Staphlyococcus aureus Phenol-Soluble Modulins Stimulate the Release of Proinflammatory Cytokines from Keratinocytes and Are Required for Induction of Skin Inflammation

Abstract

Staphylococcus aureus is a human commensal that colonizes the skin. While it is normally innocuous, it has strong associations with atopic dermatitis pathogenesis and has become the leading cause of skin and soft tissue infections in the United States. The factors that dictate the role of S. aureus in disease are still being determined. In this work, we utilized primary keratinocyte culture and an epidermal murine colonization model to investigate the role of S. aureus phenol-soluble modulins (PSMs) in proinflammatory cytokine release and inflammation induction. We demonstrated that many species of Staphylococcus are capable of causing release of interleukin 18 (IL-18) from keratinocytes and that S. aureus PSMs are necessary and sufficient to stimulate IL-18 release from keratinocytes independently of caspase 1. Further, after 7 days of epicutaneous exposure to wild-type S. aureus, but not S. aureus Δpsm, we saw dramatic changes in gross pathology, as well as systemic release of proinflammatory cytokines. This work demonstrates the importance of PSM peptides in S. aureus-mediated inflammatory cytokine release from keratinocytes in vitro and in vivo and further implicates PSMs as important contributors to pathogenesis.

INTRODUCTION

Staphylococcus aureus is a human commensal that lives in the nose, skin, and throat in approximately 30% of the human population (1, 2). While S. aureus is usually harmless, it is an opportunistic pathogen that has become a leading cause of nosocomial infections in the United States (3) and can manifest as skin and soft tissue infections, infective endocarditis, osteomyelitis, and sepsis (1). Further, it has a role in exacerbation of atopic dermatitis (AD), a chronic inflammatory disease of the skin that affects up to 20% of children and up to 3% of adults (4, 5). Chronic cutaneous inflammation during AD results in increased production of extracellular matrix components that permit attachment of S. aureus (6). Subsequently, S. aureus promotes AD by stimulating a strong proinflammatory response (7). S. aureus proteins, such as hemolysin α (HLA), staphylococcal protein A (SPA), and lipoteichoic acids (LTA), promote proinflammatory cytokine production from keratinocytes (7–11). However, this stimulation requires the concurrent presence of a surfactant, such as SDS (11).

Keratinocytes serve as the first line of defense against cutaneous pathogens and are able to stimulate an immune response by releasing cytokines, defensins, and antimicrobial cationic peptides, such as LL-37, to fight off pathogens (12). One cytokine that is produced by keratinocytes and has a role in promoting AD is interleukin 18 (IL-18) (13, 14). IL-18 is a proinflammatory cytokine that is cleaved and activated primarily by caspase 1 (15). Caspase 1 activation occurs following exposure to danger-associated molecular patterns (DAMPs) or pathogen-associated molecular patterns (PAMPs), which stimulate the activation of the inflammasome (16). Caspase 1 activation can also result in the activation of the proinflammatory cytokine IL-1β (17). These mature cytokines are then released from the cell and have varied effects, such as leukocyte recruitment, promotion of T and B cell activation, and upregulation of other inflammatory cytokines (18).

The phenol-soluble modulins (PSMs) of S. aureus have been shown to have many characteristics, including the ability to recruit leukocytes, lyse erythrocytes and neutrophils, act as antimicrobial peptides, modulate biofilm development, and exhibit surfactant-like properties (19–28). PSMs are small peptides ranging from 22 to 44 amino acids in length that are predicted to form amphipathic helices and in some cases can form amyloid fibers to abrogate their toxic properties and stabilize biofilms (19, 23). Several staphylococcal species have been reported to produce PSM proteins, including S. aureus, Staphylococcus epidermidis, and Staphylococcus lugdunensis (19, 29, 30).

Here, we set out to investigate staphylococcal factors that contribute to the release of proinflammatory cytokines from keratinocytes. We found that some, but not all, species of staphylococci examined produce compounds that are able to cause the lytic release of active IL-18 from human keratinocytes independently of caspase 1 activation. We also showed that PSMs are necessary and sufficient for this release. Further, we utilized a mouse model of cutaneous colonization (31) to demonstrate that neutrophil recruitment and systemic inflammatory response are dependent on S. aureus PSMs.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

The bacteria used in this study are summarized in Table 1. S. aureus strain LAC (32) was used as the wild-type (WT) strain for the study. To create a Δpsm deletion strain, the PSMα and PSMβ operons were deleted using allelic replacement, as previously described (23), and the start codon of δ-toxin was mutated to prevent translation without affecting the function of RNAIII, as was done previously (19). Genetic complementation of the PSMα and PSMβ operons in the Δpsm strain was done as previously described using pALC2073-PSMα and pRS-PSMβ (23). Bacterial supernatants were collected after 24 h of growth in tryptic soy broth (TSB) (MP Biosciences, Santa Ana, CA) at 37°C with orbital shaking at 200 rpm. The cells were centrifuged at 7,000 × g for 10 min, followed by filter sterilization of the supernatants through 0.22-μm filters. The supernatants were stored at −20°C until use. Bacteria used for colonization were grown overnight in TSB at 37°C with orbital shaking at 200 rpm. Before use, they were diluted 1:500 in fresh TSB and grown for 4 h to obtain cells in the exponential growth phase. The cells were resuspended in phosphate-buffered saline (PBS) (Gibco, Grand Island, NY) prior to use.

TABLE 1.

Bacterial strains used in this study

Strain	Description or species	Source or reference
S. aureus
AH1181	LAC hla::erm	This study
AH1263	LAC (WT)	32
AH1292	LAC agr::tet	47
BB3047	LAC Δpsm; pALC2073 and pAH8	This study, 23
BB3048	LAC Δpsm; pALC2073-PSMα and pRS-PSMβ	This study, 23
Other staphylococci
BB2153	S. saprophyticus	This study
BB2164	S. epidermidis	This study
BB2191	S. lugdunensis	This study
BB2201	S. warneri	This study
BB2203	S. hominis	This study
BB2205	S. haemolyticus	This study
BB2207	S. capitis	This study

Peptides.

PSM peptides were synthesized by LifeTein (South Plainfield, NJ) and assayed to be >90% pure by high-performance liquid chromatography (HPLC). Synthetic peptides were prepared as previously described (33). Briefly, the peptides were resuspended in hexafluoroisopropanol (HFIP), and 0.5 mg was aliquoted into microcentrifuge tubes. The HFIP was then removed using a SpeedVac system at room temperature. The dried peptides were stored at −20°C. Immediately before use, the peptides were suspended in PBS to a concentration of 10 mg/ml and then diluted further in PBS to the desired concentration. LL-37 was purchased from AnaSpec Inc. (Fremont, CA).

Cell culture.

Primary human keratinocyte cultures were obtained from Johann Gudjonsson, University of Michigan. The cells were cultured in EpiLife medium (Gibco) supplemented with human keratinocyte growth supplement (Gibco), 1% Pen-Strep (100 U/ml penicillin and 100 μg/ml streptomycin; Gibco), and 0.25 μg/ml amphotericin B (Fungizone; Gibco). For all experiments, cells were used at passages 2 to 6, and 2 × 10⁴ cells/well were plated in 24-well plates.

Cells were exposed to bacterial supernatants or peptides at confluence. The cells were pretreated for 30 min with 10 μM caspase inhibitors (Enzo) where indicated prior to addition of the indicated concentrations of bacterial supernatants or peptides. The cells were treated for 1 h prior to harvesting. The extracellular medium was removed after 1 h, and the remaining cells were lysed using RIPA buffer (300 mM NaCl, 50 mM Tris, 6.4 mM EDTA, 0.5% Triton X-100) containing protease inhibitor cocktail (Complete Mini, EDTA free; Roche, South San Francisco, CA) by incubation for 10 min on ice. The cell debris was removed by centrifugation at 13,000 × g for 5 min, and the lysates were frozen at −20°C until use.

For caspase 1 activation studies, keratinocytes were plated at 1 × 10⁴ cells/well of a 96-well plate. The following day, the cells were exposed to S. aureus supernatants for 1 h, followed by addition of fluorescein isothiocyanate (FITC)-conjugated YVAD (ImmunoChemistry Technologies) for 1 h, and processed according to the manufacturer's recommendations. The cells were counterstained with DAPI (4′,6-diamidino-2-phenylindole) before fixation. Images of active caspase 1 were acquired on an Olympus IX70 inverted microscope (Olympus, Center Valley, PA) using a 40× objective at the Center for Live Cell Imaging (CLCI) at the University of Michigan Medical School.

To control for caspase inhibitor effectiveness, human peripheral blood mononuclear cells (PBMCs) were isolated via Ficoll gradient. The cells were plated at 1 × 10⁶ per well of a 12-well plate; 10 μM YVAD or ZVAD was added 30 min prior to stimulation with 1 μg/ml lipopolysaccharide (LPS) for 24 h. The medium was collected, and IL-1β release was measured via enzyme-linked immunosorbent assay (ELISA).

Mice.

All animal studies were performed according to protocols approved by the University of Michigan Committee on the Use and Care of Animals, protocol 01823. The animals were obtained from Jackson Laboratory and housed at the University of Michigan in specific-pathogen-free housing, followed by biohazard containment after treatment with bacterial strains. To test the effects of exposure to WT S. aureus versus S. aureus Δpsm, the dorsal skin of 8- to 10-week-old C57BL/6 female mice was shaved and depilated with Veet (Reckitt Benckiser Group plc). The next day, the stratum corneum barrier was disrupted via mild stripping using three applications of Tegaderm (3M, St. Paul, MN). This technique exposes the keratinocyte layers without creating a wound (31). S. aureus (1 × 10⁷ CFU) or PBS was placed with sterile gauze on the stripped skin and occluded with Tegaderm (3M). One week after S. aureus exposure, the animals were euthanized. Serum was collected via cardiac puncture, and skin was removed for cell count analysis via flow cytometry (see below) and RNA analysis.

Cytokine production.

In vitro quantification of IL-18 and IL-1β was done by ELISA (eBioscience, Vienna, Austria) according to the manufacturer's instructions. Active IL-18 release was assessed via Western blotting (primary antibody, rabbit anti-human IL-18 [Santa Cruz]; secondary antibody, goat anti-rabbit-horseradish peroxidase [HRP] [Abcam]). To investigate changes in the serum cytokine profiles of mice exposed to S. aureus, a Milliplex (EMD Millipore, Darmstadt, Germany) assay was performed.

Cytotoxicity.

To test for cell lysis following peptide treatments of keratinocytes, release of lactate dehydrogenase (LDH) was measured using a CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega, Madison, WI) according to the manufacturer's instructions.

Flow cytometry.

Lymphocytes were isolated from skin biopsy specimens as follows. Immediately after euthanasia, skin samples were removed, diced into 1- to 2-mm pieces using sterile razor blades, and then placed into a GentleMacs C Tube with 10 ml RPMI-10 (RPMI plus 10% fetal bovine serum) with 2 ml enzyme solution (100 mg/ml DNase type I [Sigma; DN-25], 100 mg/ml hyaluronidase type V [Sigma; H6254], 500 mg/ml collagenase [Sigma; C5138] in Hanks balanced salt solution [HBSS]). GentleMacs tissue dissociation was performed for 1 min, followed by 2 h of incubation at 37°C. After incubation, dissociation was repeated for 1 min. The cells were strained and pelleted by centrifugation at 800 × g for 7 min at 4°C. The supernatant was discarded, and the cells were washed once with 15 ml RPMI-10. After washing, the cells were divided into tubes for fluorescence-activated cell sorter (FACS) analysis. To quantify the inflammatory cellular infiltrate following S. aureus exposure, purified cells were stained for 1 h on ice with the following antibodies (all from BioLegend, San Diego, CA): CD19-phycoerythrin (PE)-Cy7, CD3-allophycocyanin (APC), CD4-FITC, CD8-PE, Ly6G-FITC, F4/80 Pacific Blue, CD11b-APC, CD11c-PE-Cy7, CD11c-PE, and Ly6C-PE-Cy7. Flow data were collected on a BD LSR II and analyzed with FlowJo V10 (Tree Star).

RT-PCR.

