Skip to main content
NCBI home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2015 May 21;20(5):811–820. doi: 10.1007/s12192-015-0602-3

Cloning and characterization of calreticulin and its association with salinity stress in P. trituberculatus

Jianjian Lv 1,#, Yu Wang 1,2,#, Dening Zhang 1,2, Baoquan Gao 1, Ping Liu 1, Jian Li 1,✉
PMCID: PMC4529862  PMID: 25995067

Abstract

Calreticulin (CRT) is a highly conserved and multifunctional endoplasmic reticulum (ER) chaperone protein and plays important roles in salinity stress response. Portunus trituberculatus is a commercially important fishery species, and water salinity conditions influence its commercial farming significantly. In order to research the function of calreticulin under salinity stress, the full-length cDNA sequence of calreticulin from P. trituberculatus (PtCRT) was firstly cloned and characterized. The complete cDNA sequence of PtCRT is 1676 bp with 1218 bp open reading frame (ORF), encoding a polypeptide of 405 amino acids. Multiple sequence alignments showed that the deduced acid amino sequences of PtCRT shared the highest homology to CRT of Fenneropenaeus chinensis (89 %). Fluorescent quantitative real-time PCR analysis indicated that PtCRT was expressed in all detected tissues and showed the highest expression level in hepatopancreas. In addition, salinity challenge significantly influenced the expression level of PtCRT in gill. Six single nucleotide polymorphisms (SNPs) were detected in cDNA sequence of PtCRT, and one SNP was associated with the salt tolerant trait. All results indicated that PtCRT plays an important role in mediating the salinity adaption of P. trituberculatus.

Keywords: Portunus trituberculatus, Calreticulin, Salinity, Single nucleotide polymorphism

Introduction

Calreticulin (CRT) is an endoplasmic reticulum (ER) chaperone protein (Michalak et al. 1999) comprised of three highly conserved domains: a globular N-domain, a high-affinity, low-capacity calcium-binding P-domain, and a low-affinity, high-capacity calcium-binding C-domain (Nakamura et al. 2001), which is ubiquitously expressed in all of the multicellular eukaryotes (Coppolino and Dedhar 1998). CRT have diverse functions in a wide range of organisms, including lectin-like chaperoning (Liu et al. 2011), regulation of cellular Ca2+ homeostasis (Michalak et al. 1998) and Ca2+-dependent signal pathways (Michalak et al. 2002), contribution to the immune system (Guo et al. 2002) and apoptosis, control of cell adhesion (Opas et al. 1996), modulation of nuclear-hormone receptor-mediated gene expression (Burns et al. 1994), and regulation of the process of folding proteins (Williams 2006). In crustaceans, CRT plays important roles in immune function, stress responses, and molting (Visudtiphole et al. 2010; Luana et al. 2007).

The swimming crab, Portunus trituberculatus (Crustacea: Decapoda: Brachyura), is a commercially important fishery species and is widely distributed in the coastal waters of China, Korea, Japan, and Taiwan (Dai et al. 1986). P. trituberculatus often experience substantial salinity fluctuations throughout their cultivation, which could have a significant impact on productivity (Lv et al. 2013). Due to the critical importance and implications of salinity adaption to the commercial farming of crabs, we examined the whole transcriptome challenged by different salinity stresses of the P. trituberculatus and found a significant difference in CRT expression during salinity stress compared to the controls (Lv et al. 2013). Several recent studies have showed that CRT is closely related to a number of stress responses including Ca2+ level (Williams 2006), virus infection (Luana et al. 2007; Watthanasurorot et al. 2013), heat shock (Visudtiphole et al. 2010; Conway et al. 1995), starvation (Heal and Mcgivan 1998), oxidation (Ihara et al. 2005), and heavy metal contamination (Park et al. 2001); however, few studies have focused on the function of salinity adaption in CRT.

In this study, we first report the molecular cloning, sequence analysis, and characterization of CRT from P. trituberculatus. To further understand the function of salinity adaption, the effects of salinity stress on PtCRT expression were examined by quantitative real-time PCR. In addition, the single nucleotide polymorphisms (SNPs) of PtCRT were detected and association analysis between polymorphism and salt tolerant trait was carried out. These results will be essential to understanding the role of PtCRT in salinity stress response in P. trituberculatus.

Materials and methods

Salinity challenge experiments and sample preparation

Healthy P. trituberculatus at 80 days (5.78 ± 1.11 g in body weight) were collected from Chang-yi Aqua-farming Company in Weifang, China. During the experimental period, all the samples were acclimated in aerated seawater and fed with Potamocorbula laevis twice a day in the laboratory (33 ppt, 26 °C). Gill, hepatopancreas, muscle, heart, eyestalk, and hemolymph were sampled on the 7th day for tissue-specific mRNA expression analysis. Then the crabs were randomly divided into three groups: a low salinity challenged group (LC, 11 ppt), a high salinity challenged group (HC, 45 ppt) and a non-challenged group (NC, 33 ppt). Every group (LC, HC, and NC) had 270 crabs with 3 biological replicates (each replicate having 90 individuals). For each group, gills from 3 crabs were sampled at 0, 3, 6, 12, 24, 48, and 72 h after challenge, respectively. In addition, the lower salinity challenged group (5 ppt, 300 individuals) was set to screen the individuals with different tolerances to salt. The 60 earliest death individuals were considered to be susceptible to low salinity, and the surviving individuals were regarded as low salinity tolerant. Muscles were collected and applied to DNA extraction. All these samples were stored in liquid nitrogen before being used for the experiments.

DNA, RNA extraction, and cDNA synthesis

Genomic DNA was extracted from the P. trituberculatus muscles by the classical phenol-chlorophenol method and was stored at −20 °C. The genomic DNA quality was assessed by agarose gel and the concentration was measured with a spectrophotometer. All OD260/OD280 were between 1.8 and 2.0. Total RNA was extracted from collected samples using TRIzol Reagent (Invitrogen, USA), according to the manufacturer’s protocol. The quality of RNA was detected by 1.0 % agarose gel electrophoresis and the concentration of RNA was determined spectrophotometrically. All OD260/OD280 were between 1.8 and 2.0. The RACE cDNA template was synthesized using 1-ug pooled RNA (gill, hepatopancreas, and muscle) and SMARTTM RACE Amplification Kit (Clontech, USA). The fluorescent quantitative real-time RT-PCR cDNA template was synthesized using a PrimeScript RT reagent kit (TaKaRa, USA). The reaction followed the conditions recommended by the manufacturer.

Cloning the full-length cDNA of PtCRT

PCR specific primers CRT-F, CRT-R, and CRT-F′ (Table 1) were designed based on the sequence from our transcriptome data. To obtain the 3′ unknown region, two primer-pairs, specific primer CRT-F, and universal primer UPM (Table 1), specific primer CRT-F′, and nested universal primer (NUP) (Table 1), were used for the primary PCR and the nested PCR respectively using Advantage 2 PCR Kit (Clontech, USA). Similarly, the primer-pairs, specific primer CRT-R, and universal primer UPM were used to amplify the 5′ unknown region. The PCR reactions were performed as follows: 30 cycles of 94 °C for 30 s, 68 °C for 30 s and 72 °C for 3 min.. The amplified PCR products were reclaimed by Agarose Gel Extraction kit (sangon, China). The recycled products were ligated into a PMD18-T easy vector (TaKaRa, USA). Competent Escherichia coli DH5α cells were transformed and plated on LB-agar containing ampicillin (100 μg/ml) for selection. Positive colonies containing an insert of the expected sequence were screened by colony PCR. Three colonies were sequenced by a commercial biotechnology company (Sunny, China).

Table 1.

Primer used in this experiment

Primer Sequence (5′-3′)
CRT-F CTTCCAGGAGACTTTCAGTAGCG
CRT-F′ ATCGTGAAGCCCGACAACACGTATG
CRT-R CCTCATAGGTGTTGTCGGGC
UPM CTAATACGACTCACTATAGGGC
NUP AAGCAGTGGTATCAACGCAGAGT
Q-CRT-F GCCCTTCACAAACAAAGACAA
Q-CRT-R TCAAGTATCCACCACCACAGTC
RpL8-F GCGTACCACAAGTATCGCGT
RpL8-R AGACCGACCTTCCTACCAGC
C-CRT-F GTGTACTTCCAGGAGACTTTCAG
C-CRT-R GGTCTATTGGCATTTACACTCCTA
Open in a new tab

Sequence analysis

The cDNA nucleotide and deduced amino acid sequences of PtCRT were analyzed using DNAstar (http://web.expasy.org/protparam/). The signal peptide was predicted by SignalP 4.1 Server software (http://www.cbs.dtu.dk/services/). The amino acid sequences of different species were obtained using BLAST program (Altschul et al. 1997) from the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/), and a multiple sequence alignment was carried out by ClustalW (Thompson et al. 1997) multiple alignment program. A phylogenetic tree was constructed by the MEGA 4.0 program (Tamura et al. 2007) using the neighbor-joining (NJ) algorithm, and the reliability was tested using bootstrap resampling (1000 pseudo-replicates).

Quantitative real-time RT-PCR analysis

The RpL8 gene was selected as an internal control for qPCR analysis and the primers referenced the study by Xu and Liu (Xu and Liu 2011). The standard curve testing was performed using a series of diluted samples (tenfold serial dilutions: 1 ×, 10 ×,100 ×, 1000 ×, and 10,000 ×), respectively, for each primer. The slopes of the standard curves were calculated. According to the formula E = 10^ (−1/slope), the values of PCR efficiency for all the genes were calculated. In all cases, PCR efficiencies were >90 %. First strand cDNA was synthesized from 1 mg of RNA using M-MuLV reverse transcriptase (Qiagen). The qPCR reaction mixture (20 uL) consisted of 2× Power SYBR Green PCR Master mix, 0.9 uM each of the forward and reverse primers, and 1 uL of template cDNA. PCR amplification was performed under the following conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s and 60 °C for 34 s, and a final dissociation curve analysis 1 cycle of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s. The internal reference gene and target gene PtCRT both set three biological replicates. The relative expression ratio of the target gene in the treated groups (3, 6, 12, 24, 48, and 72 h after salinity challenge) versus that in controls (0 h, no salinity challenge) was calculated using the 2-△△CT method by ABI 7500 Fast Real-Time PCR Systems (Version 2.0.6). The results were subjected to one-way analysis of variance (ANOVA) followed by an unpaired, two-tailed t test. P < 0.05 was considered statistically significant.

Single nucleotide polymorphism loci detection and genotyping

The PCR products amplified by primers C-CRT-F and C-CRT-R from 60 low salinity-susceptible and 60 tolerant individuals were purified and sequenced with the automated sequencer ABI 3730 (Applied Bio-system). The SNPs were detected by sequence alignments of different individuals with Vector NTI Suite 11.0 (Invitrogen). The distributions of each SNP site allele frequencies were calculated by SPSS 17.0 and compared by the Pearson chi-square test or Fisher exact test for the significance tests to confirm their association with the susceptibility/tolerance to salinity challenge. Results were considered statistically significant when P < 0.05.

Results

PtCRT cDNA sequence

The full-length PtCRT cDNA was 1676 bp with a 1218 bp open reading frame (ORF), encoding 405 amino acids (aa) (Fig. 1) (GenBank accession number: KF548042). The cDNA contained a 5′ un-translated region (UTR) of 73 bp and a 3′-UTR of 385 bp, including a putative polyadenylation consensus signal (AATAAA) and a poly A tail. The deduced protein had a calculated molecular weight of 46.74 kDa and isoelectric point of 4.33. The total number of negatively charged residues (Asp+Glu) and positively charged residues (Arg+Lys) was 107 and 50, respectively. The instability index and grand average of hydropathicity (GRAVY) were computed to be 35.95 and −1.055, which indicated the PtCRT protein was a hydrophilic stable protein.

Fig. 1.

Fig. 1

Open in a new tab

Nucleotide and deduced amino acid sequence of PtCRT cDNA. The italic letters indicate the start condon and an asterisk indicates the stop codon. The predicted signal peptide is marked with dashed lines. The two CRT family signatures are boxed. The six SNPs are boxed in red color. The underlined letters show the three repeats (position 206–218, 223–235, and 240–252) motifs. The double-underlined letters represent the endoplasmic reticulum targeting tetrapeptide HDEL. The shaded letters (AATAAA) indicate the polyadenylation consensus signal

Sequence analysis showed that PtCRT contains a signal peptide, two conserved CRT family signature motifs: KHEQNIDCGGGYLKVF (96–111 aa) and LMFGPDICG (128–136 aa), and three CRT family repeat motifs: IKDPDASKPDDWD (206–218 aa), IPDPDDTKPEDWD (223–235 aa) and IPDPDATKPEDWD (240–252 aa). In addition, the C-terminal has the putative endoplasmic reticulum targeting tetrapeptide HDEL (His-Asp-Glu-Leu, 402–405 aa).

Multiple sequences and phylogenetic analysis

Amino acid sequences of CRT from different species were collected through the NCBI database. Multiple sequence alignments results showed that CRT had conserved CRT family signatures containing three repeats motifs and HDEL sequence. The deduced amino acid sequence of PtCRT showed 89, 88, 75, 72, 72, and 72 % homologous to CRT of Fenneropenaeus chinensis, Penaeus monodon, Pinctada fucata, Homo sapiens, Cavia porcellus, and Oryctolagus cuniculus, respectively (Fig. 2). The neighbor-joining phylogenetic tree of CRT showed that all cluster species are classified to two major groups including the vertebrate group and the invertebrate group, and PtCRT was classified into invertebrate group (Fig. 3). The results here were in accordance with biological classification.

Fig. 2.

Fig. 2

Open in a new tab

The multiple amino acid sequences alignment of PtCRT with other species CRT. The two CRT family signatures are indicated with underlining. The three repeats (position 206–218, 223–235, and 240–252) motifs are boxed. The endoplasmic reticulum targeting tetrapeptide H(K)DEL is indicated with double-underlining. The amino acid sequence data were acquired from the GenBank database with the following accession numbers: F. chinensis (ABC50166), P. monodon (ADO00927), P. fucata (ABR68546), H. sapiens (BAD96780), C. porcellus (XP_003468401), and O. cuniculus (NP_001075704)

Fig. 3.

Fig. 3

Open in a new tab

Phylogenetic tree of CRT amino acid sequences from different species. The sequences were aligned using Clustal W, which was then employed to construct a phylogenetic tree by MEGA 4.0 using neighbor-joining method. The value at the forks indicate the percentage of trees in which this grouping occurred after bootstrapping the data (1000 replicates). The scale bar indicates 0.05 nucleotide substitution per site. The species and GenBank accession numbers of CRT used for phylogenetic analysis were: F. chinensis (ABC50166), Pacifastacus leniusculus (AEC50079), P. monodon (ADO00927), L. vannamei (AFC34501), Culex quinquefasciatus (XP_001848824), Plutella xylostella (ADN06079), Galleria mellonella (BAB79277), Danaus plexippus (EHJ72848), Megachile rotundata (XP_003701110), Drosophila sechellia (XP_002031864), Amblyomma americanum (AAR29932), Gallus gallus (AAS49610), O. cuniculus (NP_001075704), Anolis carolinensis (XP_003216823), Paralichthys olivaceus (ABG00263), H. sapiens (BAD96780), Maylandia zebra (XP_004555132), Oreochromis niloticus (XP_003448535), P. fucata (ABR68546), Lates calcarifer (ADQ92842), Ictalurus punctatus (NP_001187111), and C. porcellus (XP_003468401)

Expression profiles of PtCRT

The fluorescent quantitative real-time RT-PCR result showed that PtCRT gene was expressed in all the tested tissue and was mainly expressed in the hepatopancreas, followed by relatively high expression levels in gill and eyestalk. Lower expression levels were observed in muscle and heart, and a weak expression level in hemocytes (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Expression pattern of PtCRT in various tissues. Different letters indicate significant differences (P < 0.05)

Expression profiles of PtCRT in gill and hepatopancreas were detected during salinity challenges. Under high salinity challenge, the expression level of PtCRT in gill rose dramatically to 1.94-fold at 3 h and then remained almost the same at 6 h. Subsequently, the expression level from 12 to 72 h declined but was still significantly higher than that of the control group (P < 0.05) (Fig. 5). Under low salinity challenge, the expression level of PtCRT in gill showed no significant difference (P < 0.05) from 0 to 12 h and then gradually increased to 2.2-fold at 72 h (Fig. 6). In hepatopancreas, the expression of PtCRT was suppressed significantly at all time points after salinity challenges, the lowest down-regulations were 0.057 and 0.074 fold at 6 h and 72 h after low and high salinity challenges, respectively (Figs. 7 and 8).

Fig. 5.

Fig. 5

Open in a new tab

Expression pattern of PtCRT during high salinity stress in gill. Different letters indicate significant differences (P < 0.05)

Fig. 6.

Fig. 6

Open in a new tab

Expression pattern of PtCRT during low salinity stress in gill. Different letters indicate significant differences (P < 0.05)

Fig. 7.

Fig. 7

Open in a new tab

Expression pattern of PtCRT during high salinity stress in hepatopancreas. Different letters indicate significant differences (P < 0.05)

Fig. 8.

Fig. 8

Open in a new tab

Expression pattern of PtCRT during low salinity stress in hepatopancreas. Different letters indicate significant differences (P < 0.05)

SNP detection and association analysis

Six SNP loci (310 C/T, 355 A/T, 991 C/T, 1009 G/A, 1061 G/A, 1186 C/T) were discovered, and all of them were located in the open reading frame (Fig. 1). Among these, five SNPs belonged to a synonymous mutation and one SNP belonged to a non-synonymous mutation. The association analysis result showed that SNP 1269 G/A was significantly associated with a low salinity tolerance trait (P < 0.05) (Table 2).

Table 2.

SNP distributions of PtCRT

Locus Located Genotype Synonymous (Y/N) Susceptible N(%) Tolerant N(%) X 2(P)
310 C/T ORF CT Y 17(0.20) 15(0.17) 0.714(0.700)
CC 22(0.25) 25(0.29)
TT 3(0.03) 5(0.06)
355 A/T ORF AT Y 32(0.40) 27(0.34) 2.696(0.260)
AA 5(0.06) 5(0.06)
TT 3(0.04) 8(0.10)
991 C/T ORF CT Y 3(0.04) 0(0.00) 2.759(0.097)
CC 41(0.49) 39(0.47)
1009 G/A ORF AG Y 19(0.22) 16(0.18) 2.326(0.313)
GG 24(0.28) 26(0.30)
AA 0(0) 2(0.23)
1061 G/A ORF GG N 23(0.28) 14(0.17) 3.632(0.020)
AG 18(0.22) 26(0.32)
1186 C/T ORF TC Y 18(0.21) 15(0.17) 2.404(0.301)
CC 24(0.28) 27(0.31)
TT 0(0) 2(0.02)
Open in a new tab

The SNP distributions between low salinity-susceptible and tolerant groups were significantly different (P < 0.05)

Y synonymous mutation, N non-synonymous mutation, N(%) percentage of each genotype of susceptible or tolerant individual share in the total number of individuals, X 2 (P) chi-square value

Discussion

Calreticulin (CRT) is a highly conserved protein with multiple functions and is implicated in a variety of physiological/pathological processes. In crustaceans, CRT has been cloned from F. chinensis (Luana et al. 2007), P. monodon (Visudtiphole et al. 2010), Litopenaeus vannamei (GenBank accession number: AFC34501), and Exopalaemon carinicauda (Duan et al. 2014). In most reported cases, CRT was related to the functions of stress responses (temperature, air exposure) and immune defenses (virus and bacteria); however, no research focused on its function in salinity adaptation until now. Our previous study results found that the expression pattern of calreticulin changed significantly in salinity stress. To verify its function in salinity adaptation, we cloned the whole length cDNA of calreticulin from P. trituberculatus for the first time and studied the expression pattern in different salinity stresses, while also exploring SNP and carrying out association analysis with salt tolerant trait.

In the present study, the full-length cDNA of CRT encoding 405 amino acids was cloned, including the typical signature motifs of the CRT family and three typical conserved N-, P-, and C-domains. Multiple sequence alignments revealed that the deduced amino acid sequence of PtCRT shared high homology with F. chinensis and P. monodon (89 and 88 %). The results indicated that CRT has highly conserved sequences in crustaceans.

Quantitative real-time RT-PCR data revealed that PtCRT was expressed in all the tested tissues, including gill, hepatopancreas, muscle, heart, eyestalk, and hemocytes, suggesting its multifunction in several biological processes based on different tissues. Hepatopancreas was regarded as the metabolic center for reactive oxygen species (ROS) production and the major site for the synthesis of immune defense molecules involved in eliminating pathogens or other particulate matter in crustaceans (Bianchini and Monserrat 2007; Duan et al. 2014), and PtCRT was mainly expressed in hepatopancreas suggesting that one of its main functions involves stress and immune response mechanisms. Many studies in crustaceans have proven the inference (Luana et al. 2007; Visudtiphole et al. 2010; Duan et al. 2014), that the expression of CRTs was up-regulated in hepatopancreas after temperature and pathogen challenges. Interestingly, the expression of CRT was suppressed after salinity challenges in this study, which suggests that the stress and immune response functions of CRT were disturbed in salinity stress (Joseph and Philip 2007). This inference is consistent with the phenomenon of increased mortality and decreased immunity caused by salinity changes in the crustaceans (Joseph and Philip 2007; Romano and Zeng 2006; Prangnell and Fotedar 2006); however, the specific mechanism needs further verification.

Osmotic and ionic regulation in the crustacea is mostly accomplished by the multifunctional gills. In addition to their role in gas exchange, the gills are vital in many essential physiological functions such as osmoregulation, calcium homeostasis, ammonium excretion, and extracellular pH regulation (Freire et al. 2008), which are important to salinity adaption. The relatively high levels of PtCRT expression in gill and eyestalk tissues revealed that it may play an important role in osmoregulation. Previous studies showed that salinity stress could induce the expression of CRT in animals and plants (Barman et al. 2012; Shaterian et al. 2005; Shekhar et al. 2013). In this study, the expression of PtCRT up-regulated in gill during salinity challenges further verified that PtCRT plays an important role in salinity adaptation. Further analysis found that the time of PtCRT up-regulated in low salinity challenged was significantly later than the high salinity challenged (48 vs. 3 h), and the different expression profiles indicated that PtCRT may have different mechanisms in low and high salinity adaption.

Single nucleotide polymorphisms (SNPs) are highly abundant markers, which are evenly distributed throughout the genome, and due to their potential for high genotyping efficiency, automation, data quality, genome-wide coverage, and analytical simplicity, they have rapidly become the marker of choice for many applications in genetics and genomics (Garvin et al. 2010; Seeb et al. 2011). SNPs are suitable markers for fine mapping of genes and candidate gene association studies aimed at identifying alleles, which potentially affect important traits. Additionally, the SNP variants present in coding regions allow for associations with phenotypic variations specific to SNP, which makes it possible to identify particular genotypes, for genetic selection programs or perform molecular studies of adaptation (Bester-van der Merwe et al. 2011; Garvin et al. 2010). In this study, six SNP loci were identified from PtCRT and all of them were located in the open reading frame. The SNP 1269 G/A was found to be associated with a salinity tolerance/susceptibility trait by association analysis, which belonged to the non-synonymous mutation and caused the changes between glutamate and lysine. Further analysis found that this SNP locus lacked the AA genotype, and the GA genotype had higher salinity tolerance than the GG genotype. However, further studies are needed to understand why the amino acid change caused by SNP 1269 G/A were related to the trait of salinity tolerance/susceptibility, or it was only a molecular marker linkaged with another critical salinity adaptation related genes.

In summary, a full-length cDNA sequence of CRT was cloned from P. trituberculatus. We studied the tissue-specific mRNA expression and the expression patterns during high and low salinity challenge in gill and hepatopancreas. In addition, we identified the single nucleotide polymorphism and analyzed its association with low salinity tolerance and susceptibility. All results demonstrated that PtCRT plays an important role in P. trituberculatus salinity stress response, which provided useful information for functional research on CRT.

Acknowledgments

This research was supported by the National High Technology Research and Development Program of China (Project 2012AA10A409), the National Natural Science Foundation of China (Grant No. 41306177), China Postdoctoral Science special Foundation (2014 T70668).

Footnotes

Jianjian Lv and Yu Wang contributed equally to this work.

References

  1. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barman HK, Patra SK, Das V, Mohapatra SD, Jayasankar P, Mohapatra C, Mohanta R, Panda RP, Rath SN (2012) Identification and characterization of differentially expressed transcripts in the gills of freshwater prawn (Macrobrachium rosenbergii) under salt stress. Sci World J 2012 [DOI] [PMC free article] [PubMed]
  3. Bester-Van Der Merwe AE, Roodt-Wilding R, Volckaert FA, D’amato ME. Historical isolation and hydrodynamically constrained gene flow in declining populations of the South-African abalone, Haliotis midae. Conserv Genet. 2011;12:543–555. doi: 10.1007/s10592-010-0162-0. [DOI] [Google Scholar]
  4. Bianchini A, Monserrat JM. Effects of methyl parathion on Chasmagnathus granulatus hepatopancreas: protective role of sesamol. Ecotoxicol Environ Saf. 2007;67:100–108. doi: 10.1016/j.ecoenv.2006.03.006. [DOI] [PubMed] [Google Scholar]
  5. Burns K, Duggan B, Atkinson EA, Famulski KS, Nemer M, Bleackley RC, Michalak M (1994) Modulation of gene expression by calreticulin binding to the glucocorticoid receptor. Nature 367:476–480. doi:10.1038/367476a0 [DOI] [PubMed]
  6. Conway EM, Liu L, Nowakowski B, Steiner-Mosonyi M, Ribeiro SP, Michalak M. Heat shock-sensitive expression of calreticulin. In vitro and in vivo up-regulation. J Biol Chem. 1995;270:17011–17016. doi: 10.1074/jbc.270.28.17011. [DOI] [PubMed] [Google Scholar]
  7. Coppolino MG, Dedhar S. Calreticulin. Int J Biochem Cell Biol. 1998;30:553–558. doi: 10.1016/S1357-2725(97)00153-2. [DOI] [PubMed] [Google Scholar]
  8. Dai A, Yang S, Song Y. Marine crabs in China Sea. Beijing: Marine publishing company; 1986. [Google Scholar]
  9. Duan YF, Liu P, Li JT, Wang Y, Li J, Chen P. Molecular responses of calreticulin gene to Vibrio anguillarum and WSSV challenge in the ridgetail white prawn Exopalaemon carinicauda. Fish Shellfish Immunol. 2014;36:164–171. doi: 10.1016/j.fsi.2013.10.024. [DOI] [PubMed] [Google Scholar]
  10. Freire CA, Onken H, Mcnamara JC. A structure-function analysis of ion transport in crustacean gills and excretory organs. Comp Biochem Physiol A Mol Integr Physiol. 2008;151:272–304. doi: 10.1016/j.cbpa.2007.05.008. [DOI] [PubMed] [Google Scholar]
  11. Garvin M, Saitoh K, Gharrett A. Application of single nucleotide polymorphisms to non-model species: a technical review. Mol Ecol Resour. 2010;10:915–934. doi: 10.1111/j.1755-0998.2010.02891.x. [DOI] [PubMed] [Google Scholar]
  12. Guo L, Nakamura K, Lynch J, Opas M, Olson EN, Agellon LB, Michalak M. Cardiac-specific expression of calcineurin reverses embryonic lethality in calreticulin-deficient mouse. J Biol Chem. 2002;277:50776–50779. doi: 10.1074/jbc.M209900200. [DOI] [PubMed] [Google Scholar]
  13. Heal R, Mcgivan J. Induction of calreticulin expression in response to amino acid deprivation in Chinese hamster ovary cells. Biochem J. 1998;329:389–394. doi: 10.1042/bj3290389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ihara Y, Kageyama K, Kondo T. Overexpression of calreticulin sensitizes SERCA2a to oxidative stress. Biochem Biophys Res Commun. 2005;329:1343–1349. doi: 10.1016/j.bbrc.2005.02.112. [DOI] [PubMed] [Google Scholar]
  15. Joseph A, Philip R. Acute salinity stress alters the haemolymph metabolic profile of Penaeus monodon and reduces immunocompetence to white spot syndrome virus infection. Aquaculture. 2007;272:87–97. doi: 10.1016/j.aquaculture.2007.08.047. [DOI] [Google Scholar]
  16. Liu H, Peatman E, Wang W, Abernathy J, Liu S, Kucuktas H, Lu J, Xu D-H, Klesius P, Waldbieser G. Molecular responses of calreticulin genes to iron overload and bacterial challenge in channel catfish (Ictalurus punctatus) Dev Comp Immunol. 2011;35:267–272. doi: 10.1016/j.dci.2010.11.009. [DOI] [PubMed] [Google Scholar]
  17. Luana W, Li F, Wang B, Zhang X, Liu Y, Xiang J. Molecular characteristics and expression analysis of calreticulin in Chinese shrimp Fenneropenaeus chinensis. Comp Biochem Physiol B: Biochem Mol Biol. 2007;147:482–491. doi: 10.1016/j.cbpb.2007.03.001. [DOI] [PubMed] [Google Scholar]
  18. Lv J, Liu P, Wang Y, Gao B, Chen P, Li J. Transcriptome analysis of Portunus trituberculatus in response to salinity stress provides insights into the molecular basis of osmoregulation. PLoS ONE. 2013;8 doi: 10.1371/journal.pone.0082155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Michalak M, Mariani P, Opas M. Calreticulin, a multifunctional Ca2+ binding chaperone of the endoplasmic reticulum. Biochem Cell Biol. 1998;76:779–785. doi: 10.1139/bcb-76-5-779. [DOI] [PubMed] [Google Scholar]
  20. Michalak M, Corbett E, Mesaeli N, Nakamura K, Opas M. Calreticulin: one protein, one gene, many functions. Biochem J. 1999;344:281–292. doi: 10.1042/0264-6021:3440281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Michalak M, Parker JR, Opas M. Ca2+ signaling and calcium binding chaperones of the endoplasmic reticulum. Cell Calcium. 2002;32:269–278. doi: 10.1016/S0143416002001884. [DOI] [PubMed] [Google Scholar]
  22. Nakamura K, Zuppini A, Arnaudeau S, Lynch J, Ahsan I, Krause R, Papp S, De Smedt H, Parys JB, Müller-Esterl W. Functional specialization of calreticulin domains. J Cell Biol. 2001;154:961–972. doi: 10.1083/jcb.200102073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Opas M, Szewczenko-Pawlikowski M, Jass GK, Mesaeli N, Michalak M. Calreticulin modulates cell adhesiveness via regulation of vinculin expression. J Cell Biol. 1996;135:1913–1923. doi: 10.1083/jcb.135.6.1913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Park B-J, Lee D-G, Yu J-R, Jung S-K, Choi K, Lee J, Lee J, Kim YS, Lee JI, Kwon JY. Calreticulin, a calcium-binding molecular chaperone, is required for stress response and fertility in Caenorhabditis elegans. Mol Biol Cell. 2001;12:2835–2845. doi: 10.1091/mbc.12.9.2835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Prangnell DI, Fotedar R. The growth and survival of western king prawns, Penaeus latisulcatus Kishinouye, in potassium-fortified inland saline water. Aquaculture. 2006;259:234–242. doi: 10.1016/j.aquaculture.2006.05.023. [DOI] [Google Scholar]
  26. Romano N, Zeng C. The effects of salinity on the survival, growth and haemolymph osmolality of early juvenile blue swimmer crabs, Portunus pelagicus. Aquaculture. 2006;260:151–162. doi: 10.1016/j.aquaculture.2006.06.019. [DOI] [Google Scholar]
  27. Seeb J, Carvalho G, Hauser L, Naish K, Roberts S, Seeb L. Single-nucleotide polymorphism (SNP) discovery and applications of SNP genotyping in nonmodel organisms. Mol Ecol Resour. 2011;11:1–8. doi: 10.1111/j.1755-0998.2010.02979.x. [DOI] [PubMed] [Google Scholar]
  28. Shaterian J, Georges F, Hussain A, Waterer D, De Jong H, Tanino KK. Root to shoot communication and abscisic acid in calreticulin (CR) gene expression and salt-stress tolerance in grafted diploid potato clones. Environ Exp Bot. 2005;53:323–332. doi: 10.1016/j.envexpbot.2004.04.008. [DOI] [Google Scholar]
  29. Shekhar MS, Kiruthika J, Ponniah AG. Identification and expression analysis of differentially expressed genes from shrimp (Penaeus monodon) in response to low salinity stress. Fish Shellfish Immunol. 2013;35:1957–1968. doi: 10.1016/j.fsi.2013.09.038. [DOI] [PubMed] [Google Scholar]
  30. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  31. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Visudtiphole V, Watthanasurorot A, Klinbunga S, Menasveta P, Kirtikara K. Molecular characterization of Calreticulin: a biomarker for temperature stress responses of the giant tiger shrimp Penaeus monodon. Aquaculture. 2010;308:S100–S108. doi: 10.1016/j.aquaculture.2010.06.040. [DOI] [Google Scholar]
  33. Watthanasurorot A, Jiravanichpaisal P, Söderhäll K, Söderhäll I. A calreticulin/gC1qR complex prevents cells from dying: a conserved mechanism from arthropods to humans. J Mol Cell Biol. 2013;5:120–131. doi: 10.1093/jmcb/mjt005. [DOI] [PubMed] [Google Scholar]
  34. Williams DB. Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum. J Cell Sci. 2006;119:615–623. doi: 10.1242/jcs.02856. [DOI] [PubMed] [Google Scholar]
  35. Xu QH, Liu Y. Gene expression profiles of the swimming crab Portunus trituberculatus exposed to salinity stress. Mar Biol. 2011;158:2161–2172. doi: 10.1007/s00227-011-1721-8. [DOI] [Google Scholar]

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES