Skip to main content
PMC home page
Data in Brief logoLink to Data in Brief
. 2015 Jul 9;4:410–421. doi: 10.1016/j.dib.2015.06.021

Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae), including a reassessment of previous infrageneric classifications

Chin Cheung Tang a, Daniel C Thomas a,b, Richard MK Saunders a,⁎
PMCID: PMC4532731  PMID: 26286044

Abstract

Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae) (Tang et al., Mol. Phylogenetic Evol., 2015) [1], inferred using chloroplast DNA (cpDNA) sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers) of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated).

Specifications table

Subject area Biology, genetics and genomics
More specific subject area Phylogenetics
Type of data Primer sequences, taxon-sequence matrices, sequence alignments, phylogeny, taxon-character matrix
How data was acquired Primer sequences designed using Primer3, implemented in Geneious v.5.4.3;
Sequence data generated by PCR and novel sequencing (supplemented with data downloaded from GenBank); phylogeny generated using Bayesian inference methods
Taxon-character matrix generated following an extensive literature review
Data format Raw, filtered and analyzed
Experimental factors n/a
Experimental features Sequencing of chloroplast DNA and recording of associated morphological characters
Data source location n/a
Data accessibility With this article
Open in a new tab

Value of the data

  • •

    Data provides a summary of taxa and chloroplast DNA (cpDNA) regions and aligned data matrices that can be used for the phylogenetic reconstruction of Goniothalamus (Annonaceae tribe Annoneae) [1].

  • •

    Data provides a summary of morphological characters relevant to species in the tribe Annoneae that are important for broader morphological evolutionary studies.

  • •

    Comparisons between the resultant phylogeny for Goniothalamus species with previous infrageneric classifications [2,3] enable an assessment of congruence between the phylogeny and the infrageneric classifications.

1. Data, experimental design, materials and methods

1.1. Primer design and summary

Available sequences of nine chloroplast DNA (cpDNA) regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1 were downloaded from GenBank (https://www.ncbi.nlm.nih.gov/genbank/) for species of Goniothalamus and related species from Annonaceae tribe Annoneae. Alignment of each region was performed using MAFFT v.7.029b [4] with default settings and the automatic algorithm option. Each alignment was opened in Geneious v.5.4.3 [5] and “Design New Primer” analysis performed with the “Target Region” set as 300–400 bp and other settings kept as default using Primer3 [6,7]. The summary of primer sequences obtained from the analysis and from previous studies [8–18] are listed in Table 1.

Table 1.

List of primers used for amplification and sequencing of nine DNA regions.

Region Primer Sequence (5′–3′) Source
atpB-rbcL atpB-rbcL-2 CCAACACTTGCTTTAGTCTCTG [14]
atpB-rbcL-c1b TGGATGAATTMTGGCCATTTTCACA [1]; this study
atpB-rbcL-c2a TGGCGCAACCCAATCTTGTT [1]; this study
atpB-rbcL-c2b AGTCGCGAGGAGGTTTTTCA [1]; this study
atpB-rbcL-c3a GGATGCTGAAATAAAGAACAACAGCCA [1]; this study
atpB-rbcL-c3b ACGTCCAATAGCARGTTAATCGGT [1]; this study
atpB-rbcL-c4a TGGTGCCAACGAAATCAACCGCW [1]; this study
atpB-rbcL-3 AGTGTGGAAACCCCAGGATCAGAAG [10]
matK matK-1a TAATACCTCACCCCGTCCATCTGG Designed by Y.C.F. Su
matK-c1b TGTGTTCGCTCGAGAACAGTTCCA [1]; this study
matK-c2a CCGTTTGTTCAAAAGAGAATCGGA [1]; this study
matK-11b RATCCTGTCCGGTTGAGACCACAA Designed by Y.C.F. Su
matK-449F AGAAATGGAAATCTTACCTTGTCC [17]
matK-824R ATCCGCCCAAATYGATTGATAATA [17]
ndhF ndhF-1F ATGGAACAKACATATSAATATGC [9]
ndhF-c1bR CCTAAGATTCCTAATAATAAACCA [1]; this study
ndhF-c2aF TGGGAACTAGTGGGAATGTGCTCGT [1]; this study
ndhF-689R GGCATCRGGYAACCATACATGAAG [16]
ndhF-c1bF TGGTTTATTATTAGGAATCTTAGG [1]; this study
ndhF-c3bR GCAGCTCGATAAGAACCTATACCTRG [1]; this study
ndhF-972F GTCTCAATTGGGTTATATGATG [9]
ndhF-c4bR AYCCTRCCGCRGAAYAAGCT [1]; this study
ndhF-c5aF TGTGGTATTCCGCCCCTTGCT [1]; this study
ndhF-c5bR TGTCYGACTCATGGGGRTATGYRG [1]; this study
ndhF-LBCF TCAATAYCTATATGGGGGAAAG [16]
ndhF-c6bR ATTGGTGGGGTTAAYARTTTYGAY [1]; this study
ndhF-c5bF CYRCATAYCCCCATGAGTCRGACA [1]; this study
ndhF-2210R CCCCCTAYATATTTGATACCTTCTCC [9]
psbA-trnH psbA GTTATGCATGAACGTAATGCTC [19]
psbAtrnH-c1b TCGACCATGAACYCGYCARA [1]; this study
psbAtrnH-c2a GTTGTTGAAGGATCAGRTCAATGCCA [1]; this study
trnH(ham-GUG) CGCGCATGGTGGATTCACAATCC [13]
psbM-trnD psbM-F AGCAATAAATGCRAGAATATTTACTTCCAT [15]
psbM-c1a TTCGGGATCTAATCCCATAGAAAWACT [1]; this study
psbM-c2a TYSRATCAGGAATCYCGTGG [1]; this study
psbM-c1b TGGAYCTGTGACCGATGTAAGACCG [1]; this study
psbM-c3a CCCTCGAAAGARRKRGGGCGK [1]; this study
psbM-c2b TCCAAGGAAGGAGGATACTGACCA [1]; this study
psbM-c4a ACTCTGTCGCCGCCGAGATAAC [1]; this study
psbM-c3b AGARAGTGCCCATATGTTTTCCG [1]; this study
psbM-c5a AGGYGATACCAYCGCTCAATCC [1]; this study
psbM-c4b1 AGGAGGGACAAGARGCAGGGC [1]; this study
psbM-c4b2 TTCGAGCCCCGTCAGTCCCG [1]; this study
trnD(GUC)-R GGGATTGTAGYTCAATTGGT [15]
rbcL rbcL-7F GATTCAAAGCTGGTGTTAAAGAGT [17]
rbcL-c1b GGAATTCGCAAGTCYTCTAGGCGT [1]; this study
rbcL-c2a TCGAGCCTGTTGCTGGAGAGGA [1]; this study
rbcL-724R TCGCATGTACCTGCAGTAGC [11]
rbcL-c3a CGCCAAGAACTACGGTAGRGCG [1]; this study
rbcL-c3b TCCCGTTCCCCCTCCAGTTT [1]; this study
rbcL-4a GAGACAACGGCCTRCTTCTTCACA Designed by Y.C.F. Su
rbcL-5a ATCGCGCAATGCATGCAGTTAT Designed by Y.C.F. Su
rbcL-5b ACGTCCCTCATTCCGAGCTTGTA Designed by Y.C.F. Su
rbcL-c7a TCGGCGGAGGAACTTTAGGACA [1]; this study
rbcL-1381R TCGAATTCGAATTTGATCTCCTTC [17]
trnS-G trnS(GCU) GCCGCTTTAGTCCACTCAGC [12]
trnSG-c1b ASYGTTCAAACAAAGTTTTKATCACGA [1]; this study
trnSG-c2a TCYATTCCTAYGACAYTCACTCCTGT [1]; this study
trnSG-c2b TCGTTACTGAAGTTCCGKCTCG [1]; this study
trnSG-c3a CGGATTCTTGTACAACTCATTCTTCTG [1]; this study
trnG(UCC) GAACGAATCACACTTTTACCAC [12]
trnL-F trnLF -13F GACGCTACGGACTTGATTGGATT [17]
trnLF-c1b TGACATGTAGAACGGGACTCTCTCT [1]; this study
trnLF-c2a ACGTATACATAYCGTAGCATCAAACG [1]; this study
trnLF-c2b AYTCCTTGCCCATTCATTATCTGTTCA [1]; this study
trnLF-e GGTTCAAGTCCCTCTATCCC [8]
trnLF-960R AGCTATCCCGACCATTCTC [17]
ycf1 ycf1-M935F AGAACAGTCGGACCAAAAGA [18]
ycf1-M1792R TGACATACTGAAACGACTGCC [18]
Open in a new tab

1.2. DNA sequencing and upload to GenBank

A modified cetyl trimethyl ammonium bromide (CTAB) method [17,20,21] was used for whole genomic DNA. The extracted DNA was amplified using polymerase chain reaction (PCR). 6.4 μl ddH2O, 1.5 μl MgCl2 (25 mM), 0.25 μl dNTPs (10 mM), 0.375 μl of each forward and reverse primer (10 μM each, listed in Table 1), 0.5 μl bovine serum albumin (BSA, 10 mg/ml), 0.1 μl Flexi-taq DNA polymerase (Promega, Madison, Wisconsin, U.S.A.), and 0.5 μl DNA template were added for each reaction. The following PCR protocol was adopted: 5 min template denaturation at 95 °C followed by 38 cycles of denaturation at 95 °C for 1 min; primer annealing at 50 °C for 1 min; primer extension at 65 °C for 4 min; with the final extension set to 65 °C for 5 min. PCR products were purified, amplified and sequenced by BGI (Hong Kong, PR China) using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, California, U.S.A.), with sequencing run on an AB 3730 DNA Analyzer (Applied Biosystems). The sequences were uploaded to GenBank (https://www.ncbi.nlm.nih.gov/genbank/). The summary of the taxon-sequence matrix showing the voucher information and molecular data (GenBank accession numbers) of 67 Goniothalamus accessions and 14 accessions in the tribe Annoneae of the family Annonaceae for the nine cpDNA regions is presented in Table 2.

Table 2.

Summary of voucher information and GenBank accession numbers of the 81 accessions.

Voucher information
 GenBank accession numbers
Taxon name Origin Voucher Collection date atpB-rbcL matK ndhF psbA-trnH trnL-F trnS-G ycf1 rbcL psbM-trnD
Annona dumetorum R.E.Fr. Dominican Republic Abbott, J.R. 20966 (FLAS) 6 June 2006 – GQ139704 – EU420856 EU420838 – GU937352 EU420856 –
Annona glabra L. USA Chatrou, L.W. 467 (U) EF179246 GQ139717 EF179281 AY841596 AY841673 EF179323 GU937365 AY841596 –
Annona herzogii (R.E.Fr.) H.Rainer Bolivia Chatrou, L.W. et al. 347 (U) EF179273 DQ125062 EF179308 AY841656 AY841734 EF179350 – AY841656 –
Annona mucosa Jacq. Abbott, J.R. 21032 (FLAS) – GQ139705 – EU420870 EU420852 – GU937353 EU420870 –
Annona muricata L. Chatrou, L.W. 468 (U) EF179247 AF543722 EF179282 AY743440 AY743459 EF179324 – AY743440 –
Annona reticulata Sieber ex A.DC. Bolivia Chatrou, L.W. et al. 290 (U) – JQ586491 – EU420863 EU420845 – – EU420863 –
Annona squamosa L. Nakkuntod, M. 45 (BCU) – EU715064 – EU420865 EU420847 – – EU420865 –
Anonidium sp. Cheek 7896 Cameroon Cheek, M. 7896 (K) EF179248 DQ125051 EF179283 AY841598 AY841675 EF179325 – AY841598 –
Asimina longifolia Kral USA Weerasooriya, A.D. s.n. (MISS) EF179251 GQ139707 EF179286 DQ124939 GQ139885 EF179328 GU937355 DQ124939 –
Asimina rugelii B.L.Rob. Abbott, J.R. 22361 (FLAS) – GQ139706 – JQ513887 GQ139881 – GU937354 JQ513887 –
Asimina triloba Dunal Chatrou, L.W. et al. 276 (U) EF179252 GQ139711 AY218171 AY743441 AY743460 EF179329 GU937349 AY743441 –
Disepalum platypetalum Merr. Takeuchi, W. & Sambas 18201 EF179257 DQ125057 EF179292 – – EF179334 – – –
Disepalum pulchrum (King) J.Sinclair Chan, R. 192 (FLAS) – GQ139736 – JQ513888 GQ139909 – GU937383 JQ513888 –
Goniothalamus tapis Miq. Thailand Keßler, P.J.A. 3193 (L) EF179262 DQ125058 EF179297 AY841622 AY841700 EF179339 – AY841622 –
Goniothalamus amuyon Merr. Philippines Tang, C.C. 20100907 (HKU) 7 Sept 2010 KM818518 KM818567 KM818648 KM818728 KM818898 KM818916 KM818979 KM818839 KM818755
Goniothalamus andersonii J.Sinclair Borneo Anderson, J.A.R. S12596 (L) 18 May 1961 KM818519 KM818568 – KM818711 KM818867 KM818949 – KM818789 –
Goniothalamus angustifolius (A.C.Sm.) B.Xue & R.M.K. Saunders Fiji Gillespie, J.W. 2198 (A) 9 Aug 1927 – KM818569 KM818632 KM818732 KM818878 KM818937 KM818983 KM818797 –
Goniothalamus aruensis Scheff. New Guinea Regalado, J. & Takeuchi, W. 1409 (L) 26 Jun 1995 KM818520 KM818570 KM818640 KM818706 KM818868 KM818918 – KM818791 –
Goniothalamus australis Jessup Australia Unknown collector 3178 (HKU) 17 Jun 2009 KM818521 KM818571 KM818638 KM818709 KM818887 KM818910 KM818973 KM818836 KM818769
Goniothalamus borneensis Mat-Salleh Borneo Arbainsyah et al. AA1011 (L) 21 Feb 1995 KM818522 KM818572 KM818673 – KM818893 KM818952 – KM818826 KM818747
Goniothalamus bracteosus Bân Borneo Clemens, J. & Clemens, M.S. 27619 (L) 17 Dec 1931 – KM818573 – KM818730 KM818906 KM818967 – KM818796 –
Goniothalamus calcareus Mat-Salleh Borneo Ahmad Ali, J. BRUN23929 (BRUN) 10 July 2012 – – – KM818717 – KM818927 KM818994 KM818810 –
Goniothalamus calvicarpus Craib Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/13 (HKU) 25 Jul 2004 KM818523 KM818574 KM818647 KM818702 KM818874 KM818934 KM819005 KM818809 KM818775
Goniothalamus cardiopetalus Hook.f. & Thomson India Raghavan, R.S. 86311 (L) 16 Feb 1963 KM818524 KM818575 KM818654 KM818692 KM818879 KM818912 – KM818799 KM818752
Goniothalamus cauliflorus K.Schum. Papua New Guinea Hartley, T.G. 9911 (L) 15 Feb 1962 KM818525 KM818576 KM818663 KM818696 KM818869 KM818919 – KM818807 KM818757
Goniothalamus cheliensis Hu Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/22 (HKU) 25 Jul 2004 KM818526 KM818577 KM818661 KM818678 KM818901 KM818926 KM818992 KM818831 KM818758
Goniothalamus clemensii Bân Borneo Beaman, J.H. 8184 (L) 3 Jan 1984 – KM818578 – KM818736 KM818844 KM818915 – KM818780 –
Goniothalamus costulatus Miq. Java Martati, T. 169 (L) 15 Sep 1960 – KM818579 – KM818737 KM818865 KM818945 – KM818805 –
Goniothalamus dumontetii R.M.K. Saunders & Munzinger New Caledonia Dumontet, V. & Poullain, C. 716 (HKU) 15 Jun 2006 – KM818580 – KM818729 KM818861 KM818954 – KM818840 –
Goniothalamus elegans Ast Thailand Nakkuntod, M. 40 (BCU) 28 Oct 2005 KM818527 KM818581 KM818676 KM818707 KM818850 KM818955 KM818997 KM818817 –
Goniothalamus elmeri Merr. Philippines Rosario et al. 11-014 (University of Santo Tomas Herbarium) s.a. – KM818582 KM818639 KM818677 KM818882 KM818924 KM819003 KM818811 –
Goniothalamus expansus Craib Thailand Kitamura, S. MN22 (BCU) 9 Jun 2004 – KM818583 KM818634 KM818714 KM818853 KM818931 KM818987 KM818829 –
Goniothalamus fasciculatus Boerl. Borneo Keßler, P.J.A. et al. 2846 (HKU) 10 Apr 2000 KM818528 KM818584 KM818636 – KM818890 KM818950 – – –
Goniothalamus gardneri Hook.f. & Thomson Sri Lanka Tillekaratne, H.I. G29 (HKU) s.a. KM818529 KM818585 KM818656 KM818704 KM818871 KM818923 KM819001 KM818784 KM818773
Goniothalamus giganteus Hook.f. & Thomson Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/28 (HKU) 25 Jul 2004 KM818530 KM818586 KM818655 KM818698 KM818892 KM818963 KM818996 KM818837 KM818754
Goniothalamus grandiflorus Boerl. Papua New Guinea Takeuchi, W.N. 8771 (L) 11 Feb 1993 KM818531 KM818587 KM818637 KM818691 KM818851 KM818930 – KM818802 KM818770
Goniothalamus griffithii Hook.f. & Thomson Thailand Saunders, R.M.K. & Chalermglin, P. 04/30 (HKU) 28 Jul 2004 KM818532 KM818588 KM818651 KM818701 KM818894 KM818939 KM819000 KM818798 KM818748
Goniothalamus hookeri Thwaites Sri Lanka Ratnayake, R.M.C.S. 100 (HKU) 10 Feb 2003 KM818533 KM818589 KM818657 KM818734 KM818872 KM818956 – KM818814 KM818774
Goniothalamus howii Merr. & Chun China Wang, X.B. W2011003 (HUTB) 3 Aug 2011 KM818534 KM818590 – KM818689 KM818886 KM818938 KM818986 KM818833 KM818767
Goniothalamus imbricatus Scheff. Papua New Guinea Bau, B. LAE89112 (LAE) s.a. KM818535 KM818591 – KM818722 KM818847 KM818946 KM818998 KM818806 KM818753
Goniothalamus kinabaluensis Bân ex Mat-Salleh Borneo Vogel, E.F. de 8387 (L) 18 Oct 1986 KM818536 KM818592 KM818672 KM818684 KM818876 KM818935 – KM818787 KM818745
Goniothalamus laoticus (Finet & Gagnep.) Bân Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/9 (HKU) 25 Jul 2004 KM818537 KM818593 KM818666 KM818699 KM818881 KM818959 KM818993 KM818808 KM818760
Goniothalamus loerzingii R.M.K. Saunders Sumatra Kostermans, A.J.G.H. 22015 (L) 13 Dec 1965 – KM818594 – KM818724 KM818902 KM818947 – KM818782 –
Goniothalamus macranthus Boerl. Andamans King׳s collector 347 (L) 1884 KM818538 KM818595 KM818643 KM818695 KM818873 KM818928 KM818995 KM818792 KM818776
Goniothalamus macrophyllus (Blume) Hook.f. & Thoms. Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/16 (HKU) 25 Jul 2004 KM818539 KM818596 KM818665 KM818688 KM818897 KM818940 KM819002 KM818843 KM818766
Goniothalamus maewongensis R.M.K. Saunders & Chalermglin Thailand Saunders, R.M.K., Nakkuntod, M. & Chalermglin, P. 04/35 (HKU) 29 Jul 2004 KM818540 KM818597 KM818659 KM818725 KM818888 KM818962 KM818977 KM818838 KM818746
Goniothalamus majestatis Kessler Sulawesi McDonald, J.A. 3896 (L) 26 July 1993 KM818541 KM818598 – KM818713 KM818903 KM818958 – KM818788 KM818756
Goniothalamus malayanus Hook.f. & Thomson Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/24 (HKU) 25 Jul 2004 KM818542 KM818599 KM818650 KM818718 KM818891 KM818914 KM819006 KM818835 KM818743
Goniothalamus megalocalyx I.M.Turner & R.M.K. Saunders Borneo Tang, C.C. et al. TCC117 (HKU) 11 Nov 2011 KM818543 KM818600 KM818645 KM818726 KM818885 KM818960 KM819007 KM818822 KM818763
Goniothalamus monospermus (A.Gray) R.M.K. Saunders Fiji Smith, A.C. 5111 (L) 7 Jul-18 Sep 1947 – KM818601 – KM818735 – KM818969 – KM818790 –
Goniothalamus montanus J.Sinclair Peninsular Malaysia Soepadmo, E. & Suhaimi, M. 43 (L) 11 Nov 1989 KM818544 KM818602 KM818674 KM818710 KM818856 KM818932 – KM818813 –
Goniothalamus obtusatus (Baill.) R.M.K. Saunders New Caledonia Veillon, J.M. 7591 (NOU) 25 Nov 1992 KM818545 KM818603 KM818660 KM818687 KM818883 KM818911 KM818981 KM818815 –
Goniothalamus palawanensis C.C. Tang & R.M.K. Saunders Philippines Tang, C.C. TCC12 (HKU) 31 May 2012 – KM818604 – KM818716 KM818855 KM818925 KM818976 KM818793 –
Goniothalamus parallelivenius Ridl. Borneo Tang, C.C. et al. TCC50 (HKU) 16 May 2011 KM818546 KM818605 KM818635 KM818683 KM818880 KM818941 – KM818801 KM818765
Goniothalamus repevensis Pierre ex Finet & Gagnep. Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/8 (HKU) 25 Jul 2004 KM818547 KM818606 KM818664 KM818723 KM818877 KM818936 – KM818795 KM818749
Goniothalamus reticulatus Thwaites Sri Lanka Saunders, R.M.K. & Weerasooriya, A.D. 00/7 (HKU) 17 Jun 2000 KM818548 KM818607 – – – KM818913 – KM818786 KM818742
Goniothalamus ridleyi King Peninsular Malaysia Soepadmo, E. & Suhaimi, M. 341 (L) 16 Feb 1991 KM818549 KM818608 – KM818739 KM818860 KM818951 KM818985 KM818830 –
Goniothalamus rotundisepalus M.R.Hend. Thailand Larsen, K. & Larsen, S.S. 32826 (AAU) 2 Mar 1974 KM818550 KM818609 KM818649 KM818693 KM818857 KM818908 – KM818794 KM818759
Goniothalamus rufus Miq. Borneo Keßler, P.J.A. et al. 2482 (L) 10 Mar 1999 KM818551 KM818610 – KM818727 KM818848 KM818943 – KM818819 –
Goniothalamus sawtehii C.E.C.Fisch. Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/14 (HKU) 25 Jul 2004 KM818552 KM818611 KM818646 KM818680 KM818895 KM818942 KM819004 KM818785 KM818751
Goniothalamus scortechinii King Peninsular Malaysia Noorsiha, A. et al. FRI 39427 (L) 21 Sep 1993 KM818553 KM818612 KM818670 KM818712 KM818845 KM818929 KM818988 KM818781 KM818744
Goniothalamus sesquipedalis Hook.f. & Thomson India Griffith, W. s.n. [= Herb. E. India Co. 402A] (L) s.a. KM818554 KM818613 KM818667 KM818719 KM818904 KM818907 KM818984 KM818825 KM818740
Goniothalamus sp. nov. tcc10 Philippines Tang, C.C. TCC10 (HKU) 31 May 2012 – KM818614 KM818675 KM818715 KM818864 KM818944 KM818980 KM818821 –
Goniothalamus suaveolens 1 Becc. Borneo Tang, C.C. TCC32 (HKU) 10 May 2011 KM818555 KM818616 – KM818682 KM818858 KM818933 KM818982 KM818800 KM818762
Goniothalamus suaveolens 2 Becc. Borneo Atkins, S. 466 (L) 14 Jul 1993 – KM818615 – KM818681 KM818884 KM818968 KM818999 KM818818 –
Goniothalamus tamirensis Pierre ex Finet & Gagnep. Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/23 (HKU) 25 Jul 2004 KM818556 KM818617 KM818662 KM818700 KM818866 KM818917 KM818990 KM818832 KM818761
Goniothalamus tapisoides Mat-Salleh Borneo Tang, C.C. et al. TCC51 (HKU) 16 May 2011 KM818557 KM818618 KM818641 KM818686 KM818899 KM818920 – KM818823 KM818771
Goniothalamus tavoyensis Chatterjee Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/11 (HKU) 25 Jul 2004 KM818558 KM818619 KM818633 KM818690 KM818854 KM818961 – KM818841 KM818750
Goniothalamus tenuifolius King Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/17 (HKU) 25 Jul 2004 KM818559 KM818620 KM818669 KM818694 KM818889 KM818909 KM818974 KM818842 KM818741
Goniothalamus thomsoni Thwaites Sri Lanka Kostermans, A.J.G.H. 25485 (L) 31 Aug 1974 – KM818621 – KM818733 KM818875 KM818971 – KM818834 –
Goniothalamus thwaitesii Hook.f. & Thomson India Beddome, R.H. 299 (PDA) s.a. KM818560 KM818622 KM818653 KM818703 KM818849 KM818922 – – KM818772
Goniothalamus tomentosus R.M.K. Saunders Peninsular Malaysia Whitmore, T.C. FRI 3851 (L) 21 May 1967 KM818561 KM818623 – KM818738 KM818846 KM818964 – KM818783 –
Goniothalamus tortilipetalus M.R.Hend. Thailand Nakkuntod, S. 58 (HKU) 25 Nov 2005 – KM818624 KM818642 KM818708 KM818905 KM818948 – KM818828 –
Goniothalamus touranensis Ast Indochina Clemens, J. & Clemens, M.S. 4187 (NY) May-Jul 1927 – KM818625 – KM818731 KM818870 KM818965 – KM818804 –
Goniothalamus undulatus Ridl. Cultivated Saunders, R.M.K., Su, Y.C.F. & Chalermglin, P. 04/25 (HKU) 25 Jul 2004 KM818562 KM818626 KM818652 KM818679 KM818896 KM818921 KM818978 KM818820 KM818777
Goniothalamus uvarioides King Peninsular Malaysia Kochummen, K.M. FRI 2344 (L) 24 May 1967 – KM818627 KM818658 KM818685 KM818852 KM818966 KM818975 KM818827 –
Goniothalamus velutinus Airy Shaw Borneo Tang, C.C. TCC46 (HKU) 16 May 2011 KM818563 KM818628 KM818644 KM818705 KM818900 KM818953 KM818989 KM818812 KM818764
Goniothalamus woodii Merr. ex Mat-Salleh Borneo Shea, G. SAN 75202 (L) 18 Mar 1972 KM818564 KM818629 KM818668 KM818720 KM818862 KM818972 – KM818824 KM818778
Goniothalamus wrayi King Peninsular Malaysia Suppiah, T. FRI 28345 (L) 18 Jan 1979 KM818565 KM818630 KM818671 KM818721 KM818859 KM818957 – KM818803 KM818779
Goniothalamus wynaadensis Bedd. India Kramer, K.U. 6248 (L) 17 Dec 1977 KM818566 KM818631 – KM818697 KM818863 KM818970 KM818991 KM818816 KM818768
Neostenanthera myristicifolia (Oliv.) Exell Gabon Wieringa, J.J. et al. 3566 (WAG) EF179271 AY743486 EF179306 AY743448 AY743467 EF179348 – AY743448 –
Open in a new tab

1.3. Bayesian phylogenetic reconstructions for Goniothalamus

The sequences of the taxa listed in Table 2 were downloaded and aligned using MAFFT v.7.029b [4] with default settings and the automatic algorithm option. For manual editing and optimizing, an 11-bp inversion in psbA-trnH and a 16-bp region in ycf1 were excluded from the matrix in Geneious. The aligned and edited matrices of each region are presented as Supplementary material (Alignments 1–9, representing atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1).

For Bayesian phylogenetic reconstructions, MrBayes v.3.1.2 [22,23] was performed using the online portal in the CIPRES Science Gateway [24]. Data was partitioned according to DNA region identity. The best-fitting evolutionary models were selected using MrModeltest v.2.3 [25] under the Akaike Information Criterion (AIC [26]): GTR+Γ+I was selected for the psbA-trnH, psbM-F, rbcL, and ycf1 partitions; GTR+Γ was selected for the matK, ndhF, trnL-F, and trnS-G partitions; and the Hasegawa–Kishino–Yano Model with among-site rate variation modeled with a gamma distribution (HKY+Γ) for the atpB-rbcL partition. Four independent MCMCMC analyses were run in the Bayesian phylogenetic reconstructions, each with 5,000,000 generations, sampled every 1000th generation. Each run involved three incrementally heated and one cold Markov chain with a temperature parameter of 0.16. The parameters for substitution rates of nucleotide substitution models, character state frequencies and rate variation among sites were unlinked. In order to reduce the likelihood of stochastic entrapment in local tree length optima [27,28], the mean branch length prior was adjusted to 0.01 (brlenspr=unconstrained:exponential (100.0)); all other priors were kept as default. Convergence was assessed by checking that the standard deviation of split frequencies was <0.005. Adequate effective sample sizes (ESS >200) were checked in Tracer v.1.5 [29], which also showed whether the parameter samples were drawn from a unimodal and stationary distribution. The “Cumulative” and “Compare” functions of AWTY [30] were used to evaluate stationarity of posterior probabilities of splits within runs and convergence between different runs. 25% burn-in of initial samples of each run was excluded and a 50% majority-rule consensus tree (see Interactive Phylogenetic Tree 1) was calculated from the post-burn-in trees. A phylogeny with 66 Goniothalamus species was extracted from the resultant 50% majority-rule consensus tree. Previous infrageneric classifications [2,3] are superimposed onto the phylogeny to show congruence (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Bayesian 50% majority-rule consensus tree of Goniothalamus species, generated from 9-partitioned dataset with all outgroups removed. Previous infrageneric classifications [2,3], published prior to the availability of molecular phylogenetic methods, are superimposed. Boerlage [2] recognized two sections, Eu-Goniothalamus (equivalent to the autonymic sect. Goniothalamus) and Beccariodendron, based on differences in ovule number per carpel. Bân [3] subsequently recognized two subgenera, Goniothalamus and Truncatella, based on differences in staminal connective shape; each of these subgenera were further divided into sections based on stigma and pseudostyle shape, and subsections based on the number of ovules per carpel. Branch length is proportional to the substitutions rate. Scale bar: 0.1 substitutions per site.

1.4. Taxon-character data matrix

Morphological characters including vegetative, floral, fruit and seed characters were assessed from living and herbarium material (BRUN, HKU, K, L, NY and US herbaria). A total of 14 vegetative, floral, fruit and seed characters were assessed from living and herbarium material, supplemented by species descriptions [31–53]. A summary of 14 characters of 66 Goniothalamus species and seven species in the tribe Annoneae are shown in Supplementary Table 1.

Acknowledgments

This research was supported by a grant from the Hong Kong Research Grants Council (HKU776713), awarded to RMKS and DCT. We are grateful to the curators of the following herbaria: E, BRUN, L, LAE, and SING for providing leaf materials. Additional leaf material and/or field collections were gratefully received from Grecebio Jonathan Alejandro, Joffre Haji Ali Ahmad, Billy Bau, David Burslem, Piya Chalermglin, Rosario Rubite, Leonardo Co, Vivian Fu, Maan Guzman, Hsieh Chang-Fu, Hou Sue Liang, Mark Hughes, Daniel Lagunzad, Thomas Magun, Joan Pereira, Sena Ratnayake, Haji Saidin Salleh, John Sugau, Danilo N. Tamdang, Erin Treiber, Wang Xuebing, George Weiblen, Tim Whitfeld, and Mahmud Yussof.

Footnotes

Appendix A

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.dib.2015.06.021.

Supplementary materials

Supplementary material

mmc1.zip (7.6KB, zip)

Supplementary material

mmc2.zip (6.2KB, zip)

Supplementary material

mmc3.zip (13KB, zip)

Supplementary material

mmc4.zip (6KB, zip)

Supplementary material

mmc5.zip (6.5KB, zip)

Supplementary material

mmc6.zip (10.3KB, zip)

Supplementary material

mmc7.zip (7.9KB, zip)

Supplementary material

mmc8.zip (8.2KB, zip)

Supplementary material

mmc9.zip (8.7KB, zip)

Supplementary material

mmc10.new (6.7KB, new)

Supplementary material

mmc11.xlsx (16KB, xlsx)

References

  • 1.Tang C.C., Thomas D.C., Saunders R.M.K. Molecular phylogenetics of the species-rich angiosperm genus Goniothalamus (Annonaceae) inferred from nine chloroplast DNA regions: Synapomorphies and putative correlated evolutionary changes in fruit and seed morphology. Mol. Phylogenetics Evol. 2015;92:124–139. doi: 10.1016/j.ympev.2015.06.016. [DOI] [PubMed] [Google Scholar]
  • 2.J.G. Boerlage, Notes sur les Annonaceés du Jardin Botanique de Buitenzorg, Icones Bogoriensis 1, 1899, 79–156+pl. 26–50.
  • 3.Bân N.T. On the taxonomy of the genus Goniothalamus (Blume) J.D. Hook. & Thomson (Annonaceae). 2. Bot. Žurn. 1974;59:660–672. [Google Scholar]
  • 4.Katoh K., Misawa K., Kuma K., Miyata. T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30:3059–3066. doi: 10.1093/nar/gkf436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.A.J. Drummond et al., Geneious, version 5.1, 2010. Available from: 〈http://www.geneious.com/〉.
  • 6.Koressaar T., Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics. 2007;23:1289–1291. doi: 10.1093/bioinformatics/btm091. [DOI] [PubMed] [Google Scholar]
  • 7.Untergrasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M., Rozen. S.G. Primer3—new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Taberlet P., Gielly L., Pautou G., Bouvet J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991;17:1105–1109. doi: 10.1007/BF00037152. [DOI] [PubMed] [Google Scholar]
  • 9.Olmstead R.G., Sweere J.A. Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Syst. Biol. 1994;43:467–481. [Google Scholar]
  • 10.Hoot S.B., Crane P.R. Inter-familial relationships in the Ranunculidae based on molecular systematics. In: Jensen U., Kadereit J.W., editors. Systematics and Evolution of the Ranunculiflorae. Springer; New York: 1995. pp. 119–131. [Google Scholar]
  • 11.Fay M.F., Swensen S.M., Chase. M.W. Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae) Kew Bull. 1997;52:111–120. [Google Scholar]
  • 12.Hamilton M. Four primer pairs for the amplification of chloroplast intergenic regions with intraspecific variation. Mol. Ecol. 1999;8:521–523. [PubMed] [Google Scholar]
  • 13.Tate J.A., Simpson B.B. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 2003;28:723–737. [Google Scholar]
  • 14.Scharaschkin T., Doyle J.A. Phylogeny and historical biogeography of Anaxagorea (Annonaceae) using morphology and non-coding chloroplast sequence data. Syst. Bot. 2005;30:712–735. [Google Scholar]
  • 15.Shaw J., Lickey E.B., Beck J.T., Farmer S.B., Liu W., Miller J., Siripun K.C., Winder C.T., Schilling E.E., Small R.L. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 2005;92:142–166. doi: 10.3732/ajb.92.1.142. [DOI] [PubMed] [Google Scholar]
  • 16.Erkens R.H.J., Chatrou L.W., Maas J.W., van der Niet T., Savolainen. V. A rapid diversification of rainforest trees (Guatteria; Annonaceae) following dispersal from Central into South America. Mol. Phylogenetics Evol. 2007;44:399–411. doi: 10.1016/j.ympev.2007.02.017. [DOI] [PubMed] [Google Scholar]
  • 17.Su Y.C.F., Smith G.J.D., Saunders R.M.K. Phylogeny of the basal angiosperm genus Pseuduvaria (Annonaceae) inferred from five chloroplast DNA regions, with interpretation of morphological character evolution. Mol. Phylogenetics Evol. 2008;48:188–206. doi: 10.1016/j.ympev.2008.03.028. [DOI] [PubMed] [Google Scholar]
  • 18.Thomas D.C., Surveswaran S., Xue B., Sankowsky G., Mols J.B., Keßler P.J.A., Saunders R.M.K. Molecular phylogenetics and historical biogeography of the Meiogyne-Fitzalania clade (Annonaceae): generic paraphyly and late Miocene-Pliocene diversification in Australasia and the Pacific. Taxon. 2012;61:559–575. [Google Scholar]
  • 19.Sang T., Crawford D., Stuessy T. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae) Am. J. Bot. 1997;84:1120–1136. [PubMed] [Google Scholar]
  • 20.Doyle J.J., Doyle. J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987;19:11–15. [Google Scholar]
  • 21.Erkens R.H.J., Cross H., Maas J.W., Hoenselaar K., Chatrou L.W. Assessment of age and greenness of herbarium specimens as predictors for successful extraction and amplification of DNA. Blumea. 2008;53:407–428. [Google Scholar]
  • 22.Huelsenbeck J.P., Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  • 23.Ronquist F., Huelsenbeck J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 24.M.A. Miller, W. Pfeiffer, T. Schwartz, Creating the CIPRES science gateway for inference of large phylogenetic trees, in: Proceedings of the Gateway Computing Environments Workshop (GCE), 2010.
  • 25.J.A.A. Nylander, MrModeltest, version 2.3, 2004. Available from: 〈http://www.abc.se/~nylander〉.
  • 26.Akaike H. Likelihood of a model and information criteria. J. Econom. 1981;16:3–14. [Google Scholar]
  • 27.Brown J.M., Hedtke S.M., Lemmon A.R., Lemmon E.M. When trees grow too long: investigating the causes of highly inaccurate Bayesian branch-length estimates. Syst. Biol. 2010;59:145–161. doi: 10.1093/sysbio/syp081. [DOI] [PubMed] [Google Scholar]
  • 28.Marshall D.C. Cryptic failure of partitioned Bayesian phylogenetic analyses: lost in the land of long trees. Syst. Biol. 2010;59:108–117. doi: 10.1093/sysbio/syp080. [DOI] [PubMed] [Google Scholar]
  • 29.A. Rambaut, A.J. Drummond, Tracer, version 1.5 2009. Available from: 〈http://beast.bio.ed.ac.uk/Tracer〉.
  • 30.Nylander J.A., Wilgenbusch J.C., Warren D.L., Swofford. D.L. AWTY (are we there yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics. 2008;24:581–583. doi: 10.1093/bioinformatics/btm388. [DOI] [PubMed] [Google Scholar]
  • 31.Hooker J.D., Thomson T. Vol. 1. W. Pamplin; London: 1855. Flora Indica. [Google Scholar]
  • 32.Hooker J.D., Thomson. T. Annonaceae. In: Hooker J.D., editor. Vol. 1. L. Reeve; Ashford, Kent: 1872. pp. 45–94. (The Flora of British India). [Google Scholar]
  • 33.Kurz W.S. Vol. 1. Superintendent of Government Printing; Calcutta: 1877. (Forest Flora of British Burma). [Google Scholar]
  • 34.King G. Materials for a flora of the Malay Peninsula. No. 4. J. Asiat. Soc. Bengal 2 Nat. Hist. 1892;61:1–130. [Google Scholar]
  • 35.King. G. The Annonaceae of British India. Ann. Roy. Bot. Gard. 1893;4:1–169. +pl. 1–220. [Google Scholar]
  • 36.Finet A., Gagnepain F. Contributions à l‘étude de la flore de l’Asie orientale. Bull. Soc. Bot. France, Mém. IV. 1906;53:55–170. +pl. 9–20. [Google Scholar]
  • 37.Finet A., Gagnepain. F. Annonacées. In: Lecomte H., editor. Vol. 1. Masson; Paris: 1907. pp. 42–123. (Flore Générale de l’Indo-Chine). +pl. 4–14. [Google Scholar]
  • 38.Ridley. H.N. Vol. 1. L. Reeve; London: 1922. The Flora of the Malay Peninsula. [Google Scholar]
  • 39.Ridley. H.N. Vol. 5. L. Reeve; London: 1925. The Flora of the Malay Peninsula. [Google Scholar]
  • 40.Ast. S. Anonacées. In: Humbert H., editor. Flore Générale de l׳Indo-Chine (Suppl. 1) Muséum National d׳Histoire Naturelle; Paris: 1938. pp. S59–S123. [Google Scholar]
  • 41.Sinclair. J. A revision of the Malayan Annonaceae. Gard. Bull. Singap. 1955;14:149–516. [Google Scholar]
  • 42.Tsiang Y., Li. P.-T. Annonaceae. In: Tsiang Y., Li P.-T., editors. Vol. 30. Science Press; Beijing: 1979. pp. 10–175. (Flora Reipublicae Popularis Sinicae). [Google Scholar]
  • 43.Hô P.-H. Published by the author; Montreal: 1991. Cayco Vietnam: An Illustrated Flora of Vietnam. [Google Scholar]
  • 44.Yuan. S.H. Annonaceae. In: Chen Z.W.J., editor. Vol. 5. Science Press; Beijing: 1991. pp. 5–64. (Flora Yunnanica). [Google Scholar]
  • 45.Mat-Salleh K. Michigan State University; East Lansing: 1993. Revision of the genus Goniothalamus (Annonaceae) of Borneo. Ph.D. thesis. [Google Scholar]
  • 46.Mat-Salleh K. New and noteworthy species of Bornean Goniothalamus (Annonaceae) Folia Malays. 2001;2:75–116. [Google Scholar]
  • 47.Bân N.T. Vol. 1. Science & Technics Publ.; Hanoi: 2000. Thuc vât chí Viêt Nam. [Google Scholar]
  • 48.Saunders. R.M.K. The genus Goniothalamus (Annonaceae) in Sumatra. Bot. J. Linn. Soc. 2002;139:225–254. [Google Scholar]
  • 49.Saunders. R.M.K. A synopsis of Goniothalamus species (Annonaceae) in Peninsular Malaysia, with a description of a new species. Bot. J. Linn. Soc. 2003;142:321–339. [Google Scholar]
  • 50.Saunders R.M.K., Munzinger. J. A new species of Goniothalamus (Annonaceae) from New Caledonia, representing a significant range extension for the genus. Bot. J. Linn. Soc. 2007;155:497–503. [Google Scholar]
  • 51.Saunders R.M.K., Chalermglin. P. A synopsis of Goniothalamus species (Annonaceae) in Thailand, with descriptions of three new species. Bot. J. Linn. Soc. 2008;156:355–384. [Google Scholar]
  • 52.Turner I.M., Saunders R.M.K. Four new species of Goniothalamus (Annonaceae) from Borneo. Nord. J. Bot. 2008;26:329–337. [Google Scholar]
  • 53.Tang C.C., Xue B., Saunders. R.M.K. A new species of Goniothalamus (Annonaceae) from Palawan, and a new nomenclatural combination in the genus from Fiji. PhytoKeys. 2013;32:27–35. doi: 10.3897/phytokeys.32.6663. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material

mmc1.zip (7.6KB, zip)

Supplementary material

mmc2.zip (6.2KB, zip)

Supplementary material

mmc3.zip (13KB, zip)

Supplementary material

mmc4.zip (6KB, zip)

Supplementary material

mmc5.zip (6.5KB, zip)

Supplementary material

mmc6.zip (10.3KB, zip)

Supplementary material

mmc7.zip (7.9KB, zip)

Supplementary material

mmc8.zip (8.2KB, zip)

Supplementary material

mmc9.zip (8.7KB, zip)

Supplementary material

mmc10.new (6.7KB, new)

Supplementary material

mmc11.xlsx (16KB, xlsx)

Articles from Data in Brief are provided here courtesy of Elsevier

RESOURCES