Abstract
Coagulase negative staphylococci are recognized as opportunistic pathogens and are widespread in the environment. It is possible to prevent and control infections due to these bacteria if their virulence factors are recognized. Eighty isolates of Staphylococcusepidermidis (S. epidermidis) including 42 from urine (52.5%), 23 from blood (28.75%), 15 from dialysis bags (18.75%) were studied for biofilm production on Congo red agar (CRA). The virulence genes in S. aureus were investigated using polymerase chain reaction (PCR) with primers. Out of 80 isolates studied, 40 isolated (50%) formed black colonies (biofilm-forming strains) on CRA. In 22 of these isolates (25%) reaction was strongly positive; in 12 isolates (15%) reaction was moderately positive, and in the remaining 6 isolates, reaction was weakly positive. In the 22 isolates that had strong positive reaction and produced black colonies on biofilm, all virulent genes (icaC, icaD, icaA icaB, icaR) were expressed. In the 12 isolates that had moderate positive reaction, 8 expressed all genes (icaC, icaD, icaA icaB, icaR) expressed while the remaining 4 expressed only ica A, and ica D genes. Of the 6 isolated which had weak positive reaction, only 1 isolate (2.5%) expressed all the genes, in the other 5 isolates no gene was observed. Urinary isolates more frequently form biofilms than the isolates from other clinical samples. Statistical analysis using Chi square test showed that there was a significant correlation between the type of sample and the biofilm production (P < 0.05). The results of biofilm production on CRA were largely in agreement with microtiter plate assay and PCR assay. The capacity of bacteria to produce biofilm is an important factor in infectivity and happens via expression of ica genes. Recognition of bacteria that produce biofilm is thus important to control infection due to these bacteria.
Keywords: Staphylococcus epidermidis, Clinical isolates, Biofilm, Virulence genes, Microtiter assay plate
Introduction
Staphylococci are Gram positive non-motile, non-spore forming, facultative anaerobes, occurring as cocci in clusters, and are classified in two main groups, coagulase-positive and coagulase-negative (Oto 2009; Asadollahi Dehkordi et al. 2015). Coagulase negative staphylococci (CNS) are normal inhabitants of human skin and mucosa. Though frequently isolated from clinical specimens; they are often considered as non-pathogens (Oto 2009). However, CNS are being increasingly recognized in causing nosocomial and community infections. There are 40 recognized species of CNS (Rogers et al. 2009). In contrast to Staphylococcus aureus, virulence properties associated with Staphylococcus epidermidis are few and biofilm formation on the surface of materials is the most important virulence factor as demonstrated by animal model of animal infection (Fev and Olson 2010). Production of poly-N-acetylglucosamine (PNAG) is crucial for S. epidermidis biofilm formation and is synthesized by the gene products of the ica ADBC gene cluster. Biofilm formation protects these bacteria against the antibacterial drugs and the immune system defenses (Fev and Olson 2010). Currently S. epidermidis is the predominant cause of nosocomial infections because of its potential ability in biofilm formation and colonization in different surfaces (Uckay et al. 2009; Fev and Olson 2010). Staphylococcusepidermidis has emerged as a major nosocomial pathogen associated with infections of implanted medical devices. In the past few decades, the clinical importance, and the emergence of methicillin-resistant S. epidermidis strains have created many challenges in the treatment process (Namvar et al. 2014). Several studies have been performed on detecting virulent genes in isolates of Staphylococcus aureus and S. epidermidis (Gad et al. 2009; Kumar et al. 2009; Bien et al. 2011; Gomes et al. 2011). An extracellular polysaccharide adhesin represents a key virulence determinant in S. epidermidis and is required for biofilm formation. Production of this adhesin is encoded by the ica operon (De Silva et al. 2002). A recent study from Canada concerned virulence gene expression by S. epidermidis biofilm cells exposed to antibiotics (Gomes et al. 2011). The present investigation aims at detecting virulent genes in clinical isolates of S. epidermidis recovered from patients in Iran.
Materials and methods
Sample
Eighty isolates of S.epidermidis that had been referred to the medical laboratory of Kashani Hospital, Imam Ali Hospital and Hajar Hospital in Shahrekord, Iran, including 42 from urine (52.5%) from cases of urinary tract infection, 23 from blood (28.75%) from patients of septicemia, and 15 from dialysis bags (18.75%) from kidney failure patients undergoing peritoneal dialysis. Biofilm production studied by phenotypic characterization, and microtiter plate assay. Virulence genre for biofilm formation were investigated by PCR.
Phenotypic characterization
The method employed was that described by Freeman et al. (1989). The Congo red agar medium comprised BHI (37 g/L), sucrose (50 g/L), No. 1 agar (10 g/L) and Congo Red stain (0.8 g/L). Plates of the medium were inoculated and incubated in aerobic environment for 24 h at 37°C. Under such condition, biofilm producers form black crusty colonies on CRA, whereas non-producers form red colonies.
Microtiter Plate Assay for detection of biofilm
Biofilm production was detected using microtiter plate assay, following the procedure described by O’ Toole (O’ Toole 2011). The isolates of S. epidermidis were inoculated in 10 mL of tryptic soy broth with 0.25% glucose and incubated overnight with shaking at 37°C. Next, the cultures were diluted 1:100, and 200 µL of the diluted cultures, per well, were inoculated into 96-well polystyrene microtiter plates. After 48 h incubation at 37°C under aerobic conditions, the plates were washed three times with 300 µL distilled water. Subsequently, the plates were stained with 200 µL of 1% crystal violet, per well, for 10 min. Excess crystal violet was removed by gently washing the plate twice with distilled water. Finally, a volume of 250 µL of 95% ethanol solution, per well, was added to the plate and the optical density was measured at 570 nm. The absorbance of destaining solution was measured at 570 nm in an Elisa reader (Stat fax-2100). A well with sterile TSB or LB served as controls, whereby their ODs were subtracted from that of the experimental strains. The mean OD 570 nm value was determined using four replicates, and was considered to be adherence positive at OD 570 nm greater than or equal to 0.300 high biofilm formation, between 0.200 and 0.299, and adherence negative at OD 570 nm less than 0.100.
Investigation of virulence genes
The virulence genes in S. aureus were investigated by PCR. The primer sequence used, the annealing temperature and the PCR program employed are given in Table 1. Purification of DNA was achieved using a Genomic DNA purification kit (Fermentas, GmbH, St. Leon-Rot, Germany) according to the manufacturer’s instruction. The total DNA was measured at 260 nm optical density according to the method described by Sambrook and Russell (2001). The PCR reactions were performed using Accupower PCR PreMix kit (BioNEER), following essentially the procedure described by Arciola et al. (2005). The PCR mix contained 20 μL of PCR PreMix. Accupower PCR PreMix component of 1U Taq DNA Polymerase, 250 Μm Each dNTP (dATP, dCTP, dGTP, dTTp), 10 mM Tris–HCl (pH = 9), 30 mM KCl and 1.5 mM MgCl2. In each reaction add 5–50 ng Templet DNA and 5–10 pmol primer. The PCR reaction for detection of 16srRNA, icaA, ica B, ica R and Ica C, D genes were performed using 10 pmol of each primer and 50 ng DNA of reaction mix. The PCR was performed using a DNA thermal cycler (Master Cycler Gradiant, Eppendrof, Germany). The amplicons were stained with ethidium bromide and electrophoresed in 1.5% agarose gel at 80 V for 30 min. PCR products were visualized and photographed using UVIdoc gel documentation systems (Uvitec, UK). The PCR products were compared against a 100 bp DNA marker (Fermentas, Germany). Staphylococcus epidermidis PTCC 1435 was used as a positive control.
Table 1.
