Extended Data Table 1. Summary of recursive intron lariats identified by directed RT-PCR and sequencing.
Gene | Segment | Coordinate of putative branchpoint | Distance upstream of 3′ splice site | Sequence surrounding bp | Identified in Total RNA-Seq Data |
---|---|---|---|---|---|
Sdc | segment3 | 2R:17299944 | 21 | CATCTCACTCATAAATGTGTT | No |
cpo | segment1 | 3R:13803044 | 34 | AAGGTAACTAATATGATTTTT | Yes |
cpo | segment2 | 3R:13815266 | 31 | CCAAATGCTAATTTTATACTT | Yes |
cpo | segment3 | 3R:13832619 | 37 | AGCAATCATCTAACGATTCTC | Yes |
bun | segment2 | 2L: 12458256 | 32 | CAACATACTTACAGAACCTTT | No |
CG7029 | segment2 | 3R:18592273 | 55 | GTTTGTGCTCACAGAGTCTGC | No |
nuf | segment2 | 3L:14223246 | 29 | ATATAGACTTATCAGTTCTCT | No |
CG31637 | segment2 | 2L:6525343 | 23 | GAGTATTCTAACAAGTTTCTC | Yes |
dally | segment1 | 3L:8843654 | 26 | CTAAATCTGTGCTTAATTTCT | No |
dally | segment2 | 3L:8855584 | 45 | AATTTGCACCATCGCATAACT | Yes |
dally | segment3 | 3L:8870223 | 29 | ATCCAAGCTCATCTCCTCTTT | Yes |
Mmp2 | segment2 | 2R:5503040 | 33 | TAGCATGCTGATATCATGTTT | No |
osp | segment2 | 2L: 14656399 | 30 | AACCAAACTAATTTTTCTACC | No |
osp | segment1 | 2L:14677529 | 41 | ACATCTTCTTACTAAATTATT | No |