Skin biopsy specimens were homogenized in TriPure (Roche), and RNA was isolated with Direct-zol mini RNA prep (Zymo). RNA (100 ng) was transcribed into cDNA, and real-time (RT) PCR analysis was completed on an ABI Prism 7900HT (Applied Biosystems) using Sybr green (Life Technologies) (Table 2 lists the primers). Cycle times were normalized to β-actin, and the fold change (2^−ΔΔCT) was calculated versus PBS-exposed mice.

TABLE 2.

Primers used for real-time PCR

Gene	Primer (5′→3′)
	Forward	Reverse
IFN-α	ATGGCTAGRCTCTGTGCTTTCCT	AGGGCTCTCCAGAYTTCTGCTCTG
IFN-β	AGCTCCAAGAAAGGACGAACAT	ATTCTTGCTTCGGCAGTTAC
IFN-γ	AGCGGCTGACTGAACTCAGATTGTA	GTCACAGTTTTCAGCTGTATAGGG
IL-18	ACTGTACAACCGCAGTAATACGC	AGTGAACATTACAGATTTATCCC
IL-1β	CCCTGCAGCTGGAGAGTGTGGA	CTGAGCGACCTGTCTTGGCCG
IL-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
IL-1α	CGGGTGACAGTATCAGCAAC	GACAAACTTCTGCCTGACGA
TNF-α	CCCACTCTGACCCCTTTACT	TTTGAGTCCTTGATGGTGGT
CAMP	TCAACCAGCAGTCCCTAGAC	AAGGCACATTGCTCAGGTAG
NLRP3	ATGCTGCTTCGACATCTCCT	AACCAATGCGAGATCCTGAC
Chemokine (C-C motif) receptor 1 (CCR1)	TGGGCAATGTCCTAGTGATT	GCATCACCAAAAATCCAGTC
CCL4	AGCAACACCATGAAGCTCTG	CTGTCTGCCTCTTTTGGTCA
CCL5	CAATCTTGCAGTCGTGTTTG	GGAGTGGGAGTAGGGGATTA
C-X-C motif chemokine 10 (CXCL10)	CAAAAGTAACTGCCGAAGCA	CTGAGCTAGGGAGGACAAGG
CXCL13	AGAGGTTTGCGAGATGGACT	GAGCCTGGACCTTTAAGCTG
β-Actin	TGGAATCCTGTGGCATCCTGAAAC	TAAAACGCAGCTCAGTAACAGTCCG

Statistical analysis.

Statistical analysis was performed using GraphPad Prism 6 software. Comparisons between data were made via 2-sided Student unpaired t tests or Mann-Whitney U tests for nonnormalized data. A P value of <0.05 was considered significant.

RESULTS

Some staphylococci produce cytotoxic factors that affect human keratinocytes.

To investigate the effects that secreted factors from different staphylococci have on human keratinocytes, we exposed human keratinocytes to bacterial supernatants. The keratinocytes were monitored for the release of IL-18 because of its constitutive production in keratinocytes and its proinflammatory activity in the skin (11). We found that supernatants from several staphylococcal species, including S. aureus, S. lugdunensis, S. epidermidis, Staphylococcus capitis, Staphylococcus warneri, and, to a lesser extent but still significantly, Staphylococcus hominis, were able to trigger the release of IL-18 from keratinocytes (Fig. 1A). Supernatants from Staphylococcus saprophyticus and Staphylococcus haemolyticus did not induce release of IL-18 (Fig. 1A). Importantly, release of LDH, a marker of cell lysis, aligned with IL-18 release from the cells, with the exception of S. hominis, which showed no significant increase in LDH release (Fig. 1B).

FIG 1.

Various staphylococcal species induce lytic release of IL-18 from human keratinocytes. (A and B) Human keratinocytes were exposed to supernatants from several Staphylococcus species and tested for release of IL-18 (A) and LDH (B). (C to E) Human keratinocytes were also exposed to supernatants from several strains of S. aureus and tested for the release of IL-18 (C), LDH (D), and IL-1β (E). ****, P < 0.0001; **, P < 0.01; *, P < 0.05; n = 2 in duplicate for each study. The error bars represent standard errors of the mean.

S. aureus phenol-soluble modulins induce IL-18, IL-1β, and LDH release from human keratinocytes.

Because of its prominent role in skin infections and AD, we chose to focus the rest of our study on S. aureus. Using a candidate approach, we found that the quorum-sensing system in S. aureus known as the accessory gene regulator (agr) was necessary for cytotoxicity and IL-18 and IL-1β release (Fig. 1C, D, and E). Because the agr system is known to regulate the expression of many virulence factors produced by S. aureus, we investigated mutants for two well-studied cytotoxic factors: HLA and the PSM family. S. aureus supernatants lacking PSMs (PSMα [PSMα1 to -4], PSMβ [PSMβ1 and -2], and δ-toxin) (ΔPSM) showed a significant decrease in the ability to stimulate the release of IL-18, IL-1β, and LDH from keratinocytes, and the release was restored when the strains were complemented with PSMα and PSMβ operons (Fig. 1C, D, and E). Notably, lack of HLA, which has been reported to lyse human cells and activate the inflammasome (34), did not impact the release of IL-18, LDH, or IL-1β compared to our WT S. aureus supernatant (Fig. 1C, D, and E). These data suggest that PSMs are the primary S. aureus factors that induce lysis of keratinocytes.

To further investigate which PSMs contribute to IL-18 release and keratinocyte lysis, synthetic PSMs were used. PSM peptides were sufficient to stimulate the release of IL-18 from keratinocytes (Fig. 2A). Interestingly, all of the PSMα peptides, as well as δ-toxin, but neither of the PSMβ peptides, induced release of LDH from the keratinocytes (Fig. 2B). As PSMs are thought to have a helical structure similar to that of the known lytic antimicrobial peptide LL-37 (reviewed in reference 35), we also compared the dose response of the ability of PSMα1 to induce IL-18 release to that of LL-37. As shown in Fig. 2C, both peptides induced IL-18 release at 5 μg/ml, but LL-37 appears to be more potent. Taken together, these data demonstrate that the PSM peptides of S. aureus are necessary and sufficient for the release of IL-18, likely through lytic release from human keratinocytes.

FIG 2.

S. aureus PSMs are sufficient for lytic release of IL-18 from human keratinocytes. (A and B) Human keratinocytes were exposed to synthetic PSM peptides and tested for release of IL-18 (A) and LDH (B). (C) PSMs induce release of IL-18 in a dose-dependent mechanism similar to that of LL-37. ****, P < 0.0001; ***, P < 0.001; **, P < 0.01; *, P < 0.05; n = 3 in duplicate for each study. The error bars represent standard errors of the mean.

The release of mature IL-18 is independent of caspase activity.

Several S. aureus toxins have been reported to activate the inflammasome, so we next investigated whether inflammasome activation participated in the release of IL-18 from keratinocytes following S. aureus exposure (36). As shown in Fig. 3A, we confirmed that stimulation of keratinocytes with WT S. aureus supernatant resulted in detectable active caspase 1 within the keratinocytes. Western blotting confirmed that the IL-18 released was in its active form (Fig. 3B). To see if caspase 1 activation was required for the release of IL-18 or IL-1β, we pretreated primary keratinocytes with various cell-permeable caspase inhibitors, followed by stimulation with WT S. aureus supernatant. Inhibition of caspase 1 (YVAD), caspase 3 (DEVD), caspase 5 (WEHD), caspase 6 (VEID), caspase 8 (IEHD), or all caspases (ZVAD) did not impact S. aureus-induced lytic cytokine release (Fig. 3C, D, and F). However, identical concentrations of YVAD and ZVAD repressed inflammasome activation induced by LPS in PBMCs (Fig. 3E). Elevated extracellular potassium, another condition that inhibits NLR family, pyrin domain containing 3 (NLRP3) inflammasome activation, did not inhibit S. aureus-mediated cytokine release (data not shown). These data suggest that release of active IL-18 by PSMs is specific to disruption of cell membranes and is not due to specific activation of the inflammasome.

FIG 3.

The release of mature IL-18 from human keratinocytes in response to S. aureus is independent of caspase 1 function. (A) Human keratinocytes were exposed to TSB or WT S. aureus supernatants for 1 h, followed by addition of a fluorescence-labeled peptide that binds active caspase 1 and visualized by fluorescence microscopy (n = 3). (B) Representative Western blotting for full-length, or “pro,” form and active, cleaved IL-18 released into the extracellular media (ECM) from keratinocytes exposed to TSB or WT supernatants. Recombinant active IL-18 (rIL-18) was run as a positive control. (C, D, and F) Dimethyl sulfoxide (DMSO) or caspase inhibitors (10 mM) were added to human keratinocytes prior to treatment with S. aureus supernatants and then testing for the release of IL-18 (n = 3) (C), IL-1β (n = 3) (D), and LDH (n = 1) (F). (E) Human PBMCs were incubated with 10 mM YVAD or ZVAD for 30 min prior to overnight incubation with 1 mg/ml LPS. Released IL-1β was detected via ELISA. The error bars represent standard errors of the mean. **, P < 0.01; ****, P < 0.0001.

Phenol-soluble modulins are required for neutrophil infiltration following epidermal S. aureus exposure.

Given that PSMs induce lysis of and inflammatory cytokine release from keratinocytes, we hypothesized that they may be required for initiation of inflammation in response to cutaneous colonization by S. aureus. We thus challenged mice epicutaneously with the WT or Δpsm strain of S. aureus. As shown in Fig. 4A, application of WT S. aureus to the surface of the skin resulted in infectious changes, including erythema and ulceration, whereas the Δpsm strain produced minimal skin changes. Flow cytometry of the colonized skin demonstrated a significant decrease in neutrophil infiltration of the skin in the WT compared to the Δpsm strain. Other cell types, including macrophages, dendritic cells (DC), B-cells, and T cells, were not significantly altered following S. aureus exposure (Fig. 4B). Using C57BL/6 IL-18^−/− mice, we found that IL-18 was not required for S. aureus-induced neutrophil infiltration into the skin (Fig. 4C). Absence of IL-18 enhanced macrophage, CD11b⁺ DC, and CD4⁺ T cell migration, suggesting that keratinocyte release of IL-18 may have repressive effects on chronic inflammation (Fig. 4C). These data suggest that PSMs are required for invasive infection when S. aureus is exposed to intact keratinocyte layers via epicutaneous application and that IL-18 is not required for this process.

FIG 4.

PSMs are critical for the recruitment of neutrophils into the skin during S. aureus epidermal exposure. (A) Representative photographs of dorsal surfaces from mice taken after 7 days of exposure. (B) FACS analysis of leukocytes obtained from skin samples from mice 7 days postinoculation with S. aureus. *, P < 0.05; n = 8 for each group. (C) FACS analysis of skin leukocytes from WT or IL-18 knockout (KO) mice exposed (n = 5) to WT S. aureus, as in panel B. Neutrophils, Ly6G⁺; macrophages, F4/80⁺ CD11b⁺; dendritic cells, Ly6c⁺ CD11c⁺; T cells, CD3⁺; B cells, CD19⁺. The error bars represent standard errors of the mean. ***, P < 0.001; ****, P < 0.0001.

Others have demonstrated that epicutaneous application of S. aureus results in upregulation of proinflammatory cytokines (31). In order to determine whether PSMs play a role in modulating inflammatory gene expression in the skin, we performed RT-PCR on skin sections following exposure to the WT or Δpsm strain. As shown in Fig. 5A, both the WT and Δpsm strains were able to dramatically upregulate proinflammatory genes within the skin, including alpha interferon (IFN-α), IFN-γ, IL-18, IL-1β, tumor necrosis factor alpha (TNF-α), and IL-6, compared to skin exposed to PBS. Both were also able to upregulate the antimicrobial peptide cathelicidin antimicrobial peptide (CAMP), the murine LL-37 ortholog. Chemokines, such as chemokine (C-C motif) ligand 4 (CCL4), were also upregulated by both strains. Given that the skin phenotype following exposure to the WT versus the Δpsm strain was so dramatically different, we then chose to examine systemic cytokine concentrations in mice exposed to both strains. As shown in Fig. 5B and Table 3, the concentrations of inflammatory cytokines, including granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-1β, IL-6, and IL-17, in serum are significantly diminished in Δpsm strain-exposed compared to WT-exposed mice. Together, these data suggest that PSMs are not required to stimulate inflammatory gene upregulation but are required to initiate release of proinflammatory cytokines into circulation and to permit the subsequent inflammatory response.

FIG 5.

Systemic inflammatory response, but not inflammatory gene upregulation, requires S. aureus PSMs. (A) Fold changes (FC) in the cutaneous expression of the listed genes compared to PBS-exposed mice as calculated by real-time PCR. (B) Concentrations of the indicated cytokines in serum as determined by Milliplex in WT S. aureus-exposed versus S. aureus Δpsm-exposed mice. **, P < 0.01; ***, P < 0.001; n = 8 for each group. The error bars represent standard errors of the mean.

TABLE 3.

Cytokine concentrations from mice exposed to WT S. aureus, S. aureus Δpsm, or vehicle control (PBS)

Cytokine	Concn (pg/ml) after exposure to:			Significant difference between WT S. aureus- and S. aureus Δpsm-exposed mice (P value)
	WT S. aureus	S. aureus Δpsm	PBS
G-CSF	3443.4	287.9	434.1	Yes (0.0011)
GM-CSF	34.5	12.1	14.8	Yes (0.00540)
IFNγ	2.5	2.0	2.1	No (0.2000)
IL-1α	249.6	266.4	275.4	No (0.0827)
IL-1β	16.6	7.9	22.7	Yes (0.0009)
IL-2	3.6	2.7	3.7	Yes (0.0256)
IL-4	3.0	3.0	3.4	No (1.0000)
IL-5	8.4	5.6	17.8	No (0.2887)
IL-6	71.6	9.0	23.5	Yes (0.0070)
IL-7	3.4	1.0	18.5	Yes (0.0002)
IL-10	3.8	2.1	3.0	Yes (0.0020)
IL-12p40	4.9	3.7	3.5	No (0.2822)
IL-12p70	10.2	3.7	13.0	Yes (0.00480)
IL-13	84.7	45.7	58.7	Yes (0.0047)
IL-15	6.8	2.5	2.5	Yes (0.0256)
IL-17	11.7	3.0	3.3	Yes (0.00280)
IL-18	193.8	201.1	190.9	No (0.769)
IP-10	142.7	101.9	80.4	Yes (0.0379)
KC	116.3	81.5	104.1	No (0.3754)
MCP-1	63.9	25.4	24.4	No (0.0692)
MIP-1a	39.5	13.6	19.5	Yes (0.0006)
MIP-1b	18.7	9.0	13.1	No (0.2124)
MIP-2	88.0	75.1	60.4	No (0.3958)
RANTES	14.9	9.4	7.1	No (0.2247)
TNF-α	5.2	3.4	3.6	No (0.0816)

DISCUSSION

S. aureus colonization is known to be highly prevalent in the U.S. population and also contributes to chronic skin conditions, such as AD. In this paper, we demonstrate that the PSMα family members, including δ-toxin, are necessary and sufficient for lytic activity on keratinocytes, which results in the release of inflammatory cytokines, such as IL-18 and IL-1β (Fig. 1 and 2). Additionally, we demonstrate that PSMs, while not required for transcriptional upregulation of proinflammatory genes within the skin, are required for instigation of skin inflammation and systemic cytokine changes in an epicutaneous colonization model (Fig. 4 and 5).

Several groups have investigated mechanisms by which S. aureus can elicit an immune response from keratinocytes; however, these factors have required the use of surfactants to promote membrane permeability (11). Our data presented here demonstrate that keratinocyte-mediated inflammation can be stimulated by S. aureus PSMs alone. Because of their amphipathic nature, PSMs have surfactant-like properties that allow membrane intercalation and pore formation, similar to the human cathelicidin LL-37 (Fig. 2C) (21). Interestingly, not all species of staphylococci induce keratinocyte lysis (Fig. 1). We observed strong lytic abilities in species known to contain PSMs, including S. aureus, S. epidermidis, and S. lugdunensis, but there has been no study, to our knowledge, investigating the presence of PSMs in other staphylococcal species. Further investigation of S. hominis, which is able to induce release of IL-18 without inducing cell lysis, will be of interest. Additionally, the PSMβ peptides were able to induce the release of IL-18 from human keratinocytes without causing a release of LDH (Fig. 2). It is possible that the PSMβ peptides are able to activate a receptor-mediated cytokine release or possibly trigger slow, nonlytic inflammasome activation.

Keratinocyte activation and release of IL-18 and IL-1β by caspase 1 as part of an active inflammasome have been reported (37). Additionally, an inflammasome-independent role for caspase 1 in apoptosis of keratinocytes has been described (38). Interestingly, in the presence of S. aureus supernatants, we detected activation of caspase 1, but this activation is not required for IL-18 release. This suggests that PSMs are promoting cytokine release via lysis (Fig. 3) and that other enzymes, such as cathepsin activation or granzyme B, may be important for IL-18 activation in keratinocytes (39). This PSM-induced IL-18 release may resolve the contradiction between the role of increased IL-18 signaling in atopic dermatitis and recent data that describe repressed inflammasome activity in AD (40, 41). Chronic colonization with PSM-producing S. aureus may circumvent the need for inflammasome-mediated IL-18 release.

In our epicutaneous model of S. aureus exposure, we found that absence of IL-18 did not impact neutrophil recruitment but enhanced chronic inflammatory cell infiltration. This is an interesting finding, as the actual function of IL-18 in the skin has not been systematically investigated. Many studies examining the role of IL-18 in cutaneous disease report up- or downregulation of the cytokine without reporting the consequence of these changes (42). Our data suggest that following S. aureus exposure, IL-18 may function to modulate the acute versus chronic inflammatory response. Given that absence of IL-18 promoted a large increase in CD4⁺ T cells in our study, further investigation into the Th1 versus Th2 skewing of these populations is warranted. Additionally, determining whether the effects of IL-18 are different in AD models exposed to S. aureus is an important area for future research.

PSMs produced by S. aureus have been shown to be critical determinants of pathogenesis in murine models of abscess and bacteremia (19). They are recognized by the human formyl peptide receptor 2, which stimulates neutrophil chemotaxis (24). Not only can PSMs recruit neutrophils, but they have been shown to intercalate into cell membranes, resulting in lysis and death (19). In our in vivo model, transcriptional changes of cytokines in the dermis in our mice did not differ between mice exposed to WT S. aureus and mice exposed to S. aureus Δpsm (Fig. 5A). This likely reflects intact Toll-like receptor (TLR) ligands, such as peptidoglycan, present on each strain. Keratinocytes express TLR2, which results in robust inflammatory gene upregulation after exposure to peptidoglycan (43). Thus, it is not surprising to see robust gene expression changes in the skin after exposure to the WT and Δpsm strains. Importantly, however, while a robust systemic inflammatory response was noted with WT S. aureus, the circulating concentrations of inflammatory cytokines were dramatically and significantly reduced after exposure to S. aureus Δpsm (Fig. 5B). The large difference in G-CSF agrees with previously reported effects of one of the PSMs, δ-toxin, on mast cell degranulation and G-CSF release (44). Differences in circulating IL-6 and IL-1β, both of which are released from keratinocytes, were also noted (Fig. 3) (37, 45). Systemic levels of IL-18 were not altered after S. aureus exposure (Table 3), but this does not rule out important localized effects, as other cytokines important in AD have been noted to be increased in the skin but not in serum (46). Taken together with our in vitro data, which demonstrate PSM-mediated release of IL-18 and IL-1β from keratinocytes (Fig. 1C and E and 5B), these results suggest that PSM-mediated keratinocyte lysis may be a required factor to convert S. aureus colonization into infection.

In summary, we have described a novel role for staphylococcal PSMs, which induce keratinocyte lysis and release of inflammatory cytokines. This translates into a role of PSMs in infection and the systemic inflammatory response in vivo. We propose that PSMs are important for initiating pathogenesis after colonization and may serve as important targets for treating infection or modulating inflammatory cutaneous disease.