Primers used genes in Staphylococcus epidermidis
| Gene | Primer Sequence (5′–3′) | Annealing temperature | Size of product (bp) |
|---|---|---|---|
| 16s rRNA | F: CCTATAAGACTGGGATAACTTCGGG R: CTTTGAGTTTCAACCTTGCGGTCG |
58 | 791 |
| Ica A | F: ACAGTCGCTACGAAAAGAAA R: GGAAATGCCATAATGACAAC |
56 | 103 |
| ica B | F: CTGATCAAGAATTTAAATCACAAA R: AAAGTCCCATAAGCCTGTTT |
56 | 302 |
| Ica C | F: TAACTTTAGGCGCATATGTTTT R: TTCCAGTTAGGCTGGTATTG |
56 | 400 |
| ica D | Ica D F: ATGGTCAAGCCCAGACAGAG Ica D R: CGTGTTTTCAACATTTAATGCAA |
56 | 198 |
| ica R | F: TAATCCCGAATTTTTGTGAA R: AACGCAATAACCTTATTTTCC |
56 | 469 |
Statistical analysis
The data on production of biofilms by the strains of S. epidermidis was analyzed by the statistical software SPSS® version 19.0 (SPSS Inc., USA). P values were calculated using the Chi square test. P < 0.05 was considered to be statistically significant.
Results
Out of 80 isolates of S. epidermidis examined, 40 (50%) produced biofilms as evidenced by formation of black colonies on CRA plates (Fig. 1). The biofilm production was strong in 22 (55%) isolates, moderate in 12 (30%) and weak in 6 (15%) isolates as judged by the intensity of black colonies. The distribution of biofilm production according to the source of isolates of isolates is shown in Table 2. The positive reaction indicating biofilm formation in microtiter plate assay is shown in Fig. 2. The results of the ELISA readings on 80 isolates of S. epidermidis for biofilms production is shown in Table 3. The results of microtiter plate assay for biofilm production in the isolates were largely in agreement with that on CRA plates. In PCR assay all the 22 isolates produced strong reaction on CRA and in microtiter plate assay, and in 12 isolates that exhibited moderate reaction on CRA and in microtiter plate assay all the genes (icaC, icaD, icaA icaB, icaR). Of the 12 isolates that had moderate positive reaction on CBA and in microtiter plate assay, 8 expressed all these genes, while 4 expressed only ica A, and ica D genes, Of the 6 isolates which had weak positive reactions, only 1 isolate (2.5%) exhibited the genes while in the remaining 5 isolates no gene was observed. The detection of different genes by PCR is shown in Figs. 3, 4 and 5. Statistical analysis using Chi square test showed that a significantly higher percentage of urinary isolates formed biofilms than the isolates from other clinical samples (P < 0.05).
Fig. 1.

Right black colonies in a strong biofilm-producing Staphylococcus epidermidis isolate in the Congo red agar (CRA) medium. Left red colonies of Staphylococcus epidermidis isolate with no biofilm.
Table 2.
Distribution of 40 biofilm forming strains of Staphylococcus epidermidis according to clinical samples
| Clinical sample | No. of strains according to degree of biofilm formation | P value | |||||
|---|---|---|---|---|---|---|---|
| High | Moderate | Weak | |||||
| No | % | No | % | No | % | ||
| Urine | 16 | 40 | 8 | 20 | 5 | 12.5 | <0.05 |
| Blood culture | 2 | 5 | 1 | 2.5 | 0 | 0 | <0.05 |
| Dialysis catheter | 4 | 10 | 3 | 7.5 | 1 | 2.5 | <0.05 |
| Total | 22 | 55 | 12 | 30 | 6 | 15 | <0.05 |
Fig. 2.

Reaction of biofilm formation in microtiter plate assay by a clinical isolate 4 of Staphylococcus epidermidis.
Table 3.
The results of the ELISA readings on 80 isolates of Staphylococcus epidermidis for biofilms production
| Number of samples | Result | Number of samples | Result | Number of samples | Result | Number of samples | Result |
|---|---|---|---|---|---|---|---|
| 1 | 0.001 | 21 | 0.007 | 41 | 0.125 | 61 | 0.311 |
| 2 | 0.254 | 22 | 0.004 | 42 | 0.893 | 62 | 0.050 |
| 3 | 0.028 | 23 | 0.192 | 43 | 0.054 | 62 | 1.314 |
| 4 | 0.001 | 24 | 0.183 | 44 | 0.463 | 64 | 0.043 |
| 5 | 0.405 | 25 | 0.279 | 45 | 0.054 | 65 | 0.063 |
| 6 | 0.208 | 26 | 0.045 | 46 | 0.073 | 66 | 1.000 |
| 7 | 0.005 | 27 | 0.006 | 47 | 0.154 | 67 | 0.006 |
| 9 | 0.019 | 29 | 0.221 | 49 | 0.090 | 69 | 0.307 |
| 10 | 0.069 | 30 | 0.004 | 50 | 0.051 | 70 | 0.012 |
| 11 | 0.065 | 31 | 0.251 | 51 | 0.313 | 71 | 0.025 |
| 12 | 0.079 | 32 | 0.081 | 52 | 0.096 | 72 | 0.411 |
| 13 | 0.355 | 33 | 0.225 | 53 | 0.073 | 73 | 0.317 |
| 14 | 0.314 | 34 | 0.141 | 54 | 0.030 | 74 | 0.011 |
| 15 | 0.410 | 35 | 0.069 | 55 | 0.241 | 75 | 0.010 |
| 16 | 0.403 | 36 | 0.081 | 56 | 0.157 | 76 | 0.052 |
| 17 | 0.301 | 37 | 0.070 | 57 | 0.023 | 77 | 0.310 |
| 18 | 0.062 | 38 | 0.088 | 58 | 0.367 | 78 | 0.228 |
| 19 | 0.356 | 39 | 0.283 | 59 | 1.107 | 79 | 0.309 |
| 20 | 0.225 | 40 | 0.209 | 60 | 0.040 | 80 | 0.229 |
Fig. 3.

PCR Assay for Identification of 16S rRNA Staphylococcus epidermidis. Number 1 DNA size ladder 100 bp (Fermentas), number 2 negative control; number 3 positive control (Staphylococcus epidermidis PTCC 1435); number 4 positive samples.
Fig. 4.

PCR Assay for Identification of icaR, icaB, icaA genes of S. epidermidis. Number 1 positive samples; number 2 negative control; number 3 DNA size ladder 100 bp (Fermentas).
Fig. 5.

PCR Assay for Identification of icaD, icaC genes of S. epidermidis. Number 1 DNA size ladder 100 bp (Fermentas); number 2 negative control; number 3 positive samples; number 4 positive control (Staphylococcus epidermidis PTCC 1435).
Discussion
The capacity of S. epidermidis to produce biofilm is an important factor in infectivity and happens via expression of ica genes. The present study is the first of its kind from the Gulf region dealing with biofilm forming genes expression in clinical isolates of S. epidermidis from Iran. An earlier study from Canada concerned virulence gene expression by biofilm producing strains of S. epidermidis exposed to antibiotics (Gomes et al. 2011). From the results of our study it is evident that the genes responsible for biofilm production are present to a varying degree in the clinical isolates. As can be seen in Table 1, there was a significant relationship between the type of sample and the biofilm production, as tested by Chi square test (P < 0.05). The reactions of biofilm production on Congo red agar, and in microtiter plate assay and PCR assay were largely in agreement, though no statistical analysis was done.
In a previous study, S. epidermidis isolates recovered from catheter segments showed a higher extent of biofilm production than that isolated from urine samples (Gad et al. 2009). In our study, urinary isolates demonstrated a much higher percentage of high biofilm production than that from dialysis catheter (Table 2). However, the overall percentage of biofilm producing strains is much lower in our study than that in the one from Egypt (Gad et al. 2009). Among ica genes, icaA and icaD have been reported to play a significant role in biofilm formation in S. aureus and S. epidermidis (De Silva et al. 2002). It is significant to note that both these genes were demonstrated in our biofilm producing strains of S. epidermidis. Further research is needed to contribute to the development of biomaterials and physical electrical barriers to impede bacterial colonization, and also novel strategies for therapeutic intervention.
Authors’ contributions
All authors had participated equally. All authors read and approved the final manuscript.
Acknowledgements
This research was supported by Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
Compliance with ethical guidelines
Competing interests The authors declared that they have no competing interests.
Abbreviations
- CRA
Congo red agar
- CNS
coagulase negative staphylococci
- PNAG
production of poly-N-acetylglucosamine
- S. epidermidis
Staphylococcus epidermidis
- PCR
polymerase chain reaction
Contributor Information
Seyed Mostafa Solati, Email: Mostafasolati46@gmail.com.
Elahe Tajbakhsh, Email: ee_tajbakhsh@yahoo.com.
Faham Khamesipour, Email: Dr_Faham@yahoo.com.
Harish C Gugnani, Email: harish.gugnani@gmail.com.
References
- Arciola CR, Gamberini S, Campoccia D, Visai L, Speziale P, Baldassarri L, et al. A multiplex PCR method for the detection of all five individual genes of ica locus in Staphylococcus epidermidis. A survey on 400 clinical isolates from prosthesis-associated infections. J Biomed Mater Res A. 2005;75:408–413. doi: 10.1002/jbm.a.30445. [DOI] [PubMed] [Google Scholar]
- Asadollahi Dehkordi A, Tajbakhsh E, Tajbakhsh F, Khamesipour F, Momeni Shahraki M, Momeni H. Molecular typing of staphylococcus aureus strains from Iranian raw milk and dairy products by coagulase gene polymorphisms. Adv Stud Biol. 2015;7:169–177. [Google Scholar]
- Bien J, Sokolova O, Boxko P (2011) Characterization of virulence factors of Staphylococcus aureus: novel function of known virulence factors that are implicated in activation of airway epithelial proinflammatory response. J Pathogens Article ID 601905: p 13 [DOI] [PMC free article] [PubMed]
- Fev PD, Olson ME. Current concepts in biofilm formation of Staphylococcus epidermidis. Future Microbiol. 2010;5:917–933. doi: 10.2217/fmb.10.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Freeman DJ, Falkiner FR, Keane CT. New method for detecting slime production by coagulase negative staphylococci. J Clin Pathol. 1989;42:872–874. doi: 10.1136/jcp.42.8.872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gad GFM, El-Feky MA, El-Rehewy MS, Amin M, Hassan I, Abolella H, et al. Detection of icaA, icaD genes and biofilm production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. J Infect Dev Ctries. 2009;3:342–351. doi: 10.3855/jidc.241. [DOI] [PubMed] [Google Scholar]
- Gomes F, Teixeira P, Cerca N, Ceri H, Oliveira R (2011) Virulence gene expression by Staphylococcus epidermidis biofilm cells exposed to antibiotics. Microb Drug Resist 17:191–196. doi:10.1089/mdr.2010.0149 [DOI] [PubMed]
- Kumar JD, Negi YK, Gaur A, Khanna D. Detection of virulence genes in Staphylococcus aureus isolated from paper currency. Int J Infect Dis. 2009;13:e450. doi: 10.1016/j.ijid.2009.02.020. [DOI] [PubMed] [Google Scholar]
- Namvar AE, Bastarahang S, Abbasi N, Ghehi GS, Farhadbakhtiarian S, Arezi P et al (2014) Clinical characteristics of Staphylococcus epidermidis: a systematic review. GMS Hyg Infect Control 9: doi:10.3205/dgkh000243.eCollection2014 [DOI] [PMC free article] [PubMed]
- O’ Toole GA. Microtiter dish biofilm formation assay. J Vis Exp. 2011;2011:2437–2438. doi: 10.3791/2437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oto M. Staphylococcus epidermidis—the “accidental” pathogen. Nat Rev Micobiol. 2009;7:555–567. doi: 10.1038/nrmicro2182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rogers KL, Fey PD, Rupp ME. Coagulase-negative staphylococcal infections. Infect Dis Clin North Am. 2009;23:73–98. doi: 10.1016/j.idc.2008.10.001. [DOI] [PubMed] [Google Scholar]
- Sambrook J, Russell DW. Molecular Cloning. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 2001. [Google Scholar]
- Silva De, Silva GDI, Kantzanou M, Justice A, Massey RC, Wilkinson AR, et al. The ica operon and biofilm production in coagulase-negative staphylococci associated with carriage and disease in a neonatal intensive care unit. J Clin Microbiol. 2002;40:382–388. doi: 10.1128/JCM.40.02.382-388.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Uckay I, Pittet D, Vaudaux P, Sax H, Lew D, Waldvogel F. Foreign body infections due to Staphylococcus epidermidis. Ann Med. 2009;41:109–119. doi: 10.1080/07853890802337045. [DOI] [PubMed] [Google Scholar]
