Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Jul 17;112(31):E4288–E4297. doi: 10.1073/pnas.1502068112

MicroRNA-224 promotes tumor progression in nonsmall cell lung cancer

Ri Cui a,b,1, Wei Meng c,1, Hui-Lung Sun a, Taewan Kim a,2, Zhenqing Ye d, Matteo Fassan e, Young-Jun Jeon a, Bin Li c, Caterina Vicentini e, Yong Peng a,3, Tae Jin Lee a, Zhenghua Luo a, Lan Liu f, Dongyuan Xu f, Esmerina Tili a,g, Victor Jin d, Justin Middleton a, Arnab Chakravarti c, Tim Lautenschlaeger c,4, Carlo M Croce a,4
PMCID: PMC4534291  PMID: 26187928

Significance

Aberrant microRNA (miRNA) expression is involved in tumorigenesis, and miR-224 was observed to be up-regulated in certain tumor types. However, the role of miR-224 in the pathogenesis of lung cancer remains poorly understood. Here, we comprehensively analyzed and revealed mechanisms of miR-224 up-regulation and its oncogenic role in nonsmall cell lung cancer (NSCLC). We showed that miR-224 promotes cellular migratory, invasive, and proliferative capacity and tumor growth both in vitro and in vivo. Furthermore, we identified TNFα-induced protein 1 and SMAD4 as targets of miR-224. In addition, up-regulated miR-224 expression in NSCLC is partially controlled by its promoter region’s hypomethylation and activated ERK signaling. Our finding suggests that targeting miR-224 might be a promising therapeutic strategy in the treatment of NSCLC.

Keywords: microRNA, NSCLC, metastasis, TNFAIP1, SMAD4

Abstract

Lung cancer is the leading cause of cancer-related deaths worldwide. Despite advancements and improvements in surgical and medical treatments, the survival rate of lung cancer patients remains frustratingly poor. Local control for early-stage nonsmall cell lung cancer (NSCLC) has dramatically improved over the last decades for both operable and inoperable patients. However, the molecular mechanisms of NSCLC invasion leading to regional and distant disease spread remain poorly understood. Here, we identify microRNA-224 (miR-224) to be significantly up-regulated in NSCLC tissues, particularly in resected NSCLC metastasis. Increased miR-224 expression promotes cell migration, invasion, and proliferation by directly targeting the tumor suppressors TNFα-induced protein 1 (TNFAIP1) and SMAD4. In concordance with in vitro studies, mouse xenograft studies validated that miR-224 functions as a potent oncogenic miRNA in NSCLC in vivo. Moreover, we found promoter hypomethylation and activated ERK signaling to be involved in the regulation of miR-224 expression in NSCLC. Up-regulated miR-224, thus, facilitates tumor progression by shifting the equilibrium of the partially antagonist functions of SMAD4 and TNFAIP1 toward enhanced invasion and growth in NSCLC. Our findings indicate that targeting miR-224 could be effective in the treatment of certain lung cancer patients.


Lung cancer is the second most common cancer and the leading cause of cancer-related death worldwide. In 2013, there were an estimated 228,190 new cases of lung cancer and 159,480 deaths in the United States. Despite advancements and improvements in surgical and medical treatments, the 5-y survival rate of lung cancer patients remains frustratingly poor (1). Although local control for early-stage nonsmall cell lung cancer (NSCLC) has dramatically improved over the last decades for both operable and inoperable patients (2, 3), ∼20% of early-stage patients, however, are developing distant metastasis (4, 5), and 10–15% of patients undergoing stereotactic ablative body radiation fail regionally (6). The molecular mechanisms of NSCLC invasion leading to regional and distant disease spread remain poorly understood. Understanding the molecular mechanisms that regulate invasion and disease spread would help to identify promising therapeutic targets and could be exploited to refine patient selection for already existing therapies.

MicroRNAs (miRNAs) are small endogenous noncoding RNAs that negatively regulate mRNA stability and/or repress mRNA translation (7). miRNAs have been proven to play essential roles in the initiation and progression of certain cancer types, such as chronic lymphocytic leukemia (8), breast cancer (9), and lung cancer (10, 11). Several miRNA expression profiling studies have shown that miRNAs could be used as diagnostic and prognostic biomarkers. For example, high expression levels of miR-155 and low levels of let-7a expression correlate with poor prognosis of lung cancer (10). In colorectal cancer (CRC), up-regulated miR-135b correlates with tumor stage and poor clinical outcome (12). Recently, we conducted genome-wide miRNA sequencing in primary lung cancer tissue from patients with lung adenocarcinoma (ADC), and we identified that miR-31 promotes lymph node metastasis and negatively correlates with survival in patients with lung ADC (13), emphasizing the impact of miRNAs in NSCLC biology.

TNFα-induced protein 1 (TNFAIP1) was originally identified as a TNFα- and LPS-inducible gene (14). It has been reported that TNFAIP1 interacts with the proliferating cell nuclear antigen and the small subunit of DNA polymerase-δ (P50) (15), suggesting that TNFAIP1 might be involved in DNA synthesis and apoptosis. Indeed, TNFAIP1 elicited proapoptotic activity, and coexpression of TNFAIP1 and RhoB markedly increased apoptosis in HeLa cells (16). SMAD4 plays a central role in the TGF-β family signaling pathways and is the only member of the SMAD family that is involved in TGF-β, activing, and bone morphogenetic protein signaling pathways (17, 18). SMAD4 functions as a tumor suppressor; loss of SMAD4 was frequently seen in pancreatic cancers and CRCs. Approximately 55% of pancreatic cancers have deletions or mutations in the SMAD4 locus (19), and about 30% of biallelic loss of SMAD4 was found in metastatic CRCs (20). To date, several studies have reported that TNFAIP1 and SMAD4 are targets of miRNAs in certain cancer types. For instance, oncogenic miRNAs, such as the miR-130a/301a/454 family, target SMAD4 in CRC, and miR-182 targets SMAD4 in bladder cancer (21, 22). In gastric cancer, miR-372/373 targets TNFAIP1, promoting carcinogenesis (23, 24).

Here, we show that increased miR-224 in NSCLC promotes cell migration, invasion, and proliferation by direct targeting of TNFAIP1 and SMAD4. We further show that aberrant miR-224 expression is partially controlled by hypomethylation of its promoter region and activated ERK signaling in NSCLC. Through both in vitro and in vivo analyses, we revealed the mechanisms of miR-224 up-regulation and its oncogenic role in NSCLC pathogenesis.

Results

Up-Regulated miR-224 Is Associated with NSCLC Metastasis.

We conducted genome-wide miRNA sequencing (miR-seq) on four primary lung ADCs with lymph node metastasis and six primary lung ADCs without lymph node metastasis as previously described (13). We selected 16 deregulated miRNAs with P values less than 0.01 and fold changes larger than five (SI Appendix, Table S1). Among 12 up-regulated miRNAs, we have shown that miR-31 was positively associated with lymph node metastasis and negatively correlated with survival in patients with lung ADC (13). Subsequent analyses using 87 NSCLC cases and 48 normal adjacent tissues (NATs) from the Ohio State University Comprehensive Cancer Center (OSUCCC) Tissue Procurement Shared Resource indicate that miR-224 was significantly up-regulated in both lung ADC and squamous cell carcinoma (SCC) tissues compared with the NATs (Fig. 1 A and B). Reanalysis of 666 lung ADC and SCC cases and 86 NATs for which miR-224 expression was available in The Cancer Genome Atlas (TCGA) miR-seq dataset confirmed that miR-224 was up-regulated in both lung ADC and SCC compared with NATs (SI Appendix, Fig. S1 A and B). In addition, of the evaluable 424 lung ADC patients with available staging and miRNA expression data, 281 patients had N0 disease, and 143 patients had positive lymph nodes (N1+) metastasis. We found that miR-224 was markedly up-regulated in patients with lymph node metastasis (N1+) compared with those patients without lymph node metastasis (N0) (SI Appendix, Fig. S1C). In situ hybridization analyses on human lung tissue microarrays were conducted to further examine miR-224 expression in NSCLC. Analyzing 51 evaluable paired NSCLC tissues and NAT revealed that miR-224 was overexpressed in 61% of cases, in which miR-224 was measured in cancer tissues compared with corresponding NATs (Fig. 1C and SI Appendix, Fig. S1D). We further evaluated miR-224 expression in metastasized lung cancer tissues and primary lung cancer tissues and found stronger miR-224 expression in metastasized lung cancers (90%) compared with that in primary lung cancers (58%) (Fig. 1D). These results suggest that miR-224 might also play an important role in lung cancer metastasis. Kaplan–Meier survival analysis using available data from 642 TCGA NSCLC patients indicates that there is no significant association between miR-224 expression and survival (SI Appendix, Fig. S1E). Interestingly, miR-224 was significantly associated with poor prognosis of patients with lung ADC having Kirsten rat sarcoma viral oncogene homolog (kras)/p53 mutations (n = 59), important genes involved in lung ADC pathogenesis (SI Appendix, Fig. S1F). Significantly up-regulated miR-224 expression in the N1+ group compared with the N0 group was also observed in lung ADC patients with kras/p53 mutations (SI Appendix, Fig. S1G). Subsequent analysis indicates that there is no robust association between miR-224 expression and T stage in the unselected NSCLC TCGA cohort. We, however, found significantly increased miR-224 expression in patients with T3 stage compared with patients with T1 stage (SI Appendix, Fig. S1H).

Fig. 1.

Fig. 1.

miR-224 expression in primary NSCLC and metastasized lung cancer. (A and B) Box plots showing miR-224 expression in patients with (A) lung ADC and (B) lung SCC; the RNA samples were purified from 56 lung ADCs and 21 corresponding NATs and 31 lung SCCs and 27 corresponding NATs, respectively. The RNAs were subject to quantitative RT-PCR with an miR-224 probe, and the expression was normalized by RNU6B. (C) Representative pictures for in situ hybridization analysis of miR-224. (D) Summary of tissue microarray data for metastasized lung cancer.

miR-224 Promotes Migration, Invasion, and Proliferation of Lung Cancer Cells.

Given the high expression of miR-224 in lung cancer and its association with metastasis, we hypothesized that miR-224 might play a role in the carcinogenesis and progression of lung ADC and SCC. To investigate the function of miR-224 in lung cancer cells, we transduced a Lenti-miR vector containing miR-224 precursor in three NSCLC cell lines (H1299, H1573, and H460) to overexpress miR-224. A549 cells were transduced with a vector containing an miRZip-224 anti–miR-224 miR construct to knockdown miR-224. The expression levels of miR-224 after overexpression and/or knockdown were confirmed by quantitative RT-PCR (SI Appendix, Fig. S2 A–D). In response to overexpression of miR-224, the H1299 and H1573 cells’ migratory, invasive, and proliferative abilities were significantly increased (Fig. 2 A–C). Migrated cell counts were shown in SI Appendix, Fig. S2 E and F. Similar results were also observed in miR-224–overexpressing H460 cells (SI Appendix, Fig. S2 G and I). Conversely, knockdown of miR-224 in A549 cells markedly reduced cell migration and proliferation (Fig. 2 D and E and SI Appendix, Fig. S2H).

Fig. 2.

Fig. 2.

Ectopic expression of miR-224 promotes cell proliferation, migration, and invasion. (A) Cell migration assay for miR-224–overexpressing H1299 and H1573 cells using transwell membranes. Representative pictures of migration chambers are shown (40× magnification). (B) Cell invasion assay for miR-224–overexpressing H1299 and H1573 cells. The average counts were derived from 10 random microscopic fields. (C) Cell proliferation assay for miR-224–overexpressing lung cancer cells. The cell growth rates were measured by cell counting kit 8. (D) Representative pictures of migration assay for miR-224 knockdown A549 cells (100× magnification). (E) Cell proliferation assay for miR-224 knockdown A549 cells. The values present means ± SDs as determined by quintuplex assays.

miR-224 Directly Targets the 3′-UTR of TNFAIP1 and SMAD4.

To identify putative mRNA targets of miR-224, we performed bioinformatics analyses and found several candidate targets. Among them, the 3′-UTRs of TNFAIP1 and SMAD4 mRNAs contained sequences complementary to the miR-224 seed sequence (SI Appendix, Fig. S2K). We focused on these two genes based on their tumor-suppressive role in carcinogenesis. To verify whether TNFAIP1 and SMAD4 are direct targets of miR-224, we cotransfected each of the 3′-UTRs and miR-224 mimics in 293T cells. Consistent reduction in luciferase activity for both of 3′-UTRs by miR-224 was observed. To validate target specificity, we generated mutated forms of the 3′-UTRs, where the binding sites of miR-224 were destroyed using the QuikChange Mutagenesis Kit. In detail, there were two miR-224 binding sites for 3′-UTRs of TNFAIP1 and SMAD4. Cotransfection of miR-224 with mutated forms of the 3′-UTRs (TNFAIP1 3′-Mut2 UTR, SMAD4 3′-Mut1 UTR, and SMAD4 3′-Mut2 UTR) significantly attenuated the reduction of luciferase activities on WT 3′-UTRs (Fig. 3 A and B), suggesting the specificity of miRNA and target 3′-UTRs. Next, we examined the effect of miR-224 on target proteins and mRNAs using overexpression and knockdown systems. Overexpression of miR-224 markedly reduced mRNA and protein expressions of TNFAIP1 and SMAD4, respectively, in H1299, H1573, and H460 cells (Fig. 3 C and D and SI Appendix, Fig. S2J). Conversely, knockdown of miR-224 increased expression of TNFAIP1 and SMAD4 mRNA and protein levels, respectively, in A549 cells (Fig. 3 E and F).

Fig. 3.

Fig. 3.

TNFAIP1 and SMAD4 are direct targets of miR-224. (A and B) Luciferase reporter constructs containing WT or mutated TNFAIP1 and SMAD4 3′-UTRs were cotransfected with miR-224 mimic into 293T cells. (C and D) Western blot and quantitative RT-PCR to measure TNFAIP1 and SMAD4 protein and mRNA levels in lung cancer cells infected with lentivirus expressing premiR-224 or control vector. (E and F) Western blot and quantitative RT-PCR to measure TNFAIP1 and SMAD4 protein and mRNA levels in lung cancer cells infected with lentivirus expressing miRZip-224 antimiR-224 or control vector. The bands were quantified using Image J software, and relative values were obtained by normalizing to the value of each corresponding vinculin. Data are presented as means ± SDs, and each assay was conducted three times. (G and H) Correlation between miR-224 and (G) TNFAIP1 or (H) SMAD4 in samples from NSCLC patients from the OSU cohort (n = 111).

TNFAIP1 and SMAD4 Play Essential Roles in the miR-224–Induced Phenotypes.

First, we examined TNFAIP1 and SMAD4 expression in lung ADC and SCC using the TCGA dataset. We assessed a total of 334 lung ADC patients with 57 matched NATs, and 349 lung SCC patients with 51 matched NATs with available gene expression data. Notably, significant decreases of both genes were observed in both lung ADC and lung SCC compared with the corresponding NATs. In lung ADC, the TNFAIP1 (P = 4.9E-15) and SMAD4 (P = 2.2E-16) expressions were dramatically reduced in primary tumor tissues (SI Appendix, Fig. S3 A and B). Similar reductions of TNFAIP1 (P = 1.8E-7) and SMAD4 (P = 6.2E-9) expression levels were also observed in lung SCC (SI Appendix, Fig. S3 C and D). We further analyzed TNFAIP1 and SMAD4 expression in an OSU cohort containing 63 NSCLC cases and 48 matched NATs. Consistent reductions of TNFAIP1 (5.23E-14) and SMAD4 (2.67E-06) in NSCLC were also observed in the OSU cohort (SI Appendix, Fig. S3 G and H). Second, we examined the correlation between miR-224 and its target genes (TNFAIP1 and SMAD4) using the OSU cohort and the TCGA dataset to understand if the miR-224–mediated TNFAIP1 and SMAD4 suppression might occur in human lung cancers. The samples (n = 111) from NSCLC patients from the OSU cohort or the TCGA lung ADC (n = 306) samples having both miR-224 and TNFAIP1 or SMAD4 expression data available were selected for Pearson correlation analysis. miR-224 showed a significant anticorrelation with both TNFAIP1 (r = −0.34, P = 0.000288 in the OSU cohort; r = −0.12, P = 0.038 in the TCGA dataset) and SMAD4 (r = −0.37, P = 6.286E-05 in the OSU cohort; r = −0.33, P = 3.2E-9 in the TCGA dataset), suggesting that reduced TNFAIP1 and SMAD4 expressions might be related to the up-regulation of miR-224 expression in lung cancer (Fig. 3 G and H and SI Appendix, Fig. S3 E and F).

To determine whether the oncogenic functions of miR-224 were attributable to direct targeting of tumor suppressors TNFAIP1 and SMAD4, we conducted several overexpression and knockdown experiments for TNFAIP1 and SMAD4, respectively. Knockdown of TNFAIP1 significantly increased migratory and proliferative ability of H460 (Fig. 4 A and B and SI Appendix, Figs. S4A and S7B) and H1299 cells (SI Appendix, Fig. S4 B–D). In addition, TNFα markedly induced TNFAIP1 expression in H1299/miRCont cells but not in H1299/miR-224 cells, indicating that miR-224 might functionally prevent TNFα signaling-mediated induction of TNFAIP1. We also observed reduced cleaved poly (ADP-ribose) polymerase 1 (PARP1) expression level in H1299/miR-224 cells compared with H1299/miRCont cells after TNFα treatment (Fig. 4C). Additional analyses showed that casp3/7 activity was significantly reduced in H1299/miR-224 cells compared with H1299/miRCont cells after TNFα treatment (SI Appendix, Fig. S4F). Accordingly, miR-224 significantly attenuated TNFα-induced cell growth inhibition in H1299 cells (Fig. 4D). These results suggest that miR-224 is involved in TNFα-induced apoptosis by targeting TNFAIP1 in lung cancer cells.

Fig. 4.

Fig. 4.

TNFAIP1 and SMAD4 play a crucial role in miR-224–induced cell growth and migration. (A) Cell migration assay for TNFAIP1 knockdown H460 cells using transwell membranes. The average counts were derived from six random microscopic fields. (B) Cell proliferation assay for TNFAIP1 knockdown H460 lung cancer cells. The cell growth rates were measured by cell counting kit 8. (C) Western blot analysis of H1299/miR-224 and H1299/miRCont cells treated with or without TNFα for 4 h. (D) Cell proliferation assay for H1299/miR-224 and H1299/miRCont cells treated with or without TNFα for 24 h. (E) Cell proliferation assay and (F) migration assay of miR-224–overexpressing cells transfected with SMAD4 or empty vector. (G) The H460/miR-224 and H460/miRCont cells were treated with or without TGF-β for 8 h. Both nuclear and cytosol proteins were extracted and subject to Western blot analysis. (H) Cell proliferation assay and (I) migration assay for H460/miR-224 and H460/miRCont cells treated with or without TGF-β. The values present means ± SDs as determined by quintuplex assays.

Next, to evaluate the function of SMAD4 on miR-224–mediated cell growth and migration in lung cancer cells, we transduced SMAD4 in stable miR-224–overexpressing lung cancer cells. Overexpression of SMAD4 dramatically abrogated miR-224–mediated promotion of cell proliferation and migration (Fig. 4 E and F and SI Appendix, Figs. S4E and S7C) in both H1299 and H1573 lung cancer cells. SMAD4 plays an essential role in the TGF-β signaling pathway, because it binds to SMAD2/3 and translocates to the nucleus upon TGF-β stimulation (17). To evaluate whether miR-224 affects TGF-β signaling by targeting SMAD4, we treated miR-224–overexpressing and control cells with TGF-β. miR-224 markedly impaired TGF-β–induced nuclear transportation of SMAD4 (Fig. 4G), and accordingly, miR-224 significantly attenuated the TGF-β–induced inhibitory effect of cell growth and migration in H460 cells (Fig. 4 H and I and SI Appendix, Fig. S7D). These results suggest that miR-224 plays a crucial role in the TGF-β signaling pathway by targeting SMAD4 in lung cancer.

CpG Island in the Promoter Region of miR-224 Is Hypomethylated in Lung Cancer.

miRNAs are an important molecule class regulating gene expression. miRNA expression is controlled by epigenetic modifications and/or transcriptional activations (25). miR-224 and miR-452 are located in intron 6 of the host gene γ-Aminobutyric Acid A Receptor (GABRE), and the GABRE promoter region has a CpG island (SI Appendix, Fig. S5A). We investigated the correlations between expressions of miR-224, miR-452, and GABRE using the TCGA dataset and found significant positive correlations between all three (SI Appendix, Fig. S5B), suggesting that these three genes might be transcriptionally coregulated under the same promoter. Next, we examined whether up-regulated miR-224 expression in NSCLC was associated with hypomethylation of its promoter region’s CpG island. We selected nine methylation probes, which were located in the CpG island of the promoter region, from the TCGA Illumina Infinium Human DNA Methylation 450,000 Bead Chip Data to evaluate miR-224 promoter methylation status. TCGA lung ADC (n = 221) samples and lung SCC (n = 125) samples containing both methylation and miR-224 expression were extracted for Pearson correlation analyses. Among nine methylation probes that were analyzed in our study, eight probes displayed significant anticorrelations with miR-224 expression in NSCLC (SI Appendix, Table S3). Anticorrelations between methylation probe cg27049053 and miR-224 expression in lung ADC (r = −0.16, P = 0.02) and lung SCC (r = −0.42, P = 1.25E-6) are shown in Fig. 5 A and B. These results suggest that promoter methylation could be involved in the repression of miR-224 transcription. To validate the results that we found in the TCGA methylation data, we conducted methylation specific-high resolution melting (MS-HRM) analysis using two cell lines (469NAT and 489NAT) from normal lung tissues and two lung cancer cell lines (A549 and H647). Comparing melting curves from each cell line (green lines in Fig. 5C) with standard melting curves (orange lines in Fig. 5C), 10–30% methylation was estimated in both 469NAT and 485NAT cells, and 0% methylation was estimated in the two lung cancer cell lines (Fig. 5C). The bisulfate sequencing results confirmed methylation levels at each CpG dyad (SI Appendix, Fig. S5C) in the cells from normal lung tissue. Expression of miR-224 in both 469NAT and 485NAT cells was increased after treatment with the demethylation reagent, 5-aza-CdR, for 3 d (Fig. 5D). We then validated reduced methylation levels in the promoter region of miR-224 after 5-aza-CdR treatment (SI Appendix, Fig. S5D). Taken together, these results suggest that hypomethylation at the miR-224 promoter-associated CpG island in NSCLC at least partially contributes to the higher miR-224 expression in lung cancer.

Fig. 5.

Fig. 5.

Correlation between miR-224 expression and its promoter region’s methylation status. (A and B) miR-224 expression from the TCGA dataset and methylation probe cg27049053 (chromosome X: 151142517) from the TCGA Illumina Infinium Human DNA Methylation 450,000 Bead Chip in (A) lung ADC and (B) SCC. (C) Methylation specific-high resolution melting (MS-HRM) analyses of the cells from normal lung tissues and lung cancer cells. (D) Quantitative RT-PCR to measure miR-224 expression in cells from normal lung tissues after treatment with 7.5 µM 5-aza-CdR. The values present means ± SDs as determined triplicated assays.

Activation of ERK Signaling Pathway Induces miR-224 Expression.

The RAS-proto-oncogene, serine/threonine kinase (RAF)-mitogen-activated protein kinase kinase (MEK)-ERK signaling pathway is aberrantly activated in many cancers (26), and considerable evidence suggests that the activated ERK signaling pathway might regulate miRNA expression (27). In our preliminary studies, we observed a trend toward RAS mutated lung cancer cell lines having higher miR-224 expression than RAS WT lung cancer cell lines, with some exceptions (SI Appendix, Fig. S6A). Analyzing 188 lung ADC patients for which both miR-224 and total ERK2 protein expressions were available in the TCGA miR-seq dataset and reverse phase protein array dataset also showed significant positive correlation between total ERK2 protein and miR-224 expression (SI Appendix, Fig. S6B). Thus, we sought to determine whether ERK signaling is involved in miR-224 induction. To investigate the role of ERK signaling on miR-224 expression, we activated ERK1/2 by phorbol 12-myristate 13-acetate (PMA) in two lung cancer cell lines, H460 and A549. The expression of miR-224 was significantly up-regulated in both lung cancer cell lines with PMA treatment compared with those without PMA treatment (Fig. 6C and SI Appendix, Fig. S6D). Enhanced pERK and c-Jun protein levels were observed in the cells with PMA treatment (Fig. 6B and SI Appendix, Fig. S6C). In addition, a luciferase construct containing an miR-224 promoter region markedly increased luciferase activity compared with the control vector, and it was more evident after treatment with PMA (Fig. 6A), indicating that miR-224 might be regulated by the ERK signaling pathway. Activated ERK1/2 phosphorylates and activates the c-Jun and c-Fos protooncoproteins, which participate to form the AP1 transcription factor. To investigate the direct involvement of c-Jun and c-Fos in the transcription of miR-224, we analyzed the promoter region of miR-224 using the PROMO 3.0 transcription factor binding site prediction server and found two predicted c-Jun binding sites but none for c-Fos in the promoter region (SI Appendix, Fig. S6E). Interestingly, knockdown of c-Jun significantly reduced luciferase activity induced by the miR-224 promoter vector (Fig. 6E). Moreover, knockdown of c-Jun resulted in reduced miR-224 expression in lung cancer cells (Fig. 6D). Taken together, these results suggest that miR-224 expression might be regulated by ERK signaling through c-Jun binding to the miR-224 promoter region in lung cancer.

Fig. 6.

Fig. 6.

miR-224 expression was controlled by ERK signaling pathway. (A) Luciferase reporter construct-containing promoter region of miR-224 and control vector were transfected into 293T cells and treated with PMA for 24 h. (B) Western blot analysis and (C) quantitative RT-PCR for H460 cells with and without PMA treatment to measure miR-224 expression. (D) Western blot analysis and quantitative RT-PCR for A549 cells with and without c-Jun knockdown to measure miR-224 expression. (E) Luciferase reporter constructs containing miR-224 promoter and control vector were cotransfected with si-Cjun into the 293T cells. (F and G) Effects of miR-224 on tumor growth in mouse model. (F) Tumor growth in nude mice s.c.-injected into flanks with H460/miR-224 or H460/miRCont. Data are presented as means ± SDs (n = 6 per group). (G) Representative photographs of the tumors at day 20 after inoculation with either the H460/miR-224 or H460/miRCont cells. (H) Proposed dysregulated miR-224 expression involved in lung cancer pathogenesis in our research. The data are presented as means ± SDs, and each assay was performed three times.

Effects of miR-224 on in Vivo Tumorigenicity.

miR-224 has been reported to be deregulated in several solid tumors, including lung cancer (28, 29). To investigate the role of miR-224 in tumor growth in vivo, H460/miR-224 and control cells or A549/miRZip224 and control cells were s.c.-injected into the flanks of nude mice. Overexpression of miR-224 in H460 cells significantly increased tumor growth in vivo compared with control cells (Fig. 6 F and G). Inversely, knockdown of miR-224 in A549 cells caused a substantial reduction in tumor volume in vivo (SI Appendix, Fig. S7E). These results clearly indicate that miR-224 functions as an oncogenic miRNA in lung cancer. In addition, we observed a microscopically visible lung metastasis in two of five mice with H460/miR-224 xenografts but none in the mice with H460/Cont xenografts (SI Appendix, Fig. S7F). Additional studies need to be done to validate this observation.

Discussion

Accumulated evidence has indicated that aberrant expression of miRNAs contributes to the pathogenesis of most human malignancies (30). A number of miRNAs functions as oncogenes or tumor suppressors in the majority of cancers. miR-224 has dual functions: either as tumor suppressor or oncogene dependent on the specific cancer tissue type. It has been reported that miR-224 was up-regulated in a number of solid tumors, including hepatocellular carcinoma (31, 32), CRC (33), and breast cancer (34), and plays an oncogenic role by targeting API5, SMAD4, PHLPP1, PHLPP2, and RKIP. Inversely, miR-224 plays a tumor-suppressive role in prostate cancer by targeting TPD52 and/or TRIB1 (35, 36).

Recent reports identify distinct biological functions of miR-224 in NSCLC and suggest a prognostic value of miR-224 in NSCLC (28, 29). Although one report suggested that high expression of miR-224 is associated with resistance to cisplatin therapy and poor prognosis, another report suggested that high expression of miR-224 is associated with favorable prognosis, clearly indicating that the role of miR-224 in the pathogenesis of lung cancer remains to be determined. In fact, our Kaplan–Meier survival analysis using the TCGA dataset showed no significant association between miR-224 expressions and NSCLC patients’ survival. Possible explanations and contributing factors for the apparently opposite results include differences in stage and treatment received and differences in the ethnic origin of the analyzed populations. Subgroup analysis indicates that the expression of miR-224 is significantly associated with poor prognosis in lung ADC patients having kras/p53 mutations, suggesting that miR-224 might be of prognostic significance in some lung cancers.

In this study, we identified that miR-224 is an oncogenic miRNA promoting lung cancer cell migration, invasion, and proliferation by direct targeting of TNFAIP1 and SMAD4, indicating an important role of miR-224 in lung cancer progression and metastasis. These findings are consistent with the results from the work by Wang et al. (28) but inconsistent with the results from the work by Zhu et al. (29), which reported that overexpression of miR-224 mimics inhibits lung cancer cell migration and proliferation. Because A549 cells have relatively high miR-224 expression, we knocked down miR-224 in A549 cells and found reduced cell migration and proliferation. Additional analysis showed that knockdown of miR-224 was involved in cell cycle arrest (SI Appendix, Fig. S7A). Wang et al. (28), using the same cell line, conducted both knockdown and overexpression experiments and observed consistent results with our study. Wang et al. (28) generated stable miR-224–overexpressing A549 cells to investigate phenotypic change of A549 cells. However, Zhu et al. (29) transiently overexpressed miR-224 mimics in A549 cells. These differences in experimental methods could be a reason for the observed discrepancy.

We evaluated TNFAIP1 expression levels in NSCLC and found that TNFAIP1 is significantly down-regulated in both lung ADC and SCC. We also observed a significant inverse correlation between miR-224 and TNFAIP1 in NSCLC. In addition, knockdown of TNFAIP1 induced the same phenotype with overexpression of miR-224 in lung cancer cells. Moreover, we found that miR-224 attenuated lung cancer cell growth inhibition induced by TNFα through targeting of TNFAIP1 and cleaved PARP1 expressions. These results suggest that TNFAIP1 has essential functions in miR-224–mediated invasion and progression in NSCLC.

SMAD4, a candidate tumor suppressor, plays an important role in mediating TGF-β superfamily (TGF-βs, activins, and bone morphogenetic proteins) signal transduction (37). Aberrant TGF-β signaling is common in human lung cancer, and loss of SMAD4 is thought to play an important role in the inactivation of TGF-β signaling (38, 39). However, the frequency of mutation and/or deletion on SMAD4 is relatively low in NSCLC (40, 41); therefore, the actual mechanism of aberrant expression of SMAD4 in NSCLC remained unclear. Given the significant up-regulation of miR-224 in NSCLC and the fact that SMAD4 is a direct target of miR-224, it is possible that loss of SMAD4 might be attributable to up-regulated miR-224 expression in NSCLC. As expected, we observed down-regulated SMAD4 expression in NSCLC compared with normal lung tissue and a significant inverse correlation between miR-224 and SMAD4 in NSCLC. Overexpression of SMAD4 in lung cancer cells significantly attenuated miR-224–induced cell proliferation and migration. We also identified that miR-224 is involved in the TGF-β signaling network by inhibiting nuclear transportation of SMAD4. Taken together, our findings suggest that miR-224–mediated reduction of TNFAIP1 and SMAD4 might contribute, at least in part, to the invasion and progression of NSCLC.

We know that miR-224 is up-regulated in a number of cancers; however, the mechanisms of its up-regulation in lung cancer are uncertain. Considering that the miR-224 promoter region has a CpG island, we speculate that promoter methylation status might be involved in miR-224 expression. To test our hypothesis, we conducted MS-HRM analyses and bisulfate sequencing and found promoter methylation in cells from normal lung tissues; however, no methylation was found in two lung cancer cell lines. Methylation probe cg27049053 from the TCGA Methylation 450,000 dataset was significantly anticorrelated with miR-224 expression in both lung ADC and SCC. In addition, treatment of the cells from normal lung tissues with 5-aza-CdR significantly restored miR-224 expression. These results suggest that up-regulated miR-224 expression in NSCLC can be, at least partially, attributed to the hypomethylation of the miR-224 promoter.

KRAS mutation is frequently seen in lung ADC (42). Given our observation that there is a trend toward RAS-mutated lung cancer cell lines having higher miR-224 expression, we sought to determine whether increased expression of miR-224 was associated with ERK signaling pathway activation status. We performed luciferase reporter assay and found that activation of ERK signaling significantly increased luciferase activity induced by miR-224 promoter vector. Interestingly, knockdown of c-Jun markedly reduced luciferase activity of the miR-224 promoter vector. In the same way, we showed that activation of ERK signaling by PMA markedly increased miR-224 expression. In addition, reduced miR-224 expression was observed in c-Jun knockdown lung cancer cells. Overall, our results suggest that c-Jun might bind to the miR-224 promoter region, subsequently regulating miR-224 expression in lung cancer cells. Knoll et al. (43) recently showed that miR-224 can also be induced by E2F1 driving epithelial mesenchymal transition through thioredoxin interacting protein down-regulation in a melanoma model. The fact that ERK signaling can activate E2F1 suggests that a possible interaction of E2F1 and c-Jun could lead to the activation of GABRE/miR-224 transcription, mediating invasion and metastasis.

To explore the relationship between ERK signaling and hypomethylation of the promoter of miR-224, we treated the cells from normal lung tissues with PMA and evaluated methylation levels of the promoter of miR-224. No changes were found with or without PMA treatment (SI Appendix, Fig. S5E), indicating that ERK signaling and hypomethylation of the miR-224 promoter might be independent. Additional studies are necessary to clarify this issue. Lastly, we investigated the effects of miR-224 on in vivo tumorigenicity using a nude mouse model. Mice harboring miR-224–overexpressing or knockdown cell lines showed significant increase or reduction in tumor size compared with control mice, respectively. Our in vivo studies strongly support the results from in vitro analyses indicating that miR-224 plays an oncogenic role in NSCLC.

NSCLC metastasis represents a very frequently encountered challenging clinical problem. Currently available tools to detect metastasis have limited sensitivity, and patients with distant metastases are generally considered incurable. Biomarker development to predict who will develop metastasis after definitive therapy and development of metastases prevention strategies for NSCLC patients are in their infancy. A better understanding of the biology of NSCLC metastasis will hopefully allow us to overcome some of these limitations in the near future. In this study, we show promoter hypomethylation and activated ERK signaling to be involved in the regulation of miR-224 expression in lung cancer. We further show the important functions of miR-224, modulating proliferation, migration, and invasion by direct targeting of TNFAIP1 and SMAD4 (Fig. 6H). Our study suggests previously unidentified therapeutic strategies for lung cancer by targeting miR-224.

Materials and Methods

Patients and Tissue Samples.

Human lung tissue microarrays [cancer (IMH-305), normal (IMH-340), and metastasized lung cancer (IMH-358)] were purchased from Novus Biologicals. Metastasized lung cancers consisted of seven cases with lymph node, two cases with bone, and one case with soft tissue metastases; 76 frozen tissue specimens from patients with lung ADC and 59 frozen tissue specimens from patients with lung SCC were obtained through the OSUCCC Tissue Procurement Shared Resource based on The Ohio State University Institutional Review Board (IRB)-approved research protocol. We obtained written informed consent from patients before sample analyses. Tissue samples were flash-frozen using liquid nitrogen within 2 h of surgical resection and stored at −80 °C until analyses.

Genome-Wide miR Sequencing and Data Analysis.

The detailed procedures are described in SI Appendix.

Quantitative Real-Time PCR and Western Blot Analysis.

Detailed procedures are described in SI Appendix.

Treatment of Cells with TNFα and/or TGF-β1.

The cells were treated with TNFα and cycloheximide at final concentrations of 20 ng/mL and 10 μg/mL, respectively. After 4 h of treatment, the proteins were extracted from cells and subject to Western blot. The cell proliferation assay was conducted after 24 h of treatment with TNFα. To evaluate caspase 3/7 activity, the H1299 cells were cultured in 96-well plates in quadruplicates and treated with TNFα at a final concentration of 15 ng/mL. After 2 h of incubation, the caspase 3/7 activities were analyzed using the Caspase-Glo 3/7 Assay Kit (Promega) according to the manufacturer’s instructions. The TGF-β1 was used to treat cells with a final concentration of 5 ng/mL. After 8 h of incubation, both nuclear and cytosol proteins were extracted from the TGF-β1–treated cells. The cell proliferation assay was conducted after 4 d of treatment with TGF-β1.

TCGA Dataset.

The TCGA miR-seq, RNA-seq data, and Infinium Human DNA Methylation 450,000 Bead Chip with clinical information were downloaded on July 31, 2013. Only log2-transformed level 3 data were used for analysis. For analysis of the TCGA dataset, the Welch t test was conducted to test if miR-224 expression is different between patients with and without cancer to account for unequal variances. For the correlation analysis between miR-224 and target gene expression/promoter methylation, Pearson correlation coefficients were calculated. We performed survival analysis using the Cox proportional hazards model to determine the prognostic value of miR-224 in the TCGA dataset.

In Situ Hybridization of miR-224.

In situ hybridization was performed using the miR-224 probe tagged with 5′ digoxigenin and locked nucleic acid-modified (Exiqon). The detailed procedures are described in SI Appendix.

Luciferase Reporter Assay.

To determine if miR-224 directly targets the 3′-UTRs of TNFAIP1 and SMAD4, 5 × 104 293T cells were seeded in 24-well plates overnight and then transfected with miR-224 mimic (Thermo Scientific) plus empty 3′-UTR vector or 3′-UTR vectors containing WT or mut–3′-UTR. After 48 h, the cells were lysed and assayed using Dual Luciferase Assay (Promega) according to the manufacturer’s instructions. To investigate the role of ERK signaling on miR-224 expression, empty vector or promoter vector containing C-jun binding sites was transfected to 293T cells. After 12 h, PMA was added with a final concentration of 100 nM and further incubated for 24 h. To study the direct involvement of C-jun on miR-224 promoter, we cotransfected C-jun siRNA pluses empty vector or promoter vector containing C-jun binding sites to the 293T cells. After 24 h, the cells were lysed and assayed using Dual Luciferase Assay (Promega) according to the manufacturer’s instructions.

Isolation of Cells from Normal Lung Tissues from Lung Cancer Patients.

The detailed procedures are described in SI Appendix.

Bisulfite Modification.

The cell line DNA was bisulfite-modified using the EZ DNA Methylation Kit (Zymo Research Corp). The dsDNA was denatured in M-Dilution Buffer for 15 min at 37 °C, and then, CT Conversion Reagent was mixed with an ssDNA sample and incubated at 50 °C overnight. After mixing with M-Binding Buffer, the DNA purification and desulphonation were performed on the Zymo-Spin IC Column. Finally, the bisulfite-modified DNA was eluted by M-Elution Buffer for methylation analysis.

High-Resolution Melting Analysis.

Methylation-specific high-resolution melting is based on PCR amplification of bisulfite-modified genomic DNA with subsequent high-resolution melting analysis of PCR amplicons. The primers were designed to amplify both methylated and unmethylated DNA. The MethPrimer (www.urogene.org/methprimer/index1.html) was used specifically for primer design in this miR-224 promoter methylation study. The primer sequences flanking methylation probe cg27049053 are cg27049053F: AAGTAAGTAATGTTAGAGTTGTTTGG and cg27049053R: ACAAACTTCAACTACTAAAAAAACC.

The Tmelt for the unmethylated sequence is 71.8 °C, and the Tmelt for the methylated sequence is 73.4 °C. The amplicon length is 184 bp. PCR amplification and high-resolution melting analyses were carried out sequentially on a CFX96 Real-Time PCR System (Biorad). High-resolution melting analyses were performed at a temperature ramping from 70 °C to 95 °C by 0.2 °C per second, and florescence acquisition was set per the manufacturer’s recommendation.

Demethylation by 5-aza-CdR.

The 469NAT and 485NAT cells were seeded on 10-cm tissue culture dishes and cultured with or without 7.5 μM 5-aza-CdR for 3 d. The medium-containing agent was replaced every 24 h. RNAs were isolated, and quantitative real-time PCR was carried out to evaluate the restoration of miR-224 expression after 5-aza-CdR treatment.

Target Analysis.

Bioinformatics analysis was performed by using these specific programs: Targetscan (www.targetscan.org), Pictar (pictar.mdc-berlin.de/), and RNAhybrid (http://bibiserv.techfak.uni-bielefeld.de/).

Animal Study.

Animal studies were performed according to OSU Institutional Animal Care and Use Committee guidelines. Stable miR-224–overexpressing H460 cells (H460/miR-224) or miR-224 knockdown A549 cells (A549/miRZip-224) were harvested by trypsin, washed with PBS, and resuspended in Matrigel:RPMI medium (1:1); 2 million H460/miR-224 and control cells or 10 million A549/miRZip-224 and corresponding control cells were s.c. injected into the flanks of nude mice. Injections were conducted in two flanks of each mouse. Tumor volumes were calculated from the length (a) and the width (b) by using the following formula: volume (millimeters3) = ab2/2. To see the role of miR-224 in metastasis in vivo, 4 million miR-224–overexpressing H460 cells or control cells were s.c. injected into the flanks of nude mice. Lung metastases were evaluated by microscope after H&E stains.

Statistical Analysis.

Statistical analyses were performed with the R Program (version 3.0.2). Data are represented as means with SDs, and statistical significance was determined with unpaired Student’s t tests unless indicated otherwise. P values less than 0.05 were considered statistically significant. Pearson correlation analysis was conducted to determine the correlation between expression of miR-224 and its target genes.

Supplementary Material

Supplementary File

Acknowledgments

We thank Dr. Sharon Palko and Dr. Dorothee Wernicke-Jameson for administrative support. We also thank The Ohio State University Comprehensive Cancer Center Microscopy, Microarray, Nucleic Acids, Flow Cytometry, Tissue Procurement Shared Resource, and Comparative Pathology Core Facility. This work was supported by a Ohio State University Comprehensive Cancer Center Grant, NIH/National Cancer Institute Grants 1U10CA180850-01 (to A.C.) and 1R01CA188500 (to A.C.), and NIH Grants U01CA166905 (to C.M.C.) and U01CA152758 (to C.M.C.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Data deposition: The data reported in this paper have been deposited in the Gene Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE64859).

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1502068112/-/DCSupplemental.

References

  • 1.Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63(1):11–30. doi: 10.3322/caac.21166. [DOI] [PubMed] [Google Scholar]
  • 2.Ginsberg RJ, Rubinstein LV. Randomized trial of lobectomy versus limited resection for T1 N0 non-small cell lung cancer. Lung Cancer Study Group. Ann Thorac Surg. 1995;60(3):615–622. doi: 10.1016/0003-4975(95)00537-u. [DOI] [PubMed] [Google Scholar]
  • 3.Timmerman R, et al. Stereotactic body radiation therapy for inoperable early stage lung cancer. JAMA. 2010;303(11):1070–1076. doi: 10.1001/jama.2010.261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chi A, et al. Systemic review of the patterns of failure following stereotactic body radiation therapy in early-stage non-small-cell lung cancer: Clinical implications. Radiother Oncol. 2010;94(1):1–11. doi: 10.1016/j.radonc.2009.12.008. [DOI] [PubMed] [Google Scholar]
  • 5.Martini N, et al. Incidence of local recurrence and second primary tumors in resected stage I lung cancer. J Thorac Cardiovasc Surg. 1995;109(1):120–129. doi: 10.1016/S0022-5223(95)70427-2. [DOI] [PubMed] [Google Scholar]
  • 6.Marwaha G, Stephans KL, Woody NM, Reddy CA, Videtic GM. Lung stereotactic body radiation therapy: Regional nodal failure is not predicted by tumor size. J Thorac Oncol. 2014;9(11):1693–1697. doi: 10.1097/JTO.0000000000000313. [DOI] [PubMed] [Google Scholar]
  • 7.Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–297. doi: 10.1016/s0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  • 8.Calin GA, et al. A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med. 2005;353(17):1793–1801. doi: 10.1056/NEJMoa050995. [DOI] [PubMed] [Google Scholar]
  • 9.Iorio MV, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer Res. 2005;65(16):7065–7070. doi: 10.1158/0008-5472.CAN-05-1783. [DOI] [PubMed] [Google Scholar]
  • 10.Yanaihara N, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell. 2006;9(3):189–198. doi: 10.1016/j.ccr.2006.01.025. [DOI] [PubMed] [Google Scholar]
  • 11.Yu SL, et al. MicroRNA signature predicts survival and relapse in lung cancer. Cancer Cell. 2008;13(1):48–57. doi: 10.1016/j.ccr.2007.12.008. [DOI] [PubMed] [Google Scholar]
  • 12.Valeri N, et al. MicroRNA-135b promotes cancer progression by acting as a downstream effector of oncogenic pathways in colon cancer. Cancer Cell. 2014;25(4):469–483. doi: 10.1016/j.ccr.2014.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Meng W, et al. MicroRNA-31 predicts the presence of lymph node metastases and survival in patients with lung adenocarcinoma. Clin Cancer Res. 2013;19(19):5423–5433. doi: 10.1158/1078-0432.CCR-13-0320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wolf FW, et al. Characterization of a novel tumor necrosis factor-alpha-induced endothelial primary response gene. J Biol Chem. 1992;267(2):1317–1326. [PubMed] [Google Scholar]
  • 15.Zhou J, et al. Cloning of two rat PDIP1 related genes and their interactions with proliferating cell nuclear antigen. J Exp Zoolog A Comp Exp Biol. 2005;303(3):227–240. doi: 10.1002/jez.a.150. [DOI] [PubMed] [Google Scholar]
  • 16.Kim DM, et al. RhoB induces apoptosis via direct interaction with TNFAIP1 in HeLa cells. Int J Cancer. 2009;125(11):2520–2527. doi: 10.1002/ijc.24617. [DOI] [PubMed] [Google Scholar]
  • 17.Lagna G, Hata A, Hemmati-Brivanlou A, Massagué J. Partnership between DPC4 and SMAD proteins in TGF-beta signalling pathways. Nature. 1996;383(6603):832–836. doi: 10.1038/383832a0. [DOI] [PubMed] [Google Scholar]
  • 18.Massagué J, Blain SW, Lo RS. TGFbeta signaling in growth control, cancer, and heritable disorders. Cell. 2000;103(2):295–309. doi: 10.1016/s0092-8674(00)00121-5. [DOI] [PubMed] [Google Scholar]
  • 19.Hahn SA, et al. DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. Science. 1996;271(5247):350–353. doi: 10.1126/science.271.5247.350. [DOI] [PubMed] [Google Scholar]
  • 20.Miyaki M, et al. Higher frequency of Smad4 gene mutation in human colorectal cancer with distant metastasis. Oncogene. 1999;18(20):3098–3103. doi: 10.1038/sj.onc.1202642. [DOI] [PubMed] [Google Scholar]
  • 21.Hirata H, et al. Oncogenic miRNA-182-5p targets Smad4 and RECK in human bladder cancer. PLoS One. 2012;7(11):e51056. doi: 10.1371/journal.pone.0051056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Liu L, et al. The oncogenic role of microRNA-130a/301a/454 in human colorectal cancer via targeting Smad4 expression. PLoS One. 2013;8(2):e55532. doi: 10.1371/journal.pone.0055532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhang X, et al. MicroRNA-373 is upregulated and targets TNFAIP1 in human gastric cancer, contributing to tumorigenesis. Oncol Lett. 2013;6(5):1427–1434. doi: 10.3892/ol.2013.1534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhou C, et al. microRNA-372 maintains oncogene characteristics by targeting TNFAIP1 and affects NFκB signaling in human gastric carcinoma cells. Int J Oncol. 2013;42(2):635–642. doi: 10.3892/ijo.2012.1737. [DOI] [PubMed] [Google Scholar]
  • 25.Di Leva G, Garofalo M, Croce CM. MicroRNAs in cancer. Annu Rev Pathol. 2014;9:287–314. doi: 10.1146/annurev-pathol-012513-104715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Roberts PJ, Der CJ. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 2007;26(22):3291–3310. doi: 10.1038/sj.onc.1210422. [DOI] [PubMed] [Google Scholar]
  • 27.Romano G, et al. MiR-494 is regulated by ERK1/2 and modulates TRAIL-induced apoptosis in non-small-cell lung cancer through BIM down-regulation. Proc Natl Acad Sci USA. 2012;109(41):16570–16575. doi: 10.1073/pnas.1207917109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang H, Zhu LJ, Yang YC, Wang ZX, Wang R. MiR-224 promotes the chemoresistance of human lung adenocarcinoma cells to cisplatin via regulating G₁/S transition and apoptosis by targeting p21(WAF1/CIP1) Br J Cancer. 2014;111(2):339–354. doi: 10.1038/bjc.2014.157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhu D, et al. Decreased microRNA-224 and its clinical significance in non-small cell lung cancer patients. Diagn Pathol. 2014;9(1):198. doi: 10.1186/s13000-014-0198-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 2009;10(10):704–714. doi: 10.1038/nrg2634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wang Y, et al. Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target. J Biol Chem. 2008;283(19):13205–13215. doi: 10.1074/jbc.M707629200. [DOI] [PubMed] [Google Scholar]
  • 32.Wang Y, et al. MicroRNA-224 targets SMAD family member 4 to promote cell proliferation and negatively influence patient survival. PLoS One. 2013;8(7):e68744. doi: 10.1371/journal.pone.0068744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Liao WT, et al. microRNA-224 promotes cell proliferation and tumor growth in human colorectal cancer by repressing PHLPP1 and PHLPP2. Clin Cancer Res. 2013;19(17):4662–4672. doi: 10.1158/1078-0432.CCR-13-0244. [DOI] [PubMed] [Google Scholar]
  • 34.Huang L, et al. MicroRNA-224 targets RKIP to control cell invasion and expression of metastasis genes in human breast cancer cells. Biochem Biophys Res Commun. 2012;425(2):127–133. doi: 10.1016/j.bbrc.2012.07.025. [DOI] [PubMed] [Google Scholar]
  • 35.Goto Y, et al. Tumour-suppressive microRNA-224 inhibits cancer cell migration and invasion via targeting oncogenic TPD52 in prostate cancer. FEBS Lett. 2014;588(10):1973–1982. doi: 10.1016/j.febslet.2014.04.020. [DOI] [PubMed] [Google Scholar]
  • 36.Lin ZY, et al. MicroRNA-224 inhibits progression of human prostate cancer by downregulating TRIB1. Int J Cancer. 2014;135(3):541–550. doi: 10.1002/ijc.28707. [DOI] [PubMed] [Google Scholar]
  • 37.Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor beta in human disease. N Engl J Med. 2000;342(18):1350–1358. doi: 10.1056/NEJM200005043421807. [DOI] [PubMed] [Google Scholar]
  • 38.Anumanthan G, et al. Restoration of TGF-beta signalling reduces tumorigenicity in human lung cancer cells. Br J Cancer. 2005;93(10):1157–1167. doi: 10.1038/sj.bjc.6602831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yanagisawa K, et al. Heterogeneities in the biological and biochemical functions of Smad2 and Smad4 mutants naturally occurring in human lung cancers. Oncogene. 2000;19(19):2305–2311. doi: 10.1038/sj.onc.1203591. [DOI] [PubMed] [Google Scholar]
  • 40.Nagatake M, et al. Somatic in vivo alterations of the DPC4 gene at 18q21 in human lung cancers. Cancer Res. 1996;56(12):2718–2720. [PubMed] [Google Scholar]
  • 41.Scarpa A, et al. Molecular typing of lung adenocarcinoma on cytological samples using a multigene next generation sequencing panel. PLoS One. 2013;8(11):e80478. doi: 10.1371/journal.pone.0080478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Prior IA, Lewis PD, Mattos C. A comprehensive survey of Ras mutations in cancer. Cancer Res. 2012;72(10):2457–2467. doi: 10.1158/0008-5472.CAN-11-2612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Knoll S, et al. E2F1 induces miR-224/452 expression to drive EMT through TXNIP downregulation. EMBO Rep. 2014;15(12):1315–1329. doi: 10.15252/embr.201439392. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES