Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2015 Aug 7;10(8):e0135340. doi: 10.1371/journal.pone.0135340

Anti-Retroviral Lectins Have Modest Effects on Adherence of Trichomonas vaginalis to Epithelial Cells In Vitro and on Recovery of Tritrichomonas foetus in a Mouse Vaginal Model

Aparajita Chatterjee 1, Daniel M Ratner 1,¤, Christopher M Ryan 2, Patricia J Johnson 2, Barry R O’Keefe 3, W Evan Secor 4, Deborah J Anderson 5, Phillips W Robbins 1, John Samuelson 1,*
Editor: Rodney Adam6
PMCID: PMC4529277  PMID: 26252012

Abstract

Trichomonas vaginalis causes vaginitis and increases the risk of HIV transmission by heterosexual sex, while Tritrichomonas foetus causes premature abortion in cattle. Our goals were to determine the effects, if any, of anti-retroviral lectins, which are designed to prevent heterosexual transmission of HIV, on adherence of Trichomonas to ectocervical cells and on Tritrichomonas infections in a mouse model. We show that Trichomonas Asn-linked glycans (N-glycans), like those of HIV, bind the mannose-binding lectin (MBL) that is part of the innate immune system. N-glycans of Trichomonas and Tritrichomonas bind anti-retroviral lectins (cyanovirin-N and griffithsin) and the 2G12 monoclonal antibody, each of which binds HIV N-glycans. Binding of cyanovirin-N appears to be independent of susceptibility to metronidazole, the major drug used to treat Trichomonas. Anti-retroviral lectins, MBL, and galectin-1 cause Trichomonas to self-aggregate and precipitate. The anti-retroviral lectins also increase adherence of ricin-resistant mutants, which are less adherent than parent cells, to ectocervical cell monolayers and to organotypic EpiVaginal tissue cells. Topical application of either anti-retroviral lectins or yeast N-glycans decreases by 40 to 70% the recovery of Tritrichomonas from the mouse vagina. These results, which are explained by a few simple models, suggest that the anti-retroviral lectins have a modest potential for preventing or treating human infections with Trichomonas.

Introduction

Trichomonas vaginalis is a widely prevalent sexually transmitted human parasite, while Tritrichomonas foetus (used in a mouse model of Trichomonas infection) is a widely prevalent sexually transmitted parasite of cattle [13]. While there is a second species that colonizes the upper digestive track of birds (Trichomonas gallinae) and growing evidence for a two-type structure to clinical isolates of Trichomonas vaginalis, we will use “Trichomonas” to refer to lab strains and clinical isolates studied here [4]. Trichomonas, which infects nearly four million women in the US each year, causes vaginitis, increases the risk of miscarriage, and increases rates of transmission of HIV from men to women [58]. Trichomonas infections are treated by systemic administration of metronidazole (also known as Flagyl) or tinidazole (Tindamax). However, ~4% of clinical isolates of Trichomonas show reduced in vitro susceptibility to metronidazole, and adequate safety data are not available regarding the use of tinidazole in pregnancy [9]. While there is no vaccine against Trichomonas, numerous candidate antigens have been identified (reviewed in [10]). Although there is no topical reagent approved to reduce the likelihood of Trichomonas infection, anti-poly-N-acetyl-glucosamine (PNAG) antibodies and Sapindus saponins have been proposed [11,12].

Trichomonas causes vaginitis when it penetrates the mucus layer, binds to and lyses ectocervical cells, and migrates across host tissues [13,14]. Trichomonas changes from a flagellated to an ameboid form, which is associated with changes in gene expression, actin polymerization, and release of exosomes that fuse with host cells and cause the release of cytokines [1518]. Adherence to and lysis of a benign prostatic hyperplasia cell line by Trichomonas are by similar mechanisms, while a Trichomonas homolog of macrophage inhibition factor may cause prostatic cell growth and inflammation [19].

As has been shown for bacteria and other parasites, sugars on the surface of Trichomonas and host lectins that recognize these sugars are involved in adhesion and pathogenesis [20,21]. Adhesion of Trichomonas to human ectocervical cells in vitro is inhibited by parasite lipoglycan (LG) that contains chains N-acetyllactosamine (LacNAc), which is galactose linked ß1-4 to N-acetylglucosamine (GlcNAc). LacNAc is also bound by galectin-1, a component of the innate immune response that is present in serum, in vaginal secretions, and on the surface of vaginal epithelial cells [22,23]. Mutants of Trichomonas that do not bind ricin B chain (i.e. are ricin-resistant) have decreased LacNAc in their LG, show decreased adherence to and lysis of ectocervical cells in vitro, and show decreased binding of host galectin-1 [24]. In addition, the plant lectin Concanavalin A inhibits adherence of Trichomonas to cell culture monolayers [25].

We have made a number of basic observations concerning the Asn-linked glycans (N-glycans) of Trichomonas. The parasite N-glycan precursor contains seven sugars (Man5GlcNAc2-PP-dolichol) rather than the 14-sugar precursor (Glc3Man9GlcNAc2-PP-dolichol) made by most animals, plants, and fungi [26]. The Trichomonas N-glycan is glucosylated by a uridine diphosphate glucose (UDP-Glc) glucosyltransferase that is part of the N-glycan-dependent quality control (NG-QC) of glycoprotein folding [27]. Conversely, the Trichomonas N-glycan is trimmed by an ER mannosidase that resembles those involved in N-glycan-dependent ER-associated degradation (NG-ERAD) of misfolded glycoproteins. There is positive selection for sites of N-linked glycosylation in secreted and membrane proteins of Trichomonas and other eukaryotes with NG-QC [28].

Trichomonas glycoproteins that contain N-glycans or N-glycan sites, which were identified by mass spectrometry, include important virulence factors shared with Tritrichomonas, as well as many unique proteins that appear to be absent from the predicted proteins of Tritrichomonas (our unpublished data and [29]). Shared virulence factors suggest Tritrichomonas, which causes a robust vaginal infection in mice that ascends into the uterus, may be a good surrogate for Trichomonas [2]. In contrast, Trichomonas causes transient and weak mouse infections that depend upon inducing estrus, treatment with dexamethasone, and co-infection with Lactobacilli [3].

Many Trichomonas N-glycans are not processed in the ER or Golgi and so have a single mannose arm that is similar to the three mannose arms present on unprocessed N-glycans on gp120 of HIV [26,30,31]. In contrast, most human N-glycans are extensively processed in the ER and Golgi and contain LacNAc arms capped by sialic acid, as well as fucose attached to GlcNAc at the base [32]. The unprocessed N-glycans of HIV bind mannose-binding proteins of the innate immune response, which include the mannose-binding lectin (MBL) in serum and vaginal secretions, the mannose receptor on macrophages, and DC-SIGN on dendritic cells [3336]. MBL, which has a carbohydrate recognition domain and a collagenous domain, forms oligomers that activate complement by the lectin-mediated pathway. The unprocessed N-glycans of HIV are also the target of a broadly neutralizing monoclonal antibody (2G12) derived from a long-term non-progressor infected with HIV, as well as anti-retroviral lectins (cyanovirin-N from a cyanobacterium and griffithsin from a red alga) developed as topical therapeutics to prevent the heterosexual spread of HIV [3740]. These anti-retroviral lectins are also active against herpes simplex virus (HSV), hepatitis C virus (HCV), and influenza virus [4143].

The first goal of our studies was to explore the role, if any, of Trichomonas N-glycans on pathogenesis. To do this, we determined whether recombinant human MBL labels the surface of Trichomonas. The specificity of MBL for Trichomonas N-glycans was shown by use of a morpholino to the Alg7 gene that encodes the first step in synthesis of the N-glycan precursor. We determined whether MBL, as well as galectin-1, agglutinates flagellated Trichomonas that are swimming in solution. We tested the effect of topical application of N-glycans from the Saccharomyces mnn1/mnn4 double knockout, which makes N-glycans similar to those of Trichomonas and HIV, on the recovery of Tritrichomonas in the mouse vagina [44].

The second goal was to determine what effect, if any, anti-retroviral lectins designed as topical reagents to prevent heterosexual spread of HIV have on Trichomonas in vitro and Tritrichomonas in the mouse vaginal model. We used flow cytometry to measure the binding of cyanovirin-N to Trichomonas treated with tunicamycin or an Alg7 morpholino, and we determined whether N-glycans from the Saccharomyces mnn1/mnn4 double knockout inhibit binding of cyanovirin-N to parasites. We compared the binding of cyanovirin-N to metronidazole-sensitive and metronidazole–resistant clinical isolates of Trichomonas axenized at the Center for Disease Control and Prevention (CDC) [9]. We tested the effects of cyanovirin-N and griffithsin on self-agglutination by Trichomonas and on adherence of the parasite to an ectocervical monolayer and to organotypic EpiVaginal tissue cells [45,46]. Finally, we measured the effects of topical application of these anti-retroviral lectins, as well as the 2G12 monoclonal antibody and galectin-1, on recovery of Tritrichomonas in the mouse vaginal model.

Materials and Methods

Ethics Statement

Culture of Trichomonas and Tritrichomonas has been approved by the Boston University Institutional Biosafety Committees at Boston University and the University of California-Los Angeles. Mouse infections with Tritrichomonas were performed under ABSL-2 protocols (AN-15352) with the approval of the Boston University Institutional Animal Care and Use Committee (BU IACUC). Use of metronidazole-resistant and metronidazole–sensitive Trichomonas, which were previously axenized from de-identified clinical isolates at the CDC, has been reviewed by the Boston University Institutional Review Board and judged to not be human subjects research. The organotypic EpiVaginal tissue cells, which derive from de-identified hysterectomy specimens, are a catalog item from MatTek Corporation (Ashland, MA).

Parasites and cervical/vaginal cell preparations

The genome project G3 strain of Trichomonas, the parental strain (B7RC2) for the ricin-resistant mutants, and the two mutants (4–12 and 2E2) have all been described previously [24,47]. The D1 strain of Tritrichomonas was received from Lynnette Corbeil of UCSD [2]. Metronidazole-sensitive and metronidazole-resistant Trichomonas were axenized (grown without bacteria) from clinical isolates at the CDC [9,48]. Parasites were cultured axenically in TYI-S-33 medium containing 10% bovine serum [49]. Human ectocervical cell line (Ect1 E6/E7), which was a generous gift from Dr. Raina Fichorova of the Brigham and Women’s Hospital, Boston MA, was grown in defined medium, as previously described [24,45]. Organotypic EpiVaginal tissue cells were maintained in DMEM medium containing 10% serum [46].

Microscopy, flow cytometry, and agglutination assays of lectins bound to the surface of Trichomonas

Logarithmic-phase trophozoites were concentrated by low speed centrifugation and washed in chilled phosphate buffered saline (PBS). Cyanovirin-N-labeled trophozoites were washed three times in chilled PBS and then fixed for 10 min at 4°C in 2% paraformaldehyde in 100 mM phosphate, pH 7.4. Cyanovirin-N and griffithsin (1 μg per 100 μl PBS), as well as the anti-2G12 monoclonal antibody made in plants (0.1 μg per 100 μl PBS) (a generous gift of Kevin Whaley of Mapp Biopharmaceutical, San Diego, CA), were labeled with Alexa Fluor dyes and then incubated with intact trophozoites and washed, as described for cyanovirin-N. Recombinant MBL (from Sigma-Aldrich, USA) were also labeled with Alexa Fluor dyes and incubated with intact trophozoites. Nuclei were stained with 0.1 μg/ml DAPI, and organisms were visualized with a DeltaVision deconvoluting microscope (Applied Precision, Issaquah, WA). Images were taken at 100 X primary and deconvolved using Applied Precision’s softWoRx software.

Measurement of the relative amount of cyanovirin-N to Trichomonas was performed using a BD FACSCalibur flow cytometer (BD Biosciences, Woburn, MA). The specificity of binding of cyanovirin-N to N-glycans was determined in three ways. First, we compared the amount of lectin bound to untreated Trichomonas versus Trichomonas grown for two days in the presence of 1 μg/ml tunicamycin, which inhibits the phosphoglucosyltransferase (encoded by the Alg7 gene) that catalyzes the first step in N-glycan precursor synthesis [26]. Second, trichomonads were electroporated with a morpholino to Alg7 gene (ACTCTTGTTGACATATTTGATTGTT) and then cultured for one day prior to labeling with cyanovirin-N, using methods similar to those for morpholino knockdowns in Giardia [50]. Third, a Saccharomyces mnn1/mmn4 double-knockout was made [44]; yeast were broken and walls were purified; and N-glycans were released from yeast walls with PNGaseF. The binding of cyanovirin-N to Trichomonas +/- yeast N-glycans was then measured using flow cytometry. Similar methods were used to measure binding of recombinant MBL to Trichomonas. Each flow experiment was repeated three times.

Agglutination by host MBL and galectin-1 or by anti-retroviral lectins (cyanovirin-N and griffithsin) was performed by incubating log-phase Trichomonas (12 X 104 parasites in 200 μl of TYM medium without serum and antibiotics) with 2.5 μg of lectin for 60 min at 37°C. In this assay, control Trichomonas incubated without lectin (control group) are flagellated and swimming, so that they are evenly distributed between four equal 50 μl volumes collected from top to bottom of the tubes. In contrast, Trichomonas agglutinated by the lectins precipitate to the bottom of the tube. The experiment was performed in duplicate and repeated twice.

Adherence of Trichomonas to ectocervical cells and to organotypic EpiVaginal tissue cells

For ectocervical cell assays, parental strain and ricin-resistant Trichomonas mutants were labeled with 10 μM CellTracker Blue CMAC (Invitrogen) and incubated with no lectin or with cyanovirin-N or 1 μg/ml griffithsin (each 1 μg per 100 μl PBS). Parasites (~100,000 per 500 μl PBS) +/- lectins were allowed to adhere to ~300,000 ectocervical cells grown to confluence on a coverslip in a 24 well plate [24]. After 30 min at 37°C coverslips were washed x 4 in PBS to remove nonadherent parasites, fixed in 4% paraformaldehyde, and mounted on slides. Fluorescenated Trichomonas present in fifteen 20X fields were counted using Scion Image for Windows. Each treatment was performed in triplicate, and each experiment was performed at least three independent times.

For organotypic EpiVaginal tissue cell assays, logarithmic phase parental strain and ricin-resistant Trichomonas mutants were labeled with 10 μM CellTracker green (CMFDA) for 5 min at RT (Invitrogen). CMFDA is concentrated in cytoplasmic vesicles of Trichomonas. Some Trichomonas trophozoites were also labeled with cyanovirin-N conjugated to Alexa Fluor 594 (1 μg per 100 μl PBS). Trichomonads were washed, resuspended in culture medium without serum, and incubated with EpiVaginal tissue cells for 60 min at 37°C under anaerobic conditions. Three washes in PBS were used to remove unbound parasites from EpiVaginal tissue cells, which were fixed in 2% paraformaldehyde, mounted on a two-chambered cover glass system (Thermo Fisher Scientific, Waltham MA), and observed with the deconvoluting microscope.

Infections of mice with Tritrichomonas

Six weeks old female BALB/c mice were purchased from Taconic (Hudson, NY). Five mice per treatment were infected vaginally with 500 parasites in 10 μl medium +/- 5 μg cyanovirin-N, griffithsin, 2G12 monoclonal antibody, or galectin-1 [2]. Alternatively, Tritrichomonas was infected vaginally with N-glycans released from Saccharomyces mnn1/mmn4 double-knockout. After two days 100 μl PBS was used to wash out Tritrichomonas parasites, which were incubated overnight in TYM medium to release organisms from viscous vaginal secretions. Parasites were fixed and counted. Each experiment was repeated at least three times.

Results

Effects of host mannose-binding lectin and yeast N-glycans on Trichomonas in vitro and Tritrichomonas in mice

Our hypothesis here is that host MBL, which binds to unmodified N-glycans of HIV, will also bind to unmodified N-glycans on Trichomonas (Fig 1A) [3336]. In support of this idea, we found that recombinant MBL binds to the surface of Trichomonas (Fig 1B). The non-homogeneous binding of MBL (and of anti-retroviral lectins in Figs 2A, 3A, 3B and 4B) is likely subsequent to the ridged and ruffled surface of trichomonads labeled in solution. The specificity of the binding of MBL to unmodified Trichomonas N-glycans was shown by decreased binding of MBL to Trichomonas pre-treated with an Alg7 morpholino, which decreases expression of the enzyme that is the first step in N-glycan precursor synthesis (Fig 1C) [26]. Trichomonads, which are flagellated and swim as individuals in solution, are agglutinated by MBL and sink to the bottom of a test tube (Fig 2B and 2C). These aggregates resemble “swarms” of Trichomonas formed in response to stress [51]. Similarly, recombinant galectin-1, which binds to the surface of Trichomonas [22], also causes flagellated trichomonads to self-aggregate and precipitate.

Fig 1. Mannose-binding lectin (MBL) binds to unprocessed N-glycans on the surface of Trichomonas.

Fig 1

A. MBL, as well as anti-retroviral lectins (cyanovirin-N and griffithsin) and 2G12 monoclonal antibody, binds to the single mannose arm (red box) of an unprocessed N-glycan of Trichomonas. B. MBL (green) labels the surface of Trichomonas. The nucleus is labeled with DAPI. C. Flow cytometry shows that labeling with the MBL (red) is decreased when Trichomonas is treated with an Alg7 morpholino (green) that decreases synthesis of the N-glycan precursor. Unlabeled parasites are shown in black. D. N-glycans from the Saccharomyces mnn1/mmn4 double-knockout decrease by 40% the recovery after two days of Tritrichomonas in the vagina of mice (average of three experiments with five mice each).

Fig 2. Host lectins (galectin-1 and MBL), as well as anti-retroviral lectins (cyanovirin-N and griffithsin) and 2G12 monoclonal antibody, agglutinate flagellated Trichomonas and cause them to precipitate.

Fig 2

A. Fluorescence micrograph of Trichomonas aggregated by griffithsin (green). Nuclei are labeled with DAPI. B. In the absence of host or exogenous lectins added to TYM medium (control group), flagellated Trichomonas parasites swim and remain in roughly equal numbers in the top (purple), middle (green and rust), and bottom (blue) 50 μl fractions of a 200 μl suspension. In contrast, host MBL and galectin-1 (Gal-1), as well as exogenous cyanovirin-N (CVN) and griffithsin (GFTH), agglutinate swimming Trichomonas and cause them to precipitate, so that the vast majority of the parasites are in the bottom 50 μl fraction (blue). The average of two experiments, each performed in duplicate, with very similar results is shown. C. Model shows that host or exogenous lectins agglutinate flagellated Trichomonas and cause them to precipitate (blue arrow).

Fig 3. Anti-retroviral lectins and the 2G12 monoclonal antibody bind N-glycans of Trichomonas.

Fig 3

A. Fluorescence micrographs show binding of griffithsin 2G12 antibody (red) to the surface of Trichomonas. B. Fluorescence micrograph shows binding of cyanovirin-N to the surface of Tritrichomonas. C. Flow cytometry shows that labeling with cyanovirin-N (green) is decreased when Trichomonas is treated with an Alg7 morpholino (red) or treated with tunicamycin (blue), both of which inhibit the first step in synthesis of the N-glycan precursor. D. Flow cytometry shows decreased binding of cyanovirin-N to Trichomonas (green) in the presence of N-glycans from the Saccharomyces mnn1/mmn4 double-knockout (red). E. Flow cytometry shows binding of cyanovirin-N to ricin resistant mutants (2E2 and 4–12) is slightly greater than binding to parent strain (B7RC2). F. Flow cytometry shows that binding of cyanovirin-N to two metronidazole-sensitive clinical isolates (bright blue and tan) and five metronidazole-resistant clinical isolates (green, dark blue, light blue, brown, and purple) from the CDC is as great or greater than binding of cyanovirin-N to B7RC2 (red), the parent strain for the ricin-resistant mutants.

Fig 4. Anti-retroviral lectins increase the adherence of ricin-resistant Trichomonas mutants to ectocervical cells, while cyanovirin-N is lost from the parasite surface when Trichomonas binds to EpiVaginal tissue cells and converts into an ameboid form.

Fig 4

A. Cyanovirin-N (CVN) increases the adherence of ricin-resistant mutant Trichomonas (2E2 and 4–12) to ectocervical cells in vitro, while griffithsin (GRFT) has less effect. Neither lectin has much effect on the parent B7RC2 strain, which is much more adherent to ectocervical cells in the absence of lectin. Data is average of three experiments. B. A flagellated Trichomonas labeled green with CMFDA (green), which concentrates in secretory vesicles, has cyanovirin-N (red) on its surface. C. When CMFDA-labeled Trichomonas adhere to organotypic EpiVaginal tissue cells, most of the cyanovirin-N is lost. Note that the host EpiVaginal cell (lower left) binds cyanovirin-N. D. A model for how host lectins affect adherence of Trichomonas to host cells is based upon experiments here and previously published experiments [24]. Galectin-1 (purple) secreted by the host epithelial cells cross-links LacNAc residues (bright blue) present on glycans of host proteins (grey) and on parasite LG (bright green). Similarly, host mannose-binding lectin (deep green) cross-links unmodified N-glycans (red) present on host and parasite proteins. E. Exogenous anti-retroviral lectins (brown) cross-link N-glycans on the surface of Trichomonas and host cells.

Because Trichomonas weakly infects mice while Tritrichomonas makes a robust infection that ascends into the uterus, Tritrichomonas was used to explore the possible role for parasite N-glycans in pathogenesis [2,3]. Tritrichomonas was directly applied to the mouse vagina +/- N-glycans from a Saccharomyces mnn1/mnn4 double knockout, which makes N-glycans similar to those of Trichomonas and HIV [44]. These yeast N-glycans, which have been used to raise antibodies targeted to the N-glycans present on gp120 of HIV, decreased recovery of Tritrichomonas by 40% (P < 0.001) after two days in the mouse vaginal model (Fig 1D). Because we did not perform a histological examination of the vagina nor are we detecting luciferase expressing parasites by bioluminescence, we cannot rule out that some adherent parasites remain after the vaginal wash. Alternatively, some Tritrichomonas may have migrated to the uterus and were not counted.

Anti-retroviral lectins and the 2G12 monoclonal antibody bind N-glycans of Trichomonas.

The anti-retroviral lectins cyanovirin-N and griffithsin and the anti-carbohydrate 2G12 monoclonal antibody bind to the surface of Trichomonas and Tritrichomonas (Figs 2A, 3A, 3B and 4B) [3740]. The specificity of cyanovirin-N for Trichomonas N-glycans was shown in two ways [30]. First, treatment of Trichomonas with an Alg7 morpholino or with tunicamycin, both of which target the first enzyme in N-glycan precursor synthesis, decreases binding of cyanovirin-N to the parasites, as measured by flow cytometry (Fig 3C) [26,50]. Second, binding of cyanovirin-N is inhibited by co-incubation with N-glycans released from a Saccharomyces mnn1/mmn4 double-knockout (Fig 3D) [44]. As a control for the adherence experiments (see below), we showed that binding of cyanovirin-N is slightly greater to ricin-resistant mutants (2E2 and 4–12) than to the parent strain (B7RC2) (Fig 3E) [24].

We tested the binding of cyanovirin-N to axenized clinical isolates of Trichomonas from the CDC, which are either sensitive to metronidazole (two isolates) or resistant to metronidazole (five isolates) [9,48]. All but one of the clinical isolates binds cyanovirin-N better than the parent strain (B7RC2) for the ricin-resistant mutants (Fig 3F). The two clinical isolates that bind cyanovirin-N best include one isolate that is metronidazole-sensitive and one that is metronidazole-resistant. These results suggest N-glycan synthesis and metronidazole activation are unrelated, and so anti-retroviral lectins might be used as an additional, local treatment for metronidazole-resistant Trichomonas or for pregnant women, who cannot take tinidazole.

Effects of anti-retroviral lectins on Trichomonas in vitro and Tritrichomonas in mice

Like MBL and galectin-1, anti-retroviral reagents (cyanovirin-N, griffithsin, and the 2G12 monoclonal antibody) each cause flagellated trichomonads to self-aggregate and precipitate (Fig 2A and 2B). Previous studies have shown that ricin-resistant mutants of Trichomonas adhere less well than the parental strain to ectocervical cells in vitro and that galectin-1 increases adherence [22,24]. Here we found that cyanovirin-N nearly doubles the adherence of ricin-resistant mutants to ectocervical cells, while griffithsin has a more modest effect on adherence (Fig 4A). In contrast, neither of the anti-retroviral lectins have much effect on adherence of the parent strain (B7RC2), which adheres well to ectocervical cell monolayers in the absence of lectins.

Close examination of Trichomonas adhering to organotypic EpiVaginal tissue cells, which form a multilayered squamous epithelium that closely resembles that of the vagina [46], showed three findings. First, cyanovirin-N increases adherence to EpiVaginal cells of ricin-resistant mutants, as was shown with ectocervical cell monolayers (data not shown). Second, cyanovirin-N binds well to EpiVaginal cells, which have unprocessed N-glycans on their surface in addition to complex N-glycans that do not bind cyanovirin-N (Fig 4C). Third, when trichomonads adhere to the EpiVaginal cells and transform from a flagellated to an ameboid form, they shed most of the cyanovirin-N that is present on swimming parasites (Fig 4B and 4C). Although cyanovirin-N agglutinates flagellated parasites and causes them to sink to the bottom of a tube or flask (Fig 2B and 2C), cyanovirin-N and the other lectins that bind to Trichomonas do not cause them to convert to an ameboid form, which only occurs when trichomonads adhere to host cells or to a derivatized surface [1318,22,24,25].

Topical application of cyanovirin-N or griffithsin at the time of infection with Tritrichomonas reduced the recovery of parasites from the vagina of mice after two days by 63% or 70%, respectively (Fig 5). Although the 2G12 monoclonal antibody had little effect on the recovery of Tritrichomonas from the mouse vagina, galectin-1 reduced recovery by 51% (Fig 5). These results, which have the same caveats as experiments with the yeast N-glycans with regards to missing adherent parasites or those that have migrated to the uterus, suggest anti-retroviral lectins have a modest potential for treating or preventing human infections with Trichomonas.

Fig 5. Anti-retroviral lectins decrease recovery of Tritrichomonas in a mouse vaginal model.

Fig 5

Recovery of Tritrichomonas after two days in the vagina of mice shows a modest but statistically significant decrease by co-infection with cyanovirin-N (63% decrease), griffithsin (70% decrease), or galectin-1 (51% decrease). In contrast, there is little effect of the 2G12 monoclonal antibody. Data is the average of three experiments each containing five mice per treatment.

Discussion

Revised models for Trichomonas adherence and pathogenesis

Previous studies showed that adherence of Trichomonas to ectocervical cells is mediated in part by host galectin-1, which is bivalent and binds to LacNAc on parasite LG and to LacNAc on host cells (Fig 4D) [2224]. The present experiments show that galectin-1 agglutinates flagellated Trichomonas, so they are less able to swim and divide (Fig 2B and 2C). In contrast, galectin-1 decreases recovery of Tritrichomonas in the mouse vaginal model (Fig 5). This discrepancy, which is also the case for the anti-retroviral lectins, suggests the importance of the in vivo model, even if it is with the bovine rather than the human parasite and even if there is a possibility that all parasites have not been obtained in the washes [2,3].

MBL, another important player in the host innate immune response, binds to unmodified N-glycans on the surface of Trichomonas and causes parasites to self-aggregate (Figs 1A–1C, 2B and 2C) [3336]. Whether complement activation by MBL plays a role in Trichomonas infections was not examined. Recovery of Tritrichomonas in the mouse vaginal model is decreased in the presence of N-glycans from the Saccharomyces mnn1/mmn4 double-knockout (Fig 1D) [44]. This result suggests roles for N-glycans of the host and/or parasite in colonization of trichomonads in vivo.

The results here, as well as recent experiments that demonstrate roles for parasite exosomes, bacterial vaginosis, and host cytokines [7,8,1315,2224,52], suggest that mechanisms of pathogenesis by Trichomonas are multiple and complex. Similarly, how anti-retroviral lectins reduce recovery of Tritrichomonas in vivo (next section) is likely more complicated than how these same reagents block invasion of HIV invasion into host cells [3740,53].

Modest potential for anti-retroviral lectins to prevent Trichomonas infections

The logic for testing anti-retroviral lectins versus Trichomonas included the following. Spectrometric studies show that many Trichomonas surface and secreted proteins have no known function and are unique to the parasite, so it is difficult to choose vaccine candidates (our unpublished data and [29]). The majority of unique Trichomonas proteins are absent from the predicted proteins of Tritrichomonas (our unpublished data), so that it is necessary to overexpress the Trichomonas vaccine candidate in transformed Tritrichomonas and then use these parasites in the mouse model [2,3,54]. In contrast, nearly all Trichomonas surface and secreted proteins have N-glycan sites. Like HIV and HSV, Trichomonas is sexually transmitted, so an anti-retroviral reagent present in the vagina might be used to prevent all three infections [1,6,3740]. The big advantage of using the anti-retroviral reagents versus Trichomonas is that GMP production, pharmacokinetic studies, and toxicity tests, all of which are likely prohibitively expensive for a new anti-trichomonad reagent, will have already been performed in an effort to prevent heterosexual transmission of HIV [39,40]. Finally, the use of a topical anti-retroviral reagent along with systemic treatment with tinidazole or metronidazole to treat drug-resistant Trichomonas is similar to the idea of combining anti-retroviral lectins with conventional anti-retroviral drugs to target HIV [55].

Similar to host galectin-1 [16], anti-retroviral lectins and 2G12 antibody increase adherence of trichomonads to ectocervical cells in vitro (Fig 4A). This effect is most likely by cross-linking unprocessed N-glycans on the surface of parasite and host (Figs 3B–3F and 4E). Agglutination of flagellated parasites by the anti-retroviral lectins may also contribute to their effect on adherence in vitro and colonization in vivo (Fig 2A–2C). While anti-retroviral lectins have been shown to decrease infectivity of numerous viruses in animal models, this is the first time that these lectins have been tested versus a parasite in a mouse model (Fig 5) [4143]. The modest reduction in Tritrichomonas recovered in the presence of anti-retroviral lectin (with many caveats about the counting) is much less than the total elimination of parasites that can be accomplished with metronidazole or tinidazole [9]. Indeed the partial reduction in parasite recovery is more similar to that seen by vaccination against Trichomonas, Entamoeba, or Giardia [10,56,57]. An alternative conclusion from the studies here is that the use of anti-retroviral reagents to prevent heterosexual transmission of HIV and HSV is unlikely to have a large negative effect on Trichomonas infections. Because Trichomonas does not infect easily infect mice, anti-retroviral lectins might be tested in an excellent but expensive pigtail macaque model of Trichomonas infection +/- HIV [5860].

Acknowledgments

Thanks to David Levin and Ekaterina Laz for help in construction of the Saccharomyces mnn1/mmn4 double-knockout. This work was supported by the Boston University Flow Cytometry Core Facility.

Data Availability

Data are all in figures within paper.

Funding Statement

This work was supported by the Boston University Flow Cytometry Core Facility, the National Institutes of Health, General Medical Science, GM031318 National Institutes of Allergy and Infectious Diseases, AI105779. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Johnston VJ, Mabey DC (2008) Global epidemiology and control of Trichomonas vaginalis . Curr Opin Infect Dis 21: 56–64. 10.1097/QCO.0b013e3282f3d999 [DOI] [PubMed] [Google Scholar]
  • 2. Corbeil LB, Munson L, Campero C, BonDurant RH (2001) Bovine trichomoniasis as a model for development of vaccines against sexually-transmitted disease. Am J Reprod Immunol 45: 310–319. [DOI] [PubMed] [Google Scholar]
  • 3. Cobo ER, Eckmann L, Corbeil LB (2011) Murine models of vaginal trichomonad infections. Am J Trop Med Hyg 85: 667–673. 10.4269/ajtmh.2011.11-0123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Conrad MD, Gorman AW, Schillinger JA, Fiori PL, Arroyo R, Malla N, et al. (2012) Extensive genetic diversity, unique population structure and evidence of genetic exchange in the sexually transmitted parasite Trichomonas vaginalis . PLoS Negl Trop Dis 6: e1573 10.1371/journal.pntd.0001573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Van Der Pol B, Kwok C, Pierre-Louis B, Rinaldi A, Salata RA, Chen PL, et al. (2008) Trichomonas vaginalis infection and human immunodeficiency virus acquisition in African women. J Infect Dis 197: 548–554. 10.1086/526496 [DOI] [PubMed] [Google Scholar]
  • 6. Satterwhite CL, Torrone E, Meites E, Dunne EF, Mahajan R, Ocfemia MC, et al. (2013) Sexually transmitted infections among US women and men: prevalence and incidence estimates, 2008. Sex Transm Dis 40: 187–193. 10.1097/OLQ.0b013e318286bb53 [DOI] [PubMed] [Google Scholar]
  • 7. Kusdian G, Gould SB (2014) The biology of Trichomonas vaginalis in the light of urogenital tract infection. Mol Biochem Parasitol 198: 92–99. 10.1016/j.molbiopara.2015.01.004 [DOI] [PubMed] [Google Scholar]
  • 8. Hirt RP, Sherrard J (2015) Trichomonas vaginalis origins, molecular pathobiology and clinical considerations. Curr Opin Infect Dis 28: 72–79. 10.1097/QCO.0000000000000128 [DOI] [PubMed] [Google Scholar]
  • 9. Kirkcaldy RD, Augostini P, Asbel LE, Bernstein KT, Kerani RP, Mettenbrink CJ, et al. (2012) Trichomonas vaginalis antimicrobial drug resistance in 6 US cities, STD Surveillance Network, 2009–2010. Emerg Infect Dis 18: 939–943. 10.3201/eid1806.111590 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Smith J, Garber GE (2014) Current status and prospects for development of a vaccine against Trichomonas vaginalis infections. Vaccine 32: 1588–1594. 10.1016/j.vaccine.2013.07.050 [DOI] [PubMed] [Google Scholar]
  • 11. Cywes-Bentley C, Skurnik D, Zaidi T, Roux D, Deoliveira RB, Garrett WS, et al. (2013) Antibody to a conserved antigenic target is protective against diverse prokaryotic and eukaryotic pathogens. Proc Natl Acad Sci U S A 110: E2209–E2218. 10.1073/pnas.1303573110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Jain A, Kumar L, Kushwaha B, Sharma M, Pandey A, Verma V, et al. (2014) Combining a synthetic spermicide with a natural trichomonacide for safe, prophylactic contraception. Hum Reprod 29: 242–252. 10.1093/humrep/det423 [DOI] [PubMed] [Google Scholar]
  • 13. Ryan CM, de Miguel N, Johnson PJ (2011) Trichomonas vaginalis: current understanding of host-parasite interactions. Essays Biochem 51: 161–175. 10.1042/bse0510161 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lustig G, Ryan CM, Secor WE, Johnson PJ (2013) Trichomonas vaginalis contact-dependent cytolysis of epithelial cells. Infect Immun 81: 1411–1419. 10.1128/IAI.01244-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Arroyo R, Gonzalez-Robles A, Martinez-Palomo A, Alderete JF (1993) Signalling of Trichomonas vaginalis for amoeboid transformation and adhesion synthesis follows cytoadherence. Mol Microbiol 7: 299–309. [DOI] [PubMed] [Google Scholar]
  • 16. Huang KY, Huang PJ, Ku FM, Lin R, Alderete JF, Tang P (2012) Comparative transcriptomic and proteomic analyses of Trichomonas vaginalis following adherence to fibronectin. Infect Immun 80: 3900–3911. 10.1128/IAI.00611-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Kusdian G, Woehle C, Martin WF, Gould SB (2013) The actin-based machinery of Trichomonas vaginalis mediates flagellate-amoeboid transition and migration across host tissue. Cell Microbiol 15: 1707–1721. 10.1111/cmi.12144 [DOI] [PubMed] [Google Scholar]
  • 18. Twu O, de Miguel N, Lustig G, Stevens GC, Vashisht AA, Wohlschlegel JA et al. (2013) Trichomonas vaginalis exosomes deliver cargo to host cells and mediate host∶parasite interactions. PLoS Pathog 9: e1003482 10.1371/journal.ppat.1003482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Twu O, Dessí D, Vu A, Mercer F, Stevens GC, de Miguel N, et al. (2014) Trichomonas vaginalis homolog of macrophage migration inhibitory factor induces prostate cell growth, invasiveness, and inflammatory responses. Proc Natl Acad Sci U S A 111: 8179–8184. 10.1073/pnas.1321884111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Singh BN, Hayes GR, Lucas JJ, Sommer U, Viseux N, Mirgorodskaya E, et al. (2009) Structural details and composition of Trichomonas vaginalis lipophosphoglycan in relevance to the epithelial immune function. Glycoconj J 26: 3–17. 10.1007/s10719-008-9157-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Ryan CM, Mehlert A, Richardson JM, Ferguson MA, Johnson PJ (2011) Chemical structure of Trichomonas vaginalis surface lipoglycan: a role for short galactose (β1-4/3) N-acetylglucosamine repeats in host cell interaction. J Biol Chem 286: 40494–4508. 10.1074/jbc.M111.280578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Okumura CY, Baum LG, Johnson PJ (2008) Galectin-1 on cervical epithelial cells is a receptor for the sexually transmitted human parasite Trichomonas vaginalis . Cell Microbiol 10: 2078–2090. 10.1111/j.1462-5822.2008.01190.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Camby I, Le Mercier M, Lefranc F, Kiss R (2006) Galectin-1: a small protein with major functions. Glycobiology 16: 137R–157R. [DOI] [PubMed] [Google Scholar]
  • 24. Bastida-Corcuera FD, Okumura CY, Colocoussi A, Johnson PJ (2005) Trichomonas vaginalis lipophosphoglycan mutants have reduced adherence and cytotoxicity to human ectocervical cells. Eukaryot Cell 4: 1951–1958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Martinotti MG, Martinetto P, Savoia D (1986) Adherence of Trichomonas vaginalis to cell culture monolayers. Eur J Clin Microbiol 5: 320–323. [DOI] [PubMed] [Google Scholar]
  • 26. Samuelson J, Banerjee S, Magnelli P, Cui J, Kelleher DJ, Gilmore R, Robbins PW. (2005) The diversity of dolichol-linked precursors to Asn-linked glycans likely results from secondary loss of sets of glycosyltransferases. Proc Natl Acad Sci U S A 102: 1548–1553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Banerjee S, Vishwanath P, Cui J, Kelleher DJ, Gilmore R, Robbins PW, et al. (2007) Evolution of quality control of protein-folding in the ER lumen. Proc Natl Acad Sci U S A 104: 11676–11681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Cui J, Smith T, Robbins PW, Samuelson J (2009) Darwinian selection for sites of Asn-liked glycosylation in phylogenetically disparate eukaryotes and viruses. Proc Natl Acad Sci U S A 106: 13421–13426. 10.1073/pnas.0905818106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. de Miguel N, Lustig G, Twu O, Chattopadhyay A, Wohlschlegel JA, Johnson PJ. (2010) Proteome analysis of the surface of Trichomonas vaginalis reveals novel proteins and strain-dependent differential expression. Mol Cell Proteomics 9: 1554–1566. 10.1074/mcp.M000022-MCP201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Adams EW, Ratner DM, Bokesch HR, McMahon JB, O'Keefe BR, Seeberger PH. (2004) Oligosaccharide and glycoprotein microarrays as tools in HIV glycobiology; glycan-dependent gp120/protein interactions. Chem Biol 11: 875–881. [DOI] [PubMed] [Google Scholar]
  • 31. Doores KJ, Bonomelli C, Harvey DJ, Vasiljevic S, Dwek RA, Burton DR, et al. (2010) Envelope glycans of immunodeficiency virions are almost entirely oligomannose antigens. Proc Natl Acad Sci U S A 107: 13800–13805. 10.1073/pnas.1006498107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Azadi P, Heiss C (2009) Mass spectrometry of N-linked glycans. Methods Mol Biol 534: 37–51. 10.1007/978-1-59745-022-5_3 [DOI] [PubMed] [Google Scholar]
  • 33. van den Berg LM, Geijtenbeek TB (2013) Antiviral immune responses by human langerhans cells and dendritic cells in HIV-1 infection. Adv Exp Med Biol 762: 45–70. 10.1007/978-1-4614-4433-6_2 [DOI] [PubMed] [Google Scholar]
  • 34. Ip WK, Takahashi K, Ezekowitz RA, Stuart LM (2009) Mannose-binding lectin and innate immunity. Immunol Rev 230: 9–21. 10.1111/j.1600-065X.2009.00789.x [DOI] [PubMed] [Google Scholar]
  • 35. Ji X, Gewurz H, Spear GT (2005) Mannose binding lectin (MBL) and HIV. Mol Immunol 42: 145–152. [DOI] [PubMed] [Google Scholar]
  • 36. Bulla R, De Seta F, Radillo O, Agostinis C, Durigutto P, Pellis V, et al. (2010) Mannose-binding lectin is produced by vaginal epithelial cells and its level in the vaginal fluid is influenced by progesterone. Mol Immunol 48: 281–286. 10.1016/j.molimm.2010.07.016 [DOI] [PubMed] [Google Scholar]
  • 37. Scanlan CN, Pantophlet R, Wormald MR, Ollmann Saphire E, Stanfield R, Wilson IA, et al. (2002) The broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2G12 recognizes a cluster of alpha1→2 mannose residues on the outer face of gp120. J Virol 76: 7306–7321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Balzarini J (2007) Targeting the glycans of glycoproteins: a novel paradigm for antiviral therapy. Nat Rev Microbiol 5: 583–597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. O'Keefe BR, Vojdani F, Buffa V, Shattock RJ, Montefiori DC, Bakke J, et al. (2009) Scaleable manufacture of HIV-1 entry inhibitor griffithsin and validation of its safety and efficacy as a topical microbicide component. Proc Natl Acad Sci U S A 106: 6099–6104. 10.1073/pnas.0901506106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Kouokam JC, Huskens D, Schols D, Johannemann A, Riedell SK, Walter W, et al. (2011) Investigation of griffithsin's interactions with human cells confirms its outstanding safety and efficacy profile as a microbicide candidate. PLoS One 6: e22635 10.1371/journal.pone.0022635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Nixon B, Stefanidou M, Mesquita PM, Fakioglu E, Segarra T, Rohan L, et al. (2013) Griffithsin protects mice from genital herpes by preventing cell-to-cell spread. J Virol 87: 6257–6269. 10.1128/JVI.00012-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Takebe Y, Saucedo CJ, Lund G, Uenishi R, Hase S, Tsuchiura T, et al. (2013) Antiviral lectins from red and blue-green algae show potent in vitro and in vivo activity against hepatitis C virus. PLoS One 8:e64449 10.1371/journal.pone.0064449 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. O'Keefe BR, Smee DF, Turpin JA, Saucedo CJ, Gustafson KR, Mori T, et al. (2003) Potent anti-influenza activity of cyanovirin-N and interactions with viral hemagglutinin. Antimicrob Agents Chemother 47: 2518–2525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Luallen RJ, Agrawal-Gamse C, Fu H, Smith DF, Doms RW, Geng Y, et al. (2010) Antibodies against Manalpha1,2-Manalpha1,2-Man oligosaccharide structures recognize envelope glycoproteins from HIV-1 and SIV strains. Glycobiology 20: 280–286. 10.1093/glycob/cwp184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Fichorova RN, Rheinwald JG, Anderson DJ (1997) Generation of papillomavirus-immortalized cell lines from normal human ectocervical, endocervical, and vaginal epithelium that maintain expression of tissue-specific differentiation proteins. Biol Reprod 57: 847–55. [DOI] [PubMed] [Google Scholar]
  • 46. Ayehunie S, Cannon C, Larosa K, Pudney J, Anderson DJ, Klausner M (2011) Development of an in vitro alternative assay method for vaginal irritation. Toxicology 279: 130–138. 10.1016/j.tox.2010.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Carlton JM, Hirt RP, Silva JC, Delcher AL, Schatz M, Zhao Q, et al. (2007) Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis . Science 315: 207–212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Crowell AL, Sanders-Lewis KA, Secor WE (2003) In vitro metronidazole and tinidazole activities against metronidazole-resistant strains of Trichomonas vaginalis . Antimicrob Agents Chemother 47: 1407–1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Clark CG, Diamond LS (2002) Methods for cultivation of luminal parasitic protists of clinical importance. Clin Microbiol Rev 15: 329–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Carpenter ML, Cande WZ (2009) Using morpholinos for gene knockdown in Giardia intestinalis . Eukaryot Cell 8: 916–919. 10.1128/EC.00041-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Hirt RP. (2013) Trichomonas vaginalis virulence factors: an integrative overview. Sex Transm Infect 89: 439–443. 10.1136/sextrans-2013-051105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Fichorova RN, Buck OR, Yamamoto HS, Fashemi T, Dawood HY, Fashemi B, et al. (2013) The villain team-up or how Trichomonas vaginalis and bacterial vaginosis alter innate immunity in concert. Sex Transm Infect 89: 460–466. 10.1136/sextrans-2013-051052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Buffa V, Stieh D, Mamhood N, Hu Q, Fletcher P, Shattock RJ (2009) Cyanovirin-N potently inhibits human immunodeficiency virus type 1 infection in cellular and cervical explant models. J Gen Virol 90: 234–243. 10.1099/vir.0.004358-0 [DOI] [PubMed] [Google Scholar]
  • 54. Kucknoor AS, Mundodi V, Alderete JF (2005) Heterologous expression in Tritrichomonas foetus of functional Trichomonas vaginalis AP65 adhesin. BMC Mol Biol 6: 5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Férir G, Palmer KE, Schols D (2011) Synergistic activity profile of griffithsin in combination with tenofovir, maraviroc and enfuvirtide against HIV-1 clade C. Virology 417: 253–258. 10.1016/j.virol.2011.07.004 [DOI] [PubMed] [Google Scholar]
  • 56. Barroso L, Abhyankar M, Noor Z, Read K, Pedersen K, White R, et al. (2014) Expression, purification, and evaluation of recombinant LecA as a candidate for an amebic colitis vaccine. Vaccine 32: 1218–1224. 10.1016/j.vaccine.2013.06.056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Jenikova G, Hruz P, Andersson MK, Tejman-Yarden N, Ferreira PC, Andersen YS, et al. (2011) Α1-giardin based live heterologous vaccine protects against Giardia lamblia infection in a murine model. Vaccine 29: 9529–9537. 10.1016/j.vaccine.2011.09.126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Patton DL, Sweeney YT, Agnew KJ, Balkus JE, Rabe LK, Hillier SL (2006) Development of a nonhuman primate model for Trichomonas vaginalis infection. Sex Transm Dis 33: 743–746. [DOI] [PubMed] [Google Scholar]
  • 59. Henning T, Fakile Y, Phillips C, Sweeney E, Mitchell J, Patton D, et al. (2011) Development of a pigtail macaque model of sexually transmitted infection/HIV coinfection using Chlamydia trachomatis, Trichomonas vaginalis, and SHIV (SF162P3). J Med Primatol 40: 214–223. 10.1111/j.1600-0684.2011.00488.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Henning TR, Butler K, Hanson D, Sturdevant G, Ellis S, Sweeney EM, et al. (2014) Increased susceptibility to vaginal simian/human immunodeficiency virus transmission in pig-tailed macaques coinfected with Chlamydia trachomatis and Trichomonas vaginalis . J Infect Dis 210: 1239–1247. 10.1093/infdis/jiu240 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are all in figures within paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES