Skip to main content
PLOS One logoLink to PLOS One
. 2015 Aug 7;10(8):e0134055. doi: 10.1371/journal.pone.0134055

Diversity of Pneumolysin and Pneumococcal Histidine Triad Protein D of Streptococcus pneumoniae Isolated from Invasive Diseases in Korean Children

Ki Wook Yun 1,2, Hyunju Lee 3, Eun Hwa Choi 1,2, Hoan Jong Lee 1,2,*
Editor: Paulo Lee Ho4
PMCID: PMC4529296  PMID: 26252211

Abstract

Pneumolysin (Ply) and pneumococcal histidine triad protein D (PhtD) are candidate proteins for a next-generation pneumococcal vaccine. We aimed to analyze the genetic diversity and antigenic heterogeneity of Ply and PhtD for 173 pneumococci isolated from invasive diseases in Korean children. Allele was designated based on the variation of amino acid sequence. Antigenicity was predicted by the amino acid hydrophobicity of the region. There were seven and 39 allele types for the ply and phtD genes, respectively. The nucleotide sequence identity was 97.2%-99.9% for ply and 91.4%-98.0% for phtD gene. Only minor variations in hydrophobicity were noted among the antigenicity plots of Ply and PhtD. Overall, the allele types of the ply and phtD genes were remarkably homogeneous, and the antigenic diversity of the corresponding proteins was very limited. The Ply and PhtD could be useful antigens for universal pneumococcal vaccines.

Introduction

Streptococcus pneumoniae is one of the most important pathogens responsible for otitis, sinusitis, and pneumonia and is a predominant cause of meningitis and bacteremia [1]. Since the introduction of the 7-valent pneumococcal conjugate vaccine (PCV7), a decrease in the incidence of invasive pneumococcal disease (IPD) caused by vaccine serotypes has been observed in pediatric and non-pediatric populations [2, 3]. Currently, licensing of the 10- and 13-valent PCVs heralds a new era in the control of pneumococcal diseases.

However, the licensed PCVs elicit protective antibodies against only the serotypes included in the vaccine formulation. Furthermore, an increase of non-PCV7 serotypes in IPD has been observed in many countries [1]. To broaden the protection afforded by the vaccine, therefore, it has been suggested that a serotype-independent vaccine be developed, and virulence protein components have been proposed as vaccine candidates [4]. Various virulence proteins of S. pneumoniae have been investigated as candidate antigens for protein-based vaccines [5]. These protein antigens are expected to be immunogenic in young children without requiring chemical conjugates or other carriers. Among them, the immunogenicity and prevalence of pneumolysin (Ply) and pneumococcal histidine triad protein D (PhtD) make these proteins the most promising vaccine candidates for preventing pneumococcal disease [57].

Ply, a 53-kDa cytoplasmic cholesterol-dependent pore-forming toxin, is thought to be an important virulence factor that exerts lytic effects on many cell types. In addition to mediating cell lysis, sub-lytic levels of Ply have a number of effects on host systems, including complement activation and the induction of proinflammatory mediators [8]. Recently, Shak et al. reported a novel role for Ply in the assembly of S. pneumoniae biofilms [9]. PhtD is a relatively large surface protein of 110 kDa and is thought to be involved in multiple functions, including metal ion homeostasis, evasion of complement deposition, and adherence of bacteria to host cells [7]. The protective efficacy of immunization with a Ply toxoid and PhtD has been demonstrated in animal models [1013] and clinical trials [1416].

Variation in the amino acid sequence of a candidate protein may influence the immunogenicity of a vaccine based on the presence of a single allele of given protein [17]. Although the antigenicity of a candidate protein may appear to be good, a protein with high sequence diversity does not make an ideal candidate vaccine. Few studies have investigated the sequence conservation of the ply and phtD genes among several pneumococcal serotypes of invasive isolates. Thus, we aimed to characterize the genetic diversity and antigenicity of the two most promising antigens, Ply and PhtD, for a protein vaccine.

Materials and Methods

This study was approved by the Institutional Review Board of Seoul National University Hospital (IRB registration number 1306-071-527). The Ethics Committee allowed a waiver of informed consent because this study included only the information of bacteria without any information of human from whom the bacteria was obtained.

Strains

A total of 173 invasive pneumococcal isolates were obtained from children <18 years of age at the Seoul National University Children’s Hospital between 1991 and 2011. An ‘invasive isolate’ was defined as the isolate obtained from a normally sterile body fluid, such as blood, cerebrospinal fluid, pleural fluid, ascites, or joint fluid. Each isolate was identified using standard microbiological techniques, including observations of colony morphology, hemolysis pattern, and optochin susceptibility tests. Isolates were kept at -80°C until use. Serotype was determined using the Quellung reaction and by polymerase chain reaction (PCR) followed by sequencing of capsular genes [18].

Sequence analysis of the ply and phtD genes

Extraction and purification of DNA from pneumococcal colonies were performed using a QIAamp Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s protocol. Sequence analyses of the ply and phtD genes were performed for all 173 invasive pneumococcal isolates. The complete sequences of the ply and phtD genes were amplified with newly designed primers and sequenced using conditions as described previously [19]. All primers used in this study are listed in Table 1. All sequences generated in this study have been deposited in GenBank under accession numbers KP110598 to KP110770 for the ply gene and KP127680 to KP127852 for the phtD gene.

Table 1. Oligonucleotide primers used for polymerase chain reaction and sequencing in this study.

Target gene Primer name Sequence (5’ → 3’) Reference
Ply Ply_9Y CGGGATCCGGCAAATAAAGCAGTAAATGACTTT 19
Ply_9Z GACGGAGCTCGACTAGTCATTTTCTACCTTATC
Ply_4V CAATACAGAAGTGAAGGCGG
PhtD PhtD_F2 GACCCACAAAATGACAAGACC This study
PhtD_F3 TCGTTATATCCCAGCCAAGG
PhtD_F4 AACCAAATGCGCAAATTACC
PhtD_R2 TCCTTATTTTCCTGCGAACG
PhtD_R3 GGAGGGGTCAAACCTTTCTC
PhtD_R4 GGTTGAGCTGGATTTGCATT

Allele type determination

DNA sequences were translated into amino acid sequences, and an alignment was performed, which resulted in the identification of different allele types at the protein level. For Ply, these data were compared to previously determined allele types [19], and newly identified allele types were ordered by number. Because alleles of the phtD gene have not been reported previously, all allele types of the phtD gene were newly assigned in this study, according to their amino acid sequence variations. In addition, ply and phtD alleles were subtyped according to variations in their nucleotide sequence. For allele typing of both genes, the sequences from the D39 strain were designated as allele 1 and served as reference sequences.

Phylogenetic analysis

To investigate the evolutionary relationships among the allele types of the ply and phtD genes in Korea, phylogenetic trees were individually constructed with the full nucleotide sequences of the ply and phtD genes obtained from the pneumococcal isolates in this study via the neighbor-joining method [20]. All evolutionary trees were drawn using MEGA5 software (http://megasoftware.net/) [21]. Pairwise evolutionary differences were computed using the maximum composite likelihood method in MEGA5. The percentages of replicate trees in which the associated sequences clustered together in the bootstrap test (500 replicates) are reported as the bootstrap values. In addition, based on the phylogenetic tree, a clade type was assigned to the allele groups that shared a main branch of the tree.

Antigenicity plots

Antigenic patterns of the Ply and PhtD proteins were analyzed to identify the point of greatest local hydrophobicity. This was accomplished by assigning a numerical value (hydrophobicity value) to each amino acid and then taking a moving average of these values along the peptide chain. The point of highest local average hydrophobicity was invariably located in or immediately adjacent to an antigenic determinant [22]. Antigenicity values were calculated, and the relevant diagrams were constructed using the CLC Main Workbench ver. 6.6.5 software (CLC bio, Aarhus, Denmark). Antigenicity plots for Ply and PhtD were compared with each other individually, as well as with plots for the D39 strain, which was used as a reference sequence in a previous study [19]. Antigenicity plots with different amplitudes or numbers of peak hydrophobicity points were defined as having ‘different antigenicity’.

Results

Characteristics and serotypes of pneumococcal isolates

All 173 pneumococcal isolates were obtained from sterile body fluid samples from children diagnosed with IPD. The median age of the children was 30.2 (range: 1.2–213.5) months. Twenty-four (13.9%) isolates were collected in 1991–1995, 54 (31.2%) isolates in 1995–2000, 47 (27.2%) isolates in 2001–2005, and 48 (27.7%) isolates in 2006–2011. A total of 27 serotypes were identified; the most common serotypes were 19A (17.3%), followed by 23F (13.9%), 6B (9.8%), and 14 (9.2%).

Allele types and sequence diversity of the ply gene

Five allele types (1, 2, 3, 9, and 10) were identified from among 18 previously reported types [19]. Two additional allele types, alleles 19 and 20, were newly identified in this study and had two amino acid changes each relative to the reference sequence (D39 strain, allele 1): D366N and V372I in allele 19, and K224R and H386Y in allele 20 (Fig 1). Alleles 1 (n = 64, 37.0%) and 2 (n = 87, 50.3%) were the most commonly observed ply alleles, in agreement with a previous study [19]. The numbers of isolates representing the other ply allele types were four (2.3%) for allele 3, 14 (8.1%) for allele 9, one (0.6%) for allele 10, two (1.2%) for allele 19, and one (0.6%) for allele 20. The two isolates from which ply allele 19 had been obtained were of serotypes 15B and 15C, and the isolate from which ply allele 20 had been obtained was of serotype 35B. Subtypes, which are defined as variations in nucleotide sequences that did not change amino acid sequences, were provided in Fig 2.

Fig 1. Allele types and corresponding variations in amino acid sequences of pneumolysin (ply).

Fig 1

The amino acid sequence of allele type 1 (D39 strain) was compared with all other allele types. The novel allele types, 19 and 20, are indicated by shaded rows. Notes: ND, not detected; Del, single amino acid deletion; Ins, 8 (in allele 4) and 291 (in allele 14) amino acid insertions.

Fig 2. Allele subtypes and corresponding variations of nucleotide sequences of pneumolysin (Ply) identified in this study.

Fig 2

Nucleotide sequence of allele subtype 1.0 (D39 strain) was compared with that of all other allele types. Note: del, single nucleotide deletion.

All ply allele types except alleles 4 and 14 were 471 amino acids length. As previously reported [19, 23], ply alleles 4 and 14 include insertions (INS) of eight and 291 amino acids, respectively (Fig 1). To facilitate the comparison of the sequence diversity that was common to the ply allele types, we excluded these INS from ply alleles 4 and 14 from further analyses. When the INS were excluded, the sequences of allele types 4 and 14 were identical to the sequences of allele types 2 and 1, respectively. Greater than 98% amino acid sequence identity (98.3%-100%, pairwise comparisons, data not shown) was found among all ply allele types, including the novel allele types 19 and 20. In addition, a nucleotide sequence identity of >95% (96.2%-99.9%) was observed among all known ply allele types. When the nucleotide sequences of the 28 ply allele subtypes in this study (Fig 2) were compared, sequence identity increased among the subtypes (97.2%-99.9%, pairwise comparisons, data not shown).

Allele types and sequence diversity of the phtD gene

Initially, we identified six allele types from the currently available six sequences of the phtD gene from GenBank database (NC_003098, NC_008533, NC_011072, NC_011900, NC_017592, and NC_017593), based on their amino acid sequence variations. In addition, 34 additional allele types were identified in a set of 173 invasive pneumococcal isolates in this study. All phtD genes showed one of 12 amino acid lengths, ranged from 833 to 856. Allele number was assigned to each allele type by their amino acid sequence and length, and in identified order, except allele 1 (phtD allele 1 was assigned to the D39 reference strain, NC_008533) (Table 2). Allele types in the same amino acid length showed the amino acid sequence identities of >95%, except alleles 39 and 40 (identity of 93.5%, pairwise comparisons). Pairwise comparisons of nucleotide and amino acid sequences for all phtD allele types demonstrated 91.4%-99.9% and 90.4%-99.9% identities, respectively.

Table 2. Allele types of pneumococcal histidine triad protein D (phtD).

Allele Size (aa) Number (%) of isolates Amino acid sequence Identity (%) of isolates*
1 854 1 (0.6) 100
2 843 0 NA
3, 4 842 5 (2.9) 99.41
5–9 840 8 (4.6) 96.55–99.17
10–23 839 127 (73.4) 97.26–99.88
24, 25 833 4 (2.3) 99.64
26–28 835 4 (2.3) 98.56–99.88
29–32 849 4 (2.3) 95.32–97.65
33–36 850 14 (8.1) 98.12–99.53
37 856 2 (1.2) 100
38 844 1 (0.6) 100
39, 40 857 3 (1.7) 93.47

aa, amino acid; NA, not available

*Pairwise comparisons

Fourteen allele types (alleles 10–23) and 127 (73.4%) pneumococcal isolates showed an amino acid length of 839 (Table 2). phtD allele 2, assigned from a GenBank strain (NC_011072), was not identified in this study. Among 39 allele types of phtD gene, only the allele types 3 and 10 were divided to two subtypes according to their nucleotide sequence variation. Only one nucleotide sequence each differed between the two subtypes both in phtD alleles 3 (C2802T) and 10 (G1296T). Amino acid sequence alignments for 12 representative allele types of the phtD, which were each one allele type in different length of amino acid, are presented in Fig 3.

Fig 3. Amino acid sequence alignment for 12 representative allele types of pneumococcal histidine triad protein D (phtD).

Fig 3

Each one allele type was selected from each length of amino acids of phtD. Sequences of allele 1, 2, 3, 5, 10, 24, 26, 29, 33, 37, 38, and 39 were presented in top-down order. Identical residues are shown as dots.

Phylogenetic analysis of the ply and phtD genes

Phylogenetic trees were constructed based on the nucleotide sequences of the entire ply and phtD genes, respectively. The nucleotide sequences of all allele subtypes of the ply gene from pneumococcal isolates in this study were aligned for neighbor-joining analysis. As the allele types of phtD gene in the same amino acid lengths have a large degree of homogeneous nucleotide sequences, we analyzed 12 representative allele types of the phtD gene instead of all 39 allele types.

For the ply gene, one of four clades (A, B, C, and D) was assigned to each allele subtype according to the main branch from which it was derived (Fig 4A). Ply allele type 19 clustered with allele 1 (clade A, defined in this study), and allele type 20 was placed in the furthest diverged clade D. For the phtD gene, we classified allele types into three clades, specifically A, B, and C (Fig 4B).

Fig 4. Phylogenetic analysis of all pneumolysin (A) and pneumococcal histidine triad protein D (B) alleles.

Fig 4

Phylogenetic and molecular evolutionary analyses were performed with the MEGA5 program using the neighbor-joining method. The numbers at the ends of the tree and the characters (A, B, C, and D) in the square boxes indicate allele and clade types for ply or phtD, respectively. The bar at the bottom represents genetic distance. Bootstrap support based on 500 replicates were 41% for A and B, 59% for A and C, and 91% for B and D in Fig 4A and. 86% for A and B and 49% for A and C in Fig 4B.

Antigenicity plots of the ply and phtD genes

The majority of ply allele types, including the novel alleles 19 and 20, exhibited the same antigenicity plots. Exceptions to this were alleles 3, 5, 6, and 10, which included only 1–2 positions that differed from reference allele 1, in positions spanning amino acids 150–170 (YEKITAHSMEQ; Y150H in allele 5 and S167F in allele 6) and 270–280 (VKVAPQTEWKQ; del[270K, 271V] in alleles 3, 5, 6, and 10; Figs 1 and 5A). Among our isolates, only five (2.9%; four for allele 3 and one for allele 10) isolates exhibited different antigenicity plots.

Fig 5. Comparison of the antigenicity plots of pneumolysin (A) and pneumococcal histidine triad protein D (B) alleles.

Fig 5

The vertical axis represents antigenicity values. Closed black arrows indicate the residues with antigenicity values different from that of the D39 strain (allele 1) reference sequence. The insertion sequences in alleles 4 and 14 of pneumolysin were excluded in this comparison for simplicity.

Similarly, the phtD alleles were classified into five antigenicity patterns. Isolates of phtD alleles 10–28 (n = 135, 78.0%) exhibited the same antigenicity pattern, while the other isolates (n = 31, 17.9%), except those of alleles 3–9 (n = 7, 4.0%), showed a similar antigenicity pattern with a minor difference at a single position. Three positions differed from each other within amino acids 160–170 (RSHNHNSRADN HSQHREGGTSANDG in alleles 3, 4, 39, and 40 and HSHNHGGGSNDQ in alleles 5–9, 29–36, and 38), 700–720 (QRNKNGQADTNQTEKPNEEKP RKNKVD in alleles 5–9 and RKNKAD in alleles 3, 4, and 10–28), and 770 (addition of the three amino acid sequence, KLR in allele 37; Figs 3 and 5B).

Discussion

In this work, we characterized the sequence variations and antigenicities of the ply and phtD genes from 173 pneumococci that were isolated from invasive diseases in children between 1991 and 2011. Overall genetic identity with respect to the nucleotide sequences of ply and phtD in our isolates was greater than 97% and 91%, respectively, and an exclusively homogeneous pattern was seen in the antigenicity plots for both genes. We report the presence of seven ply alleles from a collection of 173 isolates, two of which are novel allelic variants. Moreover, we believe this to be the first study examining the allelic distribution of the phtD gene among clinical isolates of S. pneumoniae.

Ply is produced by all known clinical isolates of S. pneumoniae, irrespective of serotype and genotype. The amino acid sequence of Ply is thought to be highly conserved over time and geographic distance [23]. However, others have reported the existence of at least 18 different Ply variants at the protein level, especially in carriage isolates [19]. The genes of Ply were detected in all invasive pneumococcal isolates in this study and exhibited very stable sequences over 21 years, although some allelic variations were present. When amino acid insertions were excluded from alleles 4 and 14 for comparison, all known allele types, including the novel types 19 and 20, also demonstrated stable antigenic properties. Moreover, insertions in the alleles 4 and 14 did not have a large impact on the antigenicity plot and pneumococcal strains with ply alleles 4 and 14 were not identified in this study. Only the two amino acid substitutions at residues 150 and 167 and two amino acid deletions at residues 270 and 271 produced subtle changes in antigenicity values at these locations. Ply residues 150–167 and 270–271 are included in Ply domains 1 and 3, respectively. Among the four domains of Ply, domains 1 and 3 are expected to have important roles in inducing conformational changes in the Ply oligomer, resulting in membrane deformation of a target cell [24]. Further studies are needed to determine whether minor sequence changes in domains 1 and 3 of Ply, as observed in the present study, can influence pneumococcal virulence.

There is a high degree of protein sequence conservation among PhtD proteins from diverse S. pneumoniae serotypes, and a recent study showed that PhtD is present in 100% of known strains [25]. The genes of PhtD were also detected in all 173 invasive isolates in the current study. Seventy-three percent of isolates had a size of 839 amino acids, which was designated as alleles 10–23. Although amino acid sequence and allelic variations in phtD genes were observed, nucleotide as well as amino acid sequences were not very diverse among the different allele types. In the phylogenetic analysis, clade B contained PhtD allele types 3, 5, 10, 24, 26, and 39, which comprised a total of 151 (87.3%) isolates in this study. Moreover, the antigenicity patterns of PhtD were much more homogeneous than expected based on genetic identity. All three regions differed primarily in terms of their antigenicity patterns, and residues 160–170, 700–720, and 770, in which variations occurred, were included in the regions that do not produce functional domains [26]. Whether these PhtD sequence variations can affect the virulence of pneumococci should be evaluated further.

This study has some limitations. In this study, among all the known 18 alleles of ply, only 7 allele were identified. Although this can represent sequence homogeneity of invasive pneumococcal isolates in Korea, this should be confirmed by further researches with larger sample sizes and more diverse geographical sampling. This study explored the diversity and antigenicity of the ply and phtD of the invasive isolates only. Further studies should be extended to determine the diversity of the pneumococcal carriage strains.

Sequence conservation is a necessary requirement for a universal pneumococcal vaccine. Few studies have investigated the sequence conservation of ply and phtD among invasive pneumococcal isolates from children. To investigate the extent of conservation of the ply and phtD genes, we sequenced ply and phtD from 173 pneumococcal isolates and compared the sequences to each other and to sequences in the GenBank database. In this study, the genetic and antigenic diversities of Ply and PhtD were very limited. The apparent ubiquity of Ply and PhtD along with their presumed lack of antigenic variability could make them attractive candidates for serotype-independent pneumococcal vaccines. It is also thought that the minor antigenic variations in Ply and/or PhtD in some strains could exert some influence on their virulence, a concept that should be explored.

Acknowledgments

We thank Sung-yeon Lee and Sun-jung Kim of the Seoul National University Hospital for technical assistance.

Data Availability

All relevant data are within the paper.

Funding Statement

This research was supported by the Basic Science Research Program through the National Research Foundation (NRF) of Korea, which is funded by the Ministry of Education, Science, and Technology (2011-0023092). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Linares J, Ardanuy C, Pallares R, Fenoll A. Changes in antimicrobial resistance, serotypes and genotypes in Streptococcus pneumoniae over a 30-year period. Clin Microbiol Infect. 2010;16: 402–410. 10.1111/j.1469-0691.2010.03182.x [DOI] [PubMed] [Google Scholar]
  • 2. Whitney CG, Farley MM, Hadler J, Harrison LH, Bennett NM, Lynfield R, et al. Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N Engl J Med. 2003;348: 1737–1746. [DOI] [PubMed] [Google Scholar]
  • 3. Cho EY, Lee H, Choi EH, Kim YJ, Eun BW, Cho YK, et al. Serotype distribution and antibiotic resistance of Streptococcus pneumoniae isolated from invasive infections after optional use of the 7-valent conjugate vaccine in Korea, 2006–2010. Diagn Microbiol Infect Dis. 2014;78: 481–486. 10.1016/j.diagmicrobio.2013.12.016 [DOI] [PubMed] [Google Scholar]
  • 4. Barocchi MA, Censini S, Rappuoli R. Vaccines in the era of genomics: The pneumococcal challenge. Vaccine. 2007;25: 2963–2973. [DOI] [PubMed] [Google Scholar]
  • 5. Gamez G, Hammerschmidt S. Combat pneumococcal infections: adhesins as candidates for protein-based vaccine development. Current drug targets. 2012;13: 323–337. [DOI] [PubMed] [Google Scholar]
  • 6. Mitchell AM, Mitchell TJ. Streptococcus pneumoniae: virulence factors and variation. Clin Microbiol Infect. 2010;16: 411–418. 10.1111/j.1469-0691.2010.03183.x [DOI] [PubMed] [Google Scholar]
  • 7. Plumptre CD, Ogunniyi AD, Paton JC. Polyhistidine triad proteins of pathogenic streptococci. Trends Microbiol. 2012;20: 485–493. 10.1016/j.tim.2012.06.004 [DOI] [PubMed] [Google Scholar]
  • 8. Yoo IH, Shin HS, Kim YJ, Kim HB, Jin S, Ha UH. Role of pneumococcal pneumolysin in the induction of an inflammatory response in human epithelial cells. FEMS Immunol Med Microbiol. 2010;60: 28–35. 10.1111/j.1574-695X.2010.00699.x [DOI] [PubMed] [Google Scholar]
  • 9. Shak JR, Ludewick HP, Howery KE, Sakai F, Yi H, Harvey RM, et al. Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms. MBio. 2013;4: e00655–13. 10.1128/mBio.00655-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Alexander JE, Lock RA, Peeters CC, Poolman JT, Andrew PW, Mitchell TJ, et al. Immunization of mice with pneumolysin toxoid confers a significant degree of protection against at least nine serotypes of Streptococcus pneumoniae . Infect Immun. 1994;62: 5683–5688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Norcross EW, Sanders ME, Moore QC 3rd, Taylor SD, Tullos NA, Caston RR, et al. Active immunization with pneumolysin versus 23-valent polysaccharide vaccine for Streptococcus pneumoniae keratitis. Invest Ophthalmol Vis Sci. 2011;52: 9232–9243. 10.1167/iovs.10-6968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Denoel P, Philipp MT, Doyle L, Martin D, Carletti G, Poolman JT. A protein-based pneumococcal vaccine protects rhesus macaques from pneumonia after experimental infection with Streptococcus pneumoniae . Vaccine. 2011;29: 5495–5501. 10.1016/j.vaccine.2011.05.051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Plumptre CD, Ogunniyi AD, Paton JC. Vaccination against Streptococcus pneumoniae using truncated derivatives of polyhistidine triad protein D. PLoS One. 2013;8: e78916 10.1371/journal.pone.0078916 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Kamtchoua T, Bologa M, Hopfer R, Neveu D, Hu B, Sheng X, et al. Safety and immunogenicity of the pneumococcal pneumolysin derivative PlyD1 in a single-antigen protein vaccine candidate in adults. Vaccine. 2013;31: 327–333. 10.1016/j.vaccine.2012.11.005 [DOI] [PubMed] [Google Scholar]
  • 15. Seiberling M, Bologa M, Brookes R, Ochs M, Go K, Neveu D, et al. Safety and immunogenicity of a pneumococcal histidine triad protein D vaccine candidate in adults. Vaccine. 2012;30: 7455–7460. 10.1016/j.vaccine.2012.10.080 [DOI] [PubMed] [Google Scholar]
  • 16. Bologa M, Kamtchoua T, Hopfer R, Sheng X, Hicks B, Bixler G, et al. Safety and immunogenicity of pneumococcal protein vaccine candidates: monovalent choline-binding protein A (PcpA) vaccine and bivalent PcpA-pneumococcal histidine triad protein D vaccine. Vaccine. 2012;30: 7461–7468. 10.1016/j.vaccine.2012.10.076 [DOI] [PubMed] [Google Scholar]
  • 17. Selva L, Ciruela P, Blanchette K, del Amo E, Pallares R, Orihuela CJ, et al. Prevalence and clonal distribution of pcpA, psrP and Pilus-1 among pediatric isolates of Streptococcus pneumoniae . PLoS One. 2012;7: e41587 10.1371/journal.pone.0041587 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Choi EH, Lee HJ, Cho EY, Oh CE, Eun BW, Lee J, et al. Prevalence and genetic structures of Streptococcus pneumoniae serotype 6D, South Korea. Emerg Infect Dis. 2010;16: 1751–1753. 10.3201/eid1611.100941 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Jefferies JM, Tocheva AS, Rubery H, Bennett J, Garland J, Christodoulides M, et al. Identification of novel pneumolysin alleles from paediatric carriage isolates of Streptococcus pneumoniae . J Med Microbiol. 2010;59: 808–814. 10.1099/jmm.0.018663-0 [DOI] [PubMed] [Google Scholar]
  • 20. Wu X, Wan XF, Wu G, Xu D, Lin G. Phylogenetic analysis using complete signature information of whole genomes and clustered Neighbour-Joining method. Int J Bioinform Res Appl. 2006;2: 219–248. [DOI] [PubMed] [Google Scholar]
  • 21. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28: 2731–2739. 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hopp TP, Woods KR. Prediction of protein antigenic determinants from amino acid sequences. Proc Natl Acad Sci U S A. 1981;78: 3824–3828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Mitchell TJ, Mendez F, Paton JC, Andrew PW, Boulnois GJ. Comparison of pneumolysin genes and proteins from Streptococcus pneumoniae types 1 and 2. Nucleic Acids Res. 1990;18:4010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Tilley SJ, Orlova EV, Gilbert RJ, Andrew PW, Saibil HR. Structural basis of pore formation by the bacterial toxin pneumolysin. Cell. 2005;121: 247–256. [DOI] [PubMed] [Google Scholar]
  • 25. Rioux S, Neyt C, Di Paolo E, Turpin L, Charland N, Labbe S, et al. Transcriptional regulation, occurrence and putative role of the Pht family of Streptococcus pneumoniae . Microbiology. 2011;157: 336–348. 10.1099/mic.0.042184-0 [DOI] [PubMed] [Google Scholar]
  • 26. Bersch B, Bougault C, Roux L, Favier A, Vernet T, Durmort C. New insights into histidine triad proteins: solution structure of a Streptococcus pneumoniae PhtD domain and zinc transfer to AdcAII. PLoS One. 2013;8: e81168 10.1371/journal.pone.0081168 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES