Sato, H., Mizoi, J., Tanaka, H., Maruyama, K., Qin, F., Osakabe, Y., Morimoto, K., Ohori, T., Kusakabe, K., Nagata, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2014). Arabidopsis DPB3-1, a DREB2A interactor, specifically enhances heat stress-induced gene expression by forming a heat stress-specific transcriptional complex with NF-Y subunits. Plant Cell 26: 4954–4973.
The following corrections and addendum have been made.
Corrections: In Figure 1, incorrect images were inadvertently used for images corresponding to the negative controls in Figure 1B, row 7, column 1, and row 8, column 1. These have been replaced with the correct images, and the legend for Figure 1B has been corrected as shown below.
Addendum: The amounts of DNA shown in Figure 4C (ChIP-PCR assay) were quantified by quantitative PCR (qPCR). These results are presented in an additional panel (Figure 4D) shown below.
Figure 1.
DPB3-1 Interacts with DREB2A in Yeast Cells, in Vitro and in Vivo.
(B) The growth of yeast cells harboring various truncated forms of DREB2A fused to the GAL4 DNA binding domain (BD). SD/-L-W is the nonselective medium, and SD-L-W-H-Ade (quadruple dropout [QDO]) is the selective medium. DPB3-1 was expressed as a fusion protein with the GAL4 activation domain (AD). Photographs show a 10-fold dilution series of yeast cells expressing DPB3-1 (from left to right), and concentration of cells expressing AD as controls was comparable to that of the left panels in the dilution series. a.a., amino acids.
Figure 4.
Overexpression of DPB3-1 Enhanced the Expression Levels of Heat Stress-Inducible Genes in Arabidopsis.
(D) ChIP-qPCR assays in heat-stressed GFP-DPB3-1-overexpressing plants. The relative enrichment (calculated as % input) of DNA (HsfA3, HsfA2, At1g75860, and 18S rDNA) associated with GFP-DPB3-1 compared with a negative control was determined by qPCR using an anti-GFP antibody (GFP) or IgG (negative control) for immunoprecipitation. The error bars indicate sd (n = 3). The asterisks above the bars indicate significant differences (P < 0.05 according to Student’s t test).
METHODS
qPCR
qPCR was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) and an Applied Biosystems 7500 real-time PCR system. The primers used for qPCR are listed below. Triplicate measurements were made for each DNA sample before and after ChIP assays, and the obtained amount of DNA sequences after ChIP assays was normalized according to the amount of each DNA sequence before ChIP assays.
Primers for ChIP-qPCR
The primers used for qPCR are as follows: HsfA3, forward (5′ to 3′) GAGAGCTAAGTGAAGCTGCAAGGA and reverse (5′ to 3′) TCGTCATCATGTTCCATTGATT; At1g75860, forward (5′ to 3′) CGGACCGAGCCAGTAGTCGTC and reverse (5′ to 3′) GGGGGAGAAGATAGCTAAGCGCG; HsfA2, forward (5′ to 3′) AGAGAAAAATTGTGCAGCAGGT and reverse (5′ to 3′) CGCCAGAAAAAGCCTACTAAAA; 18S rRNA, forward (5′ to 3′) AAACGGCTACCACATCCAAG and reverse (5′ to 3′) CCTCCAATGGATCCTCGTTA.
Editor’s note: the corrected figures and accompanying text were reviewed by members of The Plant Cell editorial board.