the cpxRA operon (De Wulf et al., 1999; Raivio et al., 1999, 2013; Price and Raivio, 2009). Therefore, to further investigate whether the absence of CpxA turns on CpxR-mediated gene regulation in S. Typhimurium, in the growth conditions tested, we determined the expression of a cpxRA-cat transcriptional fusion in the WT S. Typhimurium strain and its derivative ΔcpxR, ΔcpxA, and ΔcpxRA mutants. As shown in Figure 1D, the expression of the cpxRA-cat fusion was increased in the ΔcpxA mutant, but not in the ΔcpxR and ΔcpxRA mutants, indicating that the absence of CpxA induces the expression of the cpxRA operon through CpxR.

Together, these results strongly support that the absence of CpxA leads to the phoshorylation of CpxR via the AckA-Pta pathway, which in turn represses the expression of the SPI-1 genes and probably induces the positive or negative regulation of the whole CpxR regulon.

CpxA-dependent activation or overexpression of CpxR represses the SPI-1 genes

Overproduction of the lipoprotein NlpE activates the kinase activity of CpxA and thus the CpxA-dependent phosphorylation of CpxR (Snyder et al., 1995; Hunke et al., 2012; Vogt and Raivio, 2012). Hence, to determine whether the CpxA-mediated activation of CpxR also represses the expression of the SPI-1 genes, we examined the effect of the overexpression of NlpE, from an IPTG-inducible promoter, on the protein secretion profiles of the WT S. Typhimurium strain and its derivative ΔcpxR mutant. Since Salmonella lacks NlpE, the E. coli K12 NlpE was used in these assays. As shown in Figure 2, the induction of the NlpE expression by the presence of IPTG decreased the secretion/expression of the SipA-D proteins in the WT strain but not in its derivative ΔcpxR mutant, indicating that the activation of CpxA represses the secretion/expression of SPI-1-encoded proteins through CpxR. To further confirm the regulatory role of CpxR on the SPI-1 genes, we determined the effect of its overexpression on the protein secretion profile of the WT S. Typhimurium strain, since the overexpression can bypass the need for phosphorylation of CpxR to regulate target genes (Macritchie et al., 2008; Acosta et al., 2015; Yun et al., 2015). The E. coli K12 CpxR is 97% identical to that of S. Typhimurium 14028s; thus, the plasmid pCA-CpxR from the ASKA library (Kitagawa et al., 2005), which expresses the E. coli K12 CpxR from an IPTG-inducible promoter, was used in these assays. As shown in Figure 3A, the overexpression of CpxR reduced the secretion/expression of the SipA-D proteins. Furthermore, the overexpression of CpxR repressed the expression of HilA-FLAG and InvF-FLAG in the WT S. Typhimurium strain (Figure 3B). In all, these results indicate that CpxA-mediated phosphorylation of CpxR or the overexpression of CpxR represses the expression of the SPI-1 genes.

Figure 2.

Figure 2

NlpE-mediated activation of CpxA represses SPI-1 through CpxR. Secretion analysis of the SPI-1-encoded proteins SipA, SipB, SipC, and SipD was tested in the WT S. Typhimurium strain and its isogenic ΔcpxR mutant carrying plasmid pCA-NlpE, grown for 9 h in LB medium at 37°C. FliC is a flagellar protein whose secretion is SPI-1-independent. Expression (+) of NlpE from the T5-lac promoter of plasmid pCA-NlpE was induced by adding 50 μM IPTG at the beginning of the bacterial cultures.

Figure 3.

Figure 3

Overexpression of CpxR represses SPI-1 and SPI-2 genes. (A) Secretion analysis of the SPI-1-encoded proteins SipA, SipB, SipC, and SipD was tested in the WT S. Typhimurium strain carrying plasmid pCA-CpxR, grown for 9 h in LB medium at 37°C. FliC is a flagellar protein whose secretion is SPI-1-independent. (B) Expression of the SPI-1-encoded HilA-FLAG and InvF-FLAG and the SPI-2-encoded SsrB-FLAG and SseB, in the WT S. Typhimurium strain carrying the respective chromosomal FLAG-tagged gene and containing plasmid pCA-CpxR, was analyzed by Western blotting using monoclonal anti-FLAG or polyclonal anti-SseB antibodies. Whole cell lysates were prepared from samples of bacterial cultures grown in LB medium at 37°C for 5 or 9 h, for detection of SPI-1- and SPI-2-encoded proteins, respectively. As a loading control, the expression of DnaK was also determined using monoclonal anti-DnaK antibodies. Overexpression (+) of CpxR from the T5-lac promoter of plasmid pCA-CpxR was induced by adding 50 μM IPTG at the beginning of the bacterial cultures.

CpxR represses hilD and thus indirectly affects HilD-regulated genes

Several global regulators control the expression of the SPI-1 genes by directly affecting the expression, activity or concentration of HilD or HilA, the central regulators of these genes (Golubeva et al., 2012; Fàbrega and Vila, 2013). Our results indicate that CpxR represses the expression of HilA (Figure 1C). To start to define whether CpxR affects hilA directly or through HilD, which positively regulates hilA, we determined the effect of the overexpression of CpxR on the activity of a hilD-cat transcriptional fusion in the WT S. Typhimurium strain. Since plasmid pCA-CpxR, expressing the E. coli K12 CpxR, is incompatible with the vector carrying the cat fusions tested, for the next assays we constructed and used the plasmid pK3-CpxR, which constitutively expresses CpxR of S. Typhimurium 14028s. The overexpression of CpxR reduced 50% the expression of the hilD-cat fusion (Figure 4A), revealing that CpxR represses hilD. CpxR could directly repress the transcription of hilD or reduce post-transcriptionally the concentration of HilD and thus affect its positive autoregulation. To determine if CpxR affects the autoregulation of hilD, the expression of the hilD-cat fusion was determined in the WT S. Typhimurium strain and its derivatives ΔcpxA, ΔhilD, and ΔhilD ΔcpxA mutants. As shown in Figure 4B, the expression of the hilD-cat fusion was similarly reduced in these three mutants, indicating that the absence of CpxA or HilD has the same effect on the expression of hilD, and that, when HilD is not present, the absence of CpxA does not longer repress hilD. In contrast, the expression of the cpxRA-cat fusion was similarly increased in the ΔcpxA and ΔhilD ΔcpxA mutants (Figure 1D), indicating that the absence of CpxA activates the expression of cpxRA independently of HilD. These results suggest that CpxR represses hilA and thus the other SPI-1 genes by affecting the autoregulation of HilD. To confirm that CpxR regulates hilA through HilD and not directly, we analyzed the effect of CpxR on the expression of hilA in the presence or not of HilD. Previous studies indicate that HilD induces the expression of hilA by counteracting the repression exerted by the nucleoid protein H-NS on the promoter of this gene (Schechter et al., 1999; Schechter and Lee, 2001; Olekhnovich and Kadner, 2006); thus, in the absence of H-NS activity hilA can be expressed independently of HilD. Full-length deletion of hns produces severe growth defects in S. Typhimurium (Lucchini et al., 2006; Navarre et al., 2006). However, deletion of the sequence encoding the C-terminal region of H-NS (ΔCthns), which contains its DNA-binding domain, has only a minor effect on S. Typhimurium fitness (Fernández-Mora, personal communication), probably because the N-terminal of H-NS can still repress some of its target genes by interacting with StpA, another nucleoid protein (Free et al., 2001). Therefore, we constructed and tested a S. Typhimurium 14028s ΔhilD ΔCthns mutant. The overexpression of CpxR, from plasmid pK3-CpxR, reduced five-fold the expression of a hilA-cat transcriptional fusion in the WT strain (Figure 4C), but did not affect the high levels of expression showed by this fusion in the ΔhilD ΔCthns mutant (Figure 4D), indicating that CpxR regulates hilA through HilD and not directly.

Figure 4.

Figure 4

CpxR represses the autoregulation of hilD and thus negatively affects the expression of hilA. Expression of the hilD-cat transcriptional fusion carried by plasmid philD-cat was tested in the WT S. Typhimurium strain carrying plasmid pK3-CpxR or pK3-RpoH, or the vector pMPM-K3 (A), as well as in the WT S. Typhimurium strain and its isogenic ΔhilD, ΔcpxA, and ΔhilD ΔcpxA mutants (B). Expression of the hilA-cat transcriptional fusion carried by plasmid philA-cat was tested in the WT S. Typhimurium strain (C), or in its isogenic ΔhilD ΔCthns mutant (D), containing plasmid pK3-CpxR or pK3-RpoH, or the vector pMPM-K3. Plasmids pK3-CpxR and pK3-RpoH, as well as Salmonella, lack the gene encoding the repressor LacI and thus they constitutively express CpxR and RpoH, respectively, from a lac promoter. CAT-specific activity was determined from samples collected of bacterial cultures grown for 5 h in LB medium at 37°C. The data are the averages of three different experiments performed in duplicate. Bars represent the standard deviations. *Expression statistically different with respect to that shown by the same fusion in the WT strain containing the vector. **Expression statistically different with respect to that shown by the same fusion in the WT strain.

In agreement with our results indicating that CpxR represses the HilD-dependent expression of hilD and hilA, both the overexpression of CpxR and the absence of CpxA drastically reduced the production of SsrB-FLAG and SseB proteins (Figures 1C, 3B), which are encoded in SPI-2 and whose expression is also dependent of HilD in the condition tested.

Taken together, these results show that CpxR represses the autoregulation of HilD, which in turn affects the expression of hilA and thus the SPI-1 genes, as well as of other virulence genes regulated by HilD, such as ssrB and sseB located in SPI-2.

CpxR-mediated repression of the SPI-1 genes is lost in the absence of the lon protease

A previous study shown that the overexpression of the sigma factor RpoH represses the SPI-1 genes through the Lon protease that degrades HilD (Matsui et al., 2008). On the other hand, it was reported that CpxR positively regulates rpoH in E. coli (Zahrl et al., 2006). Interestingly, we observed a very similar effect with the overexpression of CpxR or RpoH on the activity of hilD-cat and hilA-cat fusions (Figures 4A,C,D), which was initially tested as an expression control of the promoter expressing CpxR from plasmid pMPM-K3. Therefore, we thought that CpxR could repress the SPI-1 genes through RpoH and Lon. To investigate this, we sought to determine the effect of CpxR on the SPI-1 genes in the absence of RpoH or Lon. After several attempts, we were unable to delete rpoH in the S. Typhimurium 14028s strain by the λRed recombination method (Datsenko and Wanner, 2000), which could suggest that the absence of RpoH affects Salmonella fitness; although, a S. Typhimurium 14028s ΔrpoH mutant was reported previously (Bang et al., 2005). In contrast, a lon deletion strain was successful; thus, we constructed and analyzed Δlon and ΔcpxA Δlon mutants. Furthermore, since HilE regulates the activity of HilD by protein-protein interaction (Baxter et al., 2003), ΔhilE and ΔcpxA ΔhilE mutants were also constructed and used as controls. Interestingly, the expression of InvF-FLAG, as well as the secretion/expression of the SipA-D proteins, was drastically reduced in the ΔcpxA and ΔcpxA ΔhilE mutants, but not in the ΔhilE, Δlon, and ΔcpxA Δlon mutants (Figures 5A,B). Consistently, the overexpression of CpxR clearly repressed the expression of InvF-FLAG in the WT strain and the ΔhilE mutant, but only slightly in the Δlon mutant (Figure 5C). Therefore, these results show that deletion of lon counteracts repression exerted by CpxR on the SPI-1 genes, which supports that CpxR acts through the Lon protease to repress these genes. Nevertheless, even in the absence of Lon, either the absence of CpxA or the overexpression of CpxR slightly repressed the SPI-1 genes (Figure 5), revealing an additional Lon-independent mechanism for the repression of these genes by CpxR.

Figure 5.

Figure 5

Repression of the SPI-1 genes by CpxR is lost in the absence of the Lon protease. Expression of the SPI-1-encoded InvF-FLAG in the WT S. Typhimurium strain and its isogenic ΔcpxA, ΔhilE, ΔcpxA ΔhilE, Δlon and ΔcpxA Δlon mutants (A), or in the WT S. Typhimurium strain and its isogenic ΔhilE and Δlon mutants carrying plasmid pCA-CpxR (C), was analyzed by Western blotting using monoclonal anti-FLAG antibodies. Whole cell lysates were prepared from samples of bacterial cultures grown for 5 h in LB medium at 37°C. As a loading control, the expression of DnaK was also determined using monoclonal anti-DnaK antibodies. Overexpression (+) of CpxR from the T5-lac promoter of plasmid pCA-CpxR was induced by adding 50 μM IPTG at the beginning of the bacterial cultures. (B) Secretion analysis of the SPI-1-encoded proteins SipA, SipB, SipC, and SipD was tested in the WT S. Typhimurium strain and its isogenic ΔcpxA, ΔhilE, ΔcpxA ΔhilE, Δlon, and ΔcpxA Δlon mutants grown for 9 h in LB medium at 37°C. FliC is a flagellar protein whose secretion is SPI-1-independent.

CpxR affects stability of HilD

On the basis of our results indicating that repression of the SPI-1 genes by CpxR is mostly lost in the absence of the Lon protease, which degrades HilD, we hypothesized that CpxR should reduce the stability of HilD. To investigate this, we determined the in vivo half-life of HilD in the presence or absence of CpxA or Lon. The cellular levels of Myc-tagged HilD (HilD-Myc) expressed from plasmid pBAD-HilD, under an arabinose-inducible promoter, were monitored in the ΔhilD, ΔhilD ΔcpxA and ΔhilD Δlon mutants, at indicated times after adding a cocktail of transcription and translation inhibitors. As shown in Figure 6A, the levels of HilD-Myc were reduced faster in the ΔhilD ΔcpxA mutant than in the ΔhilD mutant, whereas, as expected, the stability of HilD-Myc was drastically increased in the ΔhilD Δlon mutant. In these assays, the half-life of HilD-Myc in the presence and absence of CpxA was 38 and 20 min, respectively (Figure 6B), supporting the notion that the activation of CpxR by the absence of CpxA decreases the stability of HilD.

Figure 6.

Figure 6

CpxR reduces the stability of HilD. (A) Stability of HilD-Myc was determined in the ΔhilD, ΔhilD ΔcpxA, and ΔhilD Δlon mutants carrying plasmid pBAD-HilD, which were grown in LB medium at 37°C. Expression of HilD-Myc, from the arabinose-inducible promoter of plasmid pBAD-HilD, was induced with 0.05% L-arabinose for 45 min; then, transcription and translation were halted by the addition of a cocktail of antibiotics and glucose, and samples of bacterial cultures were taken at indicated times. HilD-Myc was detected from whole cell lysates of the samples by Western blotting using monoclonal anti-Myc antibodies. As a loading control, the expression of DnaK was also determined using monoclonal anti-DnaK antibodies. A representative Western blot of three independent experiments is shown. (B) Densitometric analysis of the HilD-Myc bands from the Western blots is indicated as the relative percentage of HilD-Myc at each time with respect to time 0. Intensity values of HilD-Myc bands were normalized with those respective of DnaK bands. The data are the averages of three independent experiments. Bars represent the standard deviations and t1∕2 indicates the half-life of HilD.

CpxR does not affect the transcription of lon

As most response regulators, CpxR directly controls gene expression at transcriptional level (Hunke et al., 2012; Vogt and Raivio, 2012; Raivio, 2014). Thus, we tested if CpxR affects the transcription of lon. In E. coli, lon seems to be transcribed from promoters located upstream of lon, or from those of neighboring genes clpX and clpP (RegulonDB database, www.regulondb.ccg.unam.mx). Therefore, to monitor the promoters expressing lon, we constructed lon-cat, clpX-cat and clpP-cat transcriptional fusions, which contain the full intergenic region upstream of the respective gene (Figure 7A). Each of these fusions showed similar levels of expression in the WT strain and its derivative ΔcpxA mutant (Figure 7B). Furthermore, the expression of the lon-cat, clpX-cat, and clpP-cat fusions was not affected in the WT strain by the overexpression of CpxR; in contrast, their expression was increased by the overproduction of RpoH (Figure 7C). These results indicate that CpxR does not affect the transcription of lon and demonstrate that RpoH positively regulates lon, clpX, and clpP in S. Typhimurium.

Figure 7.

Figure 7

RpoH, but not CpxR, induces the transcription of lon, clpX, and clpP. (A) Genetic organization of the lon, clpX, and clpP genes and schematic representation of the cat transcriptional fusions of these genes. Expression of the lon-cat, clpX-cat and clpP-cat transcriptional fusions, carried by plasmids plon-cat, pclpX-cat and pclpP-cat, respectively, was tested in the WT S. Typhimurium strain and its isogenic ΔcpxA mutant (B), as well as in the WT S. Typhimurium strain carrying plasmid pK3-CpxR or pK3-RpoH, which constitutively express CpxR and RpoH, respectively, or carrying the vector pMPM-K3 (C). CAT-specific activity was determined from samples collected of bacterial cultures grown for 5 h in LB medium at 37°C. The data are the averages of three different experiments performed in duplicate. Bars represent the standard deviations. *Expression statistically different with respect to that shown by the same fusion in the WT strain containing the vector.

Discussion

Previous studies have shown that deletion of cpxA or mutations in cpxA that activate the Cpx system reduce Salmonella adherence and invasion to eukaryotic cells, as well as the ability of Salmonella to infect mice (Leclerc et al., 1998; Nakayama et al., 2003; Humphreys et al., 2004). Furthermore, it was shown that deletion of cpxA decreases the expression of hilA and thus the SPI-1 genes (Nakayama et al., 2003), which code for the T3SS-1 and their cognate effector proteins that are required for Salmonella invasion into the intestinal epithelium of hosts (Haraga et al., 2008; Fàbrega and Vila, 2013). In this study, we show that deletion of cpxA negatively affects the expression of the SPI-1 genes when S. Typhimurium is grown in LB medium, but only in the presence of cpxR, indicating that the absence of CpxA leads to the repression of the SPI-1 genes through CpxR. Furthermore, we show that deletion of cpxA increases the expression of the cpxRA operon through CpxR, which is in agreement with previous studies indicating that CpxR-P induces the expression of the cpxRA operon (De Wulf et al., 1999; Raivio et al., 1999, 2013; Price and Raivio, 2009). Thus, our results could suggest that the absence of CpxA turns on the regulation of the whole CpxR regulon in S. Typhimurium.

Our data provide several lines of evidence strongly supporting that CpxR-P represses the SPI-1 genes. First, the AckA and Pta enzymes, which generate acetyl phosphate that phosphorylates CpxR (Raivio and Silhavy, 1997; Wolfe et al., 2008), are also required for the repression of the SPI-1 genes mediated by deletion of cpxA. Second, overexpression of the lipoprotein NlpE, which activates the kinase activity of CpxA on CpxR (Snyder et al., 1995; Hunke et al., 2012; Vogt and Raivio, 2012), represses the SPI-1 genes via CpxR. Third, the overexpression of CpxR, which can bypass the need for phosphorylation of CpxR to regulate target genes (Macritchie et al., 2008; Acosta et al., 2015; Yun et al., 2015), has the same effect on the expression of the SPI-1 genes than the absence of CpxA or the overexpression of NlpE. Furthermore, a previous study showed accumulation of CpxR-P in a cpxA deletion mutant of Yersinia pseudotuberculosis grown in LB medium, which was generated through the AckA-Pta pathway (Liu et al., 2012). However, since CpxR-P induces its own expression, as mentioned above, both phosphorylation and a higher concentration of CpxR would be involved in the repression of the SPI-1 genes.

Our data indicate that CpxR-P decreases the stability of HilD, the regulator that is at the apex of a regulatory cascade controlling the expression of the SPI-1 genes, as well as other virulence genes, such as those located in SPI-2 (Bustamante et al., 2008; Golubeva et al., 2012; Fàbrega and Vila, 2013; Martínez et al., 2014). Consistently, we show that CpxR represses the expression of both SPI-1 and SPI-2 (ssrAB and sseB) virulence genes when S. Typhimurium is grown in LB medium. Furthermore, we demonstrate that CpxR-P negatively affects the transcription of the SPI-1 genes hilD and hilA, but only in the presence of HilD, which would be expected, since the expression of HilD is autoregulated and HilD directly regulates hilA (Golubeva et al., 2012; Fàbrega and Vila, 2013). Therefore, the effect of CpxR-P on the expression of the SPI-1 and SPI-2 genes could be the result of its negative control on the stability of HilD and, as a consequence, on the transcription of hilD, which, in an additive manner, would decrease the concentration of HilD. In agreement with this conclusion, we did not find any putative CpxR binding-site in the regulatory regions of hilD, hilA, ssrAB and sseB, using the Virtual Footprint tool (Munch et al., 2005) (http://prodoric.tu-bs.de/vfp/) with the Position Weight Matrix for the binding-consensus sequence of E. coli K12 CpxR, 5′-GTAAA(N)5GTAA(A/G)-3′ (De Wulf et al., 2002), supporting that these genes are not directly regulated by CpxR. In contrast, these analyses revealed CpxR binding-sites in the regulatory regions of the S. Typhimurium cpxR and cpxP genes (data not shown). In E. coli, cpxR and cpxP belong to the CpxR regulon (Raivio et al., 1999, 2013; Price and Raivio, 2009).

CpxR has been shown to directly act as a transcriptional regulator (Hunke et al., 2012; Vogt and Raivio, 2012; Raivio, 2014). However, deletion of cpxA represses T3SS genes in Shigella sonnei through posttranscriptional processing of the regulator InvE (Mitobe et al., 2005). Furthermore, activation of the CpxR/A system reduces the stability of the E. coli F plasmid regulator TraJ via the HsIVU protease-chaperone pair (Gubbins et al., 2002; Lau-Wong et al., 2008). These latter studies indicate that CpxR can indirectly control protein stability by activating proteases. Interestingly, we found that the absence of the Lon protease, which has been shown to degrade HilD (Takaya et al., 2005), severely affects the repression of the SPI-1 genes mediated by CpxR. In contrast, the absence of HilE, a regulator which negatively controls HilD activity by protein-protein interactions (Baxter et al., 2003), does not affect this repression by CpxR. Taken together, our results support that CpxR-P represses the expression of the SPI-1 and SPI-2 genes mainly by reducing the stability of HilD through the Lon protease. However, our data also show that both deletion of cpxA and overexpression of CpxR slightly repress the expression of the SPI-1 genes in the absence of the Lon protease, suggesting an additional minor Lon-independent mechanism for the repression of the SPI-1 genes by CpxR-P. Alternatively, this could suggest that CpxR-P actually controls the stability of HilD through another protease, not involving Lon, which could be obfuscated by the extremely high stability of HilD in the absence of Lon. How CpxR-P reduces the stability of HilD or whether there is another mechanism by which CpxR-P represses the SPI-1 and SPI-2 genes is a matter of our current and future studies.

Overexpression of the heat shock sigma factor RpoH represses the SPI-1 genes only in the presence of the Lon protease (Matsui et al., 2008). Our results show that RpoH, but not CpxR, induces the transcription of lon, as well as of the clpX and clpP neighbor genes encoding the ClpXP protease. Accordingly, previous studies indicate that lon, clpX and clpP belong to the RpoH regulon (Nonaka et al., 2006; Wade et al., 2006), but not to the CpxR regulon of E. coli (Bury-Mone et al., 2009; Price and Raivio, 2009; Raivio et al., 2013). Therefore, CpxR and RpoH seem to affect HilD concentration and thus repress the SPI-1 genes differentially; RpoH by inducing transcription of lon and CpxR by probably affecting the posttranscriptional expression or activity of Lon, or through another protease. Anyway, HilD would integrate the regulation of Salmonella virulence genes to the stresses sensed by CpxR/A and RpoH.

The two-component system CpxR/A regulates virulence in many bacteria, mostly by inhibiting the production of secretion systems, pili, flagella, fimbriae and curli, which are required for bacteria interaction with host cells; furthermore, several studies have shown that biogenesis of these envelope-localized multiprotein complexes activates the Cpx response (Hunke et al., 2012; Vogt and Raivio, 2012; Raivio, 2014). In this study, we demonstrate that activation of the CpxR/A system represses the expression of the genes encoding the T3SS-1 and T3SS-2, and their respective effector proteins, in S. Typhimurium. The activation of the CpxR/A system also represses the expression of T3SS genes in enteropathogenic Escherichia coli (Macritchie et al., 2008), Yersinia pseudotuberculosis (Carlsson et al., 2007; Liu et al., 2012) and Shigella sonnei (Mitobe et al., 2005, 2011). Therefore, it is tempting to speculate that the CpxR/A system controls biogenesis of T3SSs by sensing misfolded proteins generated during their production.

The insight from this study better explains the mechanism by which the CpxR/A system regulates the expression of the SPI-1 genes and further increases the current knowledge about the complex regulatory network governing virulence in Salmonella. Additionally, it reveals that deletion of cpxA activates CpxR-mediated gene regulation in S. Typhimurium.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

We thank F.J. Santana for technical assistance, L.C. Martínez and A. Vázquez for constructing strains DTM76 and DTM60, respectively, B.B. Finlay and J.L. Puente for providing the anti-SseB polyclonal antibody and I. Martínez-Flores for critical reading of the manuscript. This work was supported by grants from the Dirección General de Asuntos del Personal Académico de la UNAM (IN205512 and IN203415 to VB and IN201513 to EC) and from the Consejo Nacional de Ciencia y Tecnología (179071 to VB and 179946 to EC).

References

  1. Abrusci P., Mcdowell M. A., Lea S. M., Johnson S. (2014). Building a secreting nanomachine: a structural overview of the T3SS. Curr. Opin. Struct. Biol. 25, 111–117. 10.1016/j.sbi.2013.11.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Acosta N., Pukatzki S., Raivio T. L. (2015). The Vibrio cholerae Cpx envelope stress response senses and mediates adaptation to low iron. J. Bacteriol. 197, 262–276. 10.1128/JB.01957-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bang I. S., Frye J. G., Mcclelland M., Velayudhan J., Fang F. C. (2005). Alternative sigma factor interactions in Salmonella: σE and σH promote antioxidant defences by enhancing σS levels. Mol. Microbiol. 56, 811–823. 10.1111/j.1365-2958.2005.04580.x [DOI] [PubMed] [Google Scholar]
  4. Batchelor E., Walthers D., Kenney L. J., Goulian M. (2005). The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins OmpF and OmpC. J. Bacteriol. 187, 5723–5731. 10.1128/JB.187.16.5723-5731.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Baxter M. A., Fahlen T. F., Wilson R. L., Jones B. D. (2003). HilE interacts with HilD and negatively regulates hilA transcription and expression of the Salmonella enterica serovar Typhimurium invasive phenotype. Infect. Immun. 71, 1295–1305. 10.1128/IAI.71.3.1295-1305.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bispham J., Tripathi B. N., Watson P. R., Wallis T. S. (2001). Salmonella pathogenicity island 2 influences both systemic salmonellosis and Salmonella-induced enteritis in calves. Infect. Immun. 69, 367–377. 10.1128/IAI.69.1.367-377.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brosius J. (1984). Plasmid vectors for the selection of promoters. Gene 27, 151–160. 10.1016/0378-1119(84)90136-7 [DOI] [PubMed] [Google Scholar]
  8. Brown N. F., Vallance B. A., Coombes B. K., Valdez Y., Coburn B. A., Finlay B. B. (2005). Salmonella pathogenicity island 2 is expressed prior to penetrating the intestine. PLoS Pathog. 1:e32. 10.1371/journal.ppat.0010032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bury-Mone S., Nomane Y., Reymond N., Barbet R., Jacquet E., Imbeaud S., et al. (2009). Global analysis of extracytoplasmic stress signaling in Escherichia coli. PLoS Genet. 5:e1000651. 10.1371/journal.pgen.1000651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bustamante V. H., Martínez L. C., Santana F. J., Knodler L. A., Steele-Mortimer O., Puente J. L. (2008). HilD-mediated transcriptional cross-talk between SPI-1 and SPI-2. Proc. Natl. Acad. Sci. U.S.A. 105, 14591–14596. 10.1073/pnas.0801205105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Carlsson K. E., Liu J., Edqvist P. J., Francis M. S. (2007). Extracytoplasmic-stress-responsive pathways modulate type III secretion in Yersinia pseudotuberculosis. Infect. Immun. 75, 3913–3924. 10.1128/IAI.01346-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chubiz J. E., Golubeva Y. A., Lin D., Miller L. D., Slauch J. M. (2010). FliZ regulates expression of the Salmonella pathogenicity island 1 invasion locus by controlling HilD protein activity in Salmonella enterica serovar typhimurium. J. Bacteriol. 192, 6261–6270. 10.1128/JB.00635-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cirillo D. M., Valdivia R. H., Monack D. M., Falkow S. (1998). Macrophage-dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Mol. Microbiol. 30, 175–188. 10.1046/j.1365-2958.1998.01048.x [DOI] [PubMed] [Google Scholar]
  14. Coburn B., Li Y., Owen D., Vallance B. A., Finlay B. B. (2005). Salmonella enterica serovar Typhimurium pathogenicity island 2 is necessary for complete virulence in a mouse model of infectious enterocolitis. Infect. Immun. 73, 3219–3227. 10.1128/IAI.73.6.3219-3227.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Coombes B. K., Brown N. F., Valdez Y., Brumell J. H., Finlay B. B. (2004). Expression and secretion of Salmonella pathogenicity island-2 virulence genes in response to acidification exhibit differential requirements of a functional type III secretion apparatus and SsaL. J. Biol. Chem. 279, 49804–49815. 10.1074/jbc.M404299200 [DOI] [PubMed] [Google Scholar]
  16. Coombes B. K., Coburn B. A., Potter A. A., Gomis S., Mirakhur K., Li Y., et al. (2005). Analysis of the contribution of Salmonella pathogenicity islands 1 and 2 to enteric disease progression using a novel bovine ileal loop model and a murine model of infectious enterocolitis. Infect. Immun. 73, 7161–7169. 10.1128/IAI.73.11.7161-7169.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Datsenko K. A., Wanner B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640–6645. 10.1073/pnas.120163297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Deiwick J., Nikolaus T., Erdogan S., Hensel M. (1999). Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol. Microbiol. 31, 1759–1773. 10.1046/j.1365-2958.1999.01312.x [DOI] [PubMed] [Google Scholar]
  19. De Wulf P., Kwon O., Lin E. C. (1999). The CpxR/A signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons. J. Bacteriol. 181, 6772–6778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. De Wulf P., Mcguire A. M., Liu X., Lin E. C. (2002). Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli. J. Biol. Chem. 277, 26652–26661. 10.1074/jbc.M203487200 [DOI] [PubMed] [Google Scholar]
  21. Diepold A., Wagner S. (2014). Assembly of the bacterial type III secretion machinery. FEMS Microbiol. Rev. 38, 802–822. 10.1111/1574-6976.12061 [DOI] [PubMed] [Google Scholar]
  22. Ellermeier C. D., Ellermeier J. R., Slauch J. M. (2005). HilD, HilC and RtsA constitute a feed forward loop that controls expression of the SPI1 type three secretion system regulator hilA in Salmonella enterica serovar Typhimurium. Mol. Microbiol. 57, 691–705. 10.1111/j.1365-2958.2005.04737.x [DOI] [PubMed] [Google Scholar]
  23. Ellermeier J. R., Slauch J. M. (2008). Fur regulates expression of the Salmonella pathogenicity island 1 type III secretion system through HilD. J. Bacteriol. 190, 476–486. 10.1128/JB.00926-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Eriksson S., Lucchini S., Thompson A., Rhen M., Hinton J. C. (2003). Unravelling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol. Microbiol. 47, 103–118. 10.1046/j.1365-2958.2003.03313.x [DOI] [PubMed] [Google Scholar]
  25. Fàbrega A., Vila J. (2013). Salmonella enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin. Microbiol. Rev. 26, 308–341. 10.1128/CMR.00066-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Fass E., Groisman E. A. (2009). Control of Salmonella pathogenicity island-2 gene expression. Curr. Opin. Microbiol. 12, 199–204. 10.1016/j.mib.2009.01.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Free A., Porter M. E., Deighan P., Dorman C. J. (2001). Requirement for the molecular adapter function of StpA at the Escherichia coli bgl promoter depends upon the level of truncated H-NS protein. Mol. Microbiol. 42, 903–917. 10.1046/j.1365-2958.2001.02678.x [DOI] [PubMed] [Google Scholar]
  28. Golubeva Y. A., Sadik A. Y., Ellermeier J. R., Slauch J. M. (2012). Integrating global regulatory input into the Salmonella pathogenicity island 1 type III secretion system. Genetics 190, 79–90. 10.1534/genetics.111.132779 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Grant A. J., Morgan F. J., Mckinley T. J., Foster G. L., Maskell D. J., Mastroeni P. (2012). Attenuated Salmonella Typhimurium lacking the pathogenicity island-2 type 3 secretion system grow to high bacterial numbers inside phagocytes in mice. PLoS Pathog. 8:e1003070. 10.1371/journal.ppat.1003070 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Groisman E. A., Ochman H. (1997). How Salmonella became a pathogen. Trends Microbiol. 5, 343–349. 10.1016/S0966-842X(97)01099-8 [DOI] [PubMed] [Google Scholar]
  31. Gubbins M. J., Lau I., Will W. R., Manchak J. M., Raivio T. L., Frost L. S. (2002). The positive regulator, TraJ, of the Escherichia coli F plasmid is unstable in a cpxA* background. J. Bacteriol. 184, 5781–5788. 10.1128/JB.184.20.5781-5788.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hansen-Wester I., Hensel M. (2001). Salmonella pathogenicity islands encoding type III secretion systems. Microbes Infect. 3, 549–559. 10.1016/S1286-4579(01)01411-3 [DOI] [PubMed] [Google Scholar]
  33. Haraga A., Ohlson M. B., Miller S. I. (2008). Salmonellae interplay with host cells. Nat. Rev. Microbiol. 6, 53–66. 10.1038/nrmicro1788 [DOI] [PubMed] [Google Scholar]
  34. Humphreys S., Rowley G., Stevenson A., Anjum M. F., Woodward M. J., Gilbert S., et al. (2004). Role of the two-component regulator CpxAR in the virulence of Salmonella enterica serotype Typhimurium. Infect. Immun. 72, 4654–4661. 10.1128/IAI.72.8.4654-4661.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Hunke S., Keller R., Muller V. S. (2012). Signal integration by the Cpx-envelope stress system. FEMS Microbiol. Lett. 326, 12–22. 10.1111/j.1574-6968.2011.02436.x [DOI] [PubMed] [Google Scholar]
  36. Kitagawa M., Ara T., Arifuzzaman M., Ioka-Nakamichi T., Inamoto E., Toyonaga H., et al. (2005). Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12, 291–299. 10.1093/dnares/dsi012 [DOI] [PubMed] [Google Scholar]
  37. Knodler L. A., Vallance B. A., Celli J., Winfree S., Hansen B., Montero M., et al. (2010). Dissemination of invasive Salmonella via bacterial-induced extrusion of mucosal epithelia. Proc. Natl. Acad. Sci. U.S.A. 107, 17733–17738. 10.1073/pnas.1006098107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kröger C., Colgan A., Srikumar S., Händler K., Sivasankaran S. K., Hammarlöf D. L., et al. (2013). An infection-relevant transcriptomic compendium for Salmonella enterica Serovar Typhimurium. Cell Host Microbe 14, 683–695. 10.1016/j.chom.2013.11.010 [DOI] [PubMed] [Google Scholar]
  39. Laughlin R. C., Knodler L. A., Barhoumi R., Payne H. R., Wu J., Gomez G., et al. (2014). Spatial segregation of virulence gene expression during acute enteric infection with Salmonella enterica serovar Typhimurium. MBio 5, e00946–e00913. 10.1128/mBio.00946-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lau-Wong I. C., Locke T., Ellison M. J., Raivio T. L., Frost L. S. (2008). Activation of the Cpx regulon destabilizes the F plasmid transfer activator, TraJ, via the HslVU protease in Escherichia coli. Mol. Microbiol. 67, 516–527. 10.1111/j.1365-2958.2007.06055.x [DOI] [PubMed] [Google Scholar]
  41. Leclerc G. J., Tartera C., Metcalf E. S. (1998). Environmental regulation of Salmonella typhi invasion-defective mutants. Infect. Immun. 66, 682–691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Liu J., Thanikkal E. J., Obi I. R., Francis M. S. (2012). Elevated CpxR~P levels repress the Ysc-Yop type III secretion system of Yersinia pseudotuberculosis. Res. Microbiol. 163, 518–530. 10.1016/j.resmic.2012.07.010 [DOI] [PubMed] [Google Scholar]
  43. Lostroh C. P., Bajaj V., Lee C. A. (2000). The cis requirements for transcriptional activation by HilA, a virulence determinant encoded on SPI-1. Mol. Microbiol. 37, 300–315. 10.1046/j.1365-2958.2000.01991.x [DOI] [PubMed] [Google Scholar]
  44. Lostroh C. P., Lee C. A. (2001). The HilA box and sequences outside it determine the magnitude of HilA-dependent activation of P(prgH) from Salmonella pathogenicity island 1. J. Bacteriol. 183, 4876–4885. 10.1128/JB.183.16.4876-4885.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Lucchini S., Rowley G., Goldberg M. D., Hurd D., Harrison M., Hinton J. C. (2006). H-NS mediates the silencing of laterally acquired genes in bacteria. PLoS Pathog. 2:e81. 10.1371/journal.ppat.0020081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Lundberg U., Vinatzer U., Berdnik D., Von Gabain A., Baccarini M. (1999). Growth phase-regulated induction of Salmonella-induced macrophage apoptosis correlates with transient expression of SPI-1 genes. J. Bacteriol. 181, 3433–3437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Macritchie D. M., Ward J. D., Nevesinjac A. Z., Raivio T. L. (2008). Activation of the Cpx envelope stress response down-regulates expression of several locus of enterocyte effacement-encoded genes in enteropathogenic Escherichia coli. Infect. Immun. 76, 1465–1475. 10.1128/IAI.01265-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Martínez L. C., Banda M. M., Fernández-Mora M., Santana F. J., Bustamante V. H. (2014). HilD induces expression of Salmonella pathogenicity island 2 genes by displacing the global negative regulator H-NS from ssrAB. J. Bacteriol. 196, 3746–3755. 10.1128/JB.01799-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Martínez L. C., Yakhnin H., Camacho M. I., Georgellis D., Babitzke P., Puente J. L., et al. (2011). Integration of a complex regulatory cascade involving the SirA/BarA and Csr global regulatory systems that controls expression of the Salmonella SPI-1 and SPI-2 virulence regulons through HilD. Mol. Microbiol. 80, 1637–1656. 10.1111/j.1365-2958.2011.07674.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Matsui M., Takaya A., Yamamoto T. (2008). σ32-mediated negative regulation of Salmonella pathogenicity island 1 expression. J. Bacteriol. 190, 6636–6645. 10.1128/JB.00744-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Mayer M. P. (1995). A new set of useful cloning and expression vectors derived from pBlueScript. Gene 163, 41–46. 10.1016/0378-1119(95)00389-N [DOI] [PubMed] [Google Scholar]
  52. Mcclelland M., Sanderson K. E., Spieth J., Clifton S. W., Latreille P., Courtney L., et al. (2001). Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413, 852–856. 10.1038/35101614 [DOI] [PubMed] [Google Scholar]
  53. Miao E. A., Miller S. I. (2000). A conserved amino acid sequence directing intracellular type III secretion by Salmonella typhimurium. Proc. Natl. Acad. Sci. U.S.A. 97, 7539–7544. 10.1073/pnas.97.13.7539 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Mitobe J., Arakawa E., Watanabe H. (2005). A sensor of the two-component system CpxA affects expression of the type III secretion system through posttranscriptional processing of InvE. J. Bacteriol. 187, 107–113. 10.1128/JB.187.1.107-113.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Mitobe J., Yanagihara I., Ohnishi K., Yamamoto S., Ohnishi M., Ishihama A., et al. (2011). RodZ regulates the post-transcriptional processing of the Shigella sonnei type III secretion system. EMBO Rep. 12, 911–916. 10.1038/embor.2011.132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Moest T. P., Méresse S. (2013). Salmonella T3SSs: successful mission of the secret(ion) agents. Curr. Opin. Microbiol. 16, 38–44. 10.1016/j.mib.2012.11.006 [DOI] [PubMed] [Google Scholar]
  57. Munch R., Hiller K., Grote A., Scheer M., Klein J., Schobert M., et al. (2005). Virtual Footprint and PRODORIC: an integrative framework for regulon prediction in prokaryotes. Bioinformatics 21, 4187–4189. 10.1093/bioinformatics/bti635 [DOI] [PubMed] [Google Scholar]
  58. Nakayama S., Kushiro A., Asahara T., Tanaka R., Hu L., Kopecko D. J., et al. (2003). Activation of hilA expression at low pH requires the signal sensor CpxA, but not the cognate response regulator CpxR, in Salmonella enterica serovar Typhimurium. Microbiology 149, 2809–2817. 10.1099/mic.0.26229-0 [DOI] [PubMed] [Google Scholar]
  59. Navarre W. W., Porwollik S., Wang Y., Mcclelland M., Rosen H., Libby S. J., et al. (2006). Selective silencing of foreign DNA with low GC content by the H-NS protein in Salmonella. Science 313, 236–238. 10.1126/science.1128794 [DOI] [PubMed] [Google Scholar]
  60. Nonaka G., Blankschien M., Herman C., Gross C. A., Rhodius V. A. (2006). Regulon and promoter analysis of the E. coli heat-shock factor, σ32, reveals a multifaceted cellular response to heat stress. Genes Dev. 20, 1776–1789. 10.1101/gad.1428206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Núñez-Hernández C., Alonso A., Pucciarelli M. G., Casadesús J., García-Del Portillo F. (2014). Dormant intracellular Salmonella enterica serovar Typhimurium discriminates among Salmonella pathogenicity island 2 effectors to persist inside fibroblasts. Infect. Immun. 82, 221–232. 10.1128/IAI.01304-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Olekhnovich I. N., Kadner R. J. (2002). DNA-binding activities of the HilC and HilD virulence regulatory proteins of Salmonella enterica serovar Typhimurium. J. Bacteriol. 184, 4148–4160. 10.1128/JB.184.15.4148-4160.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Olekhnovich I. N., Kadner R. J. (2006). Crucial roles of both flanking sequences in silencing of the hilA promoter in Salmonella enterica. J. Mol. Biol. 357, 373–386. 10.1016/j.jmb.2006.01.007 [DOI] [PubMed] [Google Scholar]
  64. Petrone B. L., Stringer A. M., Wade J. T. (2014). Identification of HilD-regulated genes in Salmonella enterica serovar Typhimurium. J. Bacteriol. 196, 1094–1101. 10.1128/JB.01449-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Porwollik S., Mcclelland M. (2003). Lateral gene transfer in Salmonella. Microbes Infect. 5, 977–989. 10.1016/S1286-4579(03)00186-2 [DOI] [PubMed] [Google Scholar]
  66. Price N. L., Raivio T. L. (2009). Characterization of the Cpx regulon in Escherichia coli strain MC4100. J. Bacteriol. 191, 1798–1815. 10.1128/JB.00798-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Puente J. L., Bieber D., Ramer S. W., Murray W., Schoolnik G. K. (1996). The bundle-forming pili of enteropathogenic Escherichia coli: transcriptional regulation by environmental signals. Mol. Microbiol. 20, 87–100. 10.1111/j.1365-2958.1996.tb02491.x [DOI] [PubMed] [Google Scholar]
  68. Raivio T. L. (2014). Everything old is new again: an update on current research on the Cpx envelope stress response. Biochim. Biophys. Acta 1843, 1529–1541. 10.1016/j.bbamcr.2013.10.018 [DOI] [PubMed] [Google Scholar]
  69. Raivio T. L., Leblanc S. K., Price N. L. (2013). The Escherichia coli Cpx envelope stress response regulates genes of diverse function that impact antibiotic resistance and membrane integrity. J. Bacteriol. 195, 2755–2767. 10.1128/JB.00105-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Raivio T. L., Popkin D. L., Silhavy T. J. (1999). The Cpx envelope stress response is controlled by amplification and feedback inhibition. J. Bacteriol. 181, 5263–5272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Raivio T. L., Silhavy T. J. (1997). Transduction of envelope stress in Escherichia coli by the Cpx two-component system. J. Bacteriol. 179, 7724–7733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Sánchez-Vargas F. M., Abu-El-Haija M. A., Gómez-Duarte O. G. (2011). Salmonella infections: an update on epidemiology, management, and prevention. Travel Med. Infect. Dis. 9, 263–277. 10.1016/j.tmaid.2011.11.001 [DOI] [PubMed] [Google Scholar]
  73. Schechter L. M., Damrauer S. M., Lee C. A. (1999). Two AraC/XylS family members can independently counteract the effect of repressing sequences upstream of the hilA promoter. Mol. Microbiol. 32, 629–642. 10.1046/j.1365-2958.1999.01381.x [DOI] [PubMed] [Google Scholar]
  74. Schechter L. M., Lee C. A. (2001). AraC/XylS family members, HilC and HilD, directly bind and derepress the Salmonella typhimurium hilA promoter. Mol. Microbiol. 40, 1289–1299. 10.1046/j.1365-2958.2001.02462.x [DOI] [PubMed] [Google Scholar]
  75. Schmidt H., Hensel M. (2004). Pathogenicity islands in bacterial pathogenesis. Clin Microbiol. Rev. 17, 14–56. 10.1128/CMR.17.1.14-56.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Singer H. M., Kühne C., Deditius J. A., Hughes K. T., Erhardt M. (2014). The Salmonella Spi1 virulence regulatory protein HilD directly activates transcription of the flagellar master operon flhDC. J. Bacteriol. 196, 1448–1457. 10.1128/JB.01438-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Snyder W. B., Davis L. J., Danese P. N., Cosma C. L., Silhavy T. J. (1995). Overproduction of NlpE, a new outer membrane lipoprotein, suppresses the toxicity of periplasmic LacZ by activation of the Cpx signal transduction pathway. J. Bacteriol. 177, 4216–4223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Spinola S. M., Fortney K. R., Baker B., Janowicz D. M., Zwickl B., Katz B. P., et al. (2010). Activation of the CpxR/A system by deletion of cpxA impairs the ability of Haemophilus ducreyi to infect humans. Infect. Immun. 78, 3898–3904. 10.1128/IAI.00432-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Takaya A., Kubota Y., Isogai E., Yamamoto T. (2005). Degradation of the HilC and HilD regulator proteins by ATP-dependent Lon protease leads to downregulation of Salmonella pathogenicity island 1 gene expression. Mol. Microbiol. 55, 839–852. 10.1111/j.1365-2958.2004.04425.x [DOI] [PubMed] [Google Scholar]
  80. Uzzau S., Figueroa-Bossi N., Rubino S., Bossi L. (2001). Epitope tagging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. U.S.A. 98, 15264–15269. 10.1073/pnas.261348198 [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Vogt S. L., Raivio T. L. (2012). Just scratching the surface: an expanding view of the Cpx envelope stress response. FEMS Microbiol. Lett. 326, 2–11. 10.1111/j.1574-6968.2011.02406.x [DOI] [PubMed] [Google Scholar]
  82. Wade J. T., Castro Roa D., Grainger D. C., Hurd D., Busby S. J., Struhl K., et al. (2006). Extensive functional overlap between sigma factors in Escherichia coli. Nat. Struct. Mol. Biol. 13, 806–814. 10.1038/nsmb1130 [DOI] [PubMed] [Google Scholar]
  83. Wolfe A. J., Parikh N., Lima B. P., Zemaitaitis B. (2008). Signal integration by the two-component signal transduction response regulator CpxR. J. Bacteriol. 190, 2314–2322. 10.1128/JB.01906-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Yun S., Lee E. G., Kim S. Y., Shin J. M., Jung W. S., Oh D. B., et al. (2015). The CpxR/A two-component system is involved in the maintenance of the integrity of the cell envelope in the rumen bacterium Mannheimia succiniciproducens. Curr. Microbiol. 70, 103–109. 10.1007/s00284-014-0686-5 [DOI] [PubMed] [Google Scholar]
  85. Zahrl D., Wagner M., Bischof K., Koraimann G. (2006). Expression and assembly of a functional type IV secretion system elicit extracytoplasmic and cytoplasmic stress responses in Escherichia coli. J. Bacteriol. 188, 6611–6621. 10.1128/JB.00632-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Frontiers in Microbiology are provided here courtesy of Frontiers Media SA

RESOURCES