The Homologous Regions of Spodoptera litura (Lepidoptera: Noctuidae) Nucleopolyhedrovirus II Have Both the Function as Origin of DNA Replication and Enhancer

Abstract

In the genome sequence of the Spodoptera litura nucleopolyhedrovirus II (SpltNPVII), seven homologous regions (hrs), Sphr1-7, were identified. Each of them composed of three to eight 64-bp highly conserved sequences, and each contained a 24-bp imperfect palindrome. A transient expression assay demonstrated that the expression of SpltNPVII-ie1 promoter-driven luciferase gene was enhanced between 3- and 13-fold by infection of SpltNPVII in Spli221 cells. Real-time polymerase chain reaction confirmed each of seven hrs could function as origin (ori) of viral DNA replication. This suggests that these hrs are bifunctional, having both ori and enhancer activities for transcription. In addition, the potential of seven hrs as origins had a significantly positive correlation with the number of their palindromes (r = 0.847, Sig: 0.016 < 0.05), and enhancer efficiency had a significantly positive correlation with the number of characteristic motifs (r = 0.893, Sig: 0.007 < 0.01). The efficiency of replication and enhancement of each hr both increased with increasing total numbers of palindromes, repeat sequences, and characteristic motifs. In addition, a single 64-bp highly conserved consensus sequence cannot very good support to the function as origin and enhancer, and require the assistance of other cis-elements in hrs.

Baculoviruses comprise a family of invertebrate viruses with large circular, double-stranded, covalently closed, supercoiled DNA genomes ranging in size from 80 to over 188 kb, depending on the viral species (Hilton and Winstanley 2007, Ferrelli et al. 2012). There are four genera of baculoviruses, including Alphabaculovirus (lepidopteran-specific nucleopolyhedrovirus [NPV]), Betabaculovirus (lepidopteran-specific Granuloviruses), Gammabaculovirus (hymenopteran-specific NPV), and Deltabaculovirus (dipteran-specific NPV) (Jehle et al. 2006). A unique characteristic of almost all baculovirus genomes studied to date is the presence of homologous repeat regions (hrs), the first described being hr3 of Autographa californica multiple NPV (AcMNPV) (Cochran and Faulkner 1983). These sequences typically contain many AT-rich regions, one or more copies of an imperfect palindrome sequence, some repeat sequences, and other motifs located in several positions on the genome. Within AcMNPV, nine homologous regions contain two to eight repeats centered around EcoRI sites (Viswanathan et al. 2003). These function as origins of replication when cloned into plasmids and transfected into infected insect cells and as enhancers of early gene transcription (Olson et al. 2003).

Besides those that function as origins of replication of baculoviruses, another type, non-hr oris, may be involved in genome replication (Kool et al. 1994a). They contain AT-rich regions, direct repeats, and hr-unrelated palindromes. Only one non-hr ori was found in the AcMNPV genome, and it showed some distant structural homology to consensus eukaryotic oris (DePamphilis 1993, Lee and Krell 1994). Surprisingly, the p143-3.2a ori of AcMNPV was found to function as an efficient ori in mammalian cells without the need for any viral proteins (Wu et al. 2014). Non-hr oris have also been identified in the genomes of Orgyia pseudotsugata MNPV (OpMNPV) and Spodoptera exigua MNPV (SeMNPV) (Pearson et al. 1993, Heldens et al. 1997). Unlike hrs, the non-hr oris of AcMNPV, OpMNPV, and SeMNPV are more complex and unique. Data on the functional role of non-hr oris come from analysis of defective viruses (AcMNPV) isolated after serial passage, in which non-hr sequences seem to accumulate (Lee and Krell 1994, Pijlman et al. 2003) and deletion of an SspI fragment of SeMNPV, which is an essential element of non-hr oris (Heldens et al. 1997).

Baculovirus immediate early gene 1 (ie-1), one of six genes required for DNA replication in transient replication assays, encodes a 67-kDa nuclear protein (IE1) that plays crucial roles in viral replication (Kool et al. 1994b, Friesen 1997). Transcription of ie-1, together with other promoters, is activated by baculovirus homologous regions (Lin et al. 2010). Thus baculovirus immediate early gene promoters have been proven useful for transient or continuous expression in a multitude of lepidopteran and dipteran cell lines (Jarvis et al. 1996, Pfeifer et al. 1997). In previous work, IE-1, the only early factor of Bombyx mori nuclear polyhedrosis virus (BmNPV) mediates hr enhancer function in trans (Lin et al. 2010).

The Spodoptera litura NPV II belongs to Alphabaculovirus of baculoviruses (GenBank ID: EU780426.1). The presence of putative origins in the SpltNPVII genome has been determined. In this article, the putative origins of replication of SpltNPVII are characterized for the first time, using a cell line permissive to SpltNPVII infection. We investigated all seven hr regions that can function as ori in an infection-dependent replication assay. A real-time polymerase chain reaction (PCR) method was used to allow for the quantification and comparison of plasmids containing different hr sequences. The results indicated that all hrs can serve as origins of SpltNPVII DNA replication. We also demonstrated that SpltNPVII hrs can enhance the activity of the SpltNPVII ie-1 gene promoter with or without viral infection. This suggests that all hrs in SpltNPVII are bifunctional, serving as origins of replication and as enhancers of transcription.

Materials and Methods

Viruses and Cells

SpltNPVII strain (Kupriianova et al. 2002) and the cell line TUAT-Spli221 (Spli) (Mitsuhashi 1995) were gifts from Professor Zhu Jiang (Medical College of Soochow University). The cell line was continuously propagated in TC-100 insect medium (AppliChem, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) at 27°C. The details of cell culture methods were as described previously (Summers and Smith 1987).

Bioinformatics Analysis

SpltNPVII homologous regions were surveyed and analyzed using the Genetyx-win software package (parameters: minimum length 20, maximum length 160, and over 75% matching) and compared with genomes of closely related viruses using the nblast (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and Genetyx software. Correlation analysis was carried out using Statistical Product and Service Solutions (SPSS Inc., Chicago, IL).

Plasmid Construction

Using SpltNPVII DNA as template, the intact fragments (hr2: 810, hr3: 1,113, hr5: 510, and hr6: 1,155 bp) were amplified by PCR. hr1, hr4, and hr7, which contain all imperfect palindromes and a varying number of anomalous repeat sequences (hr1: 1,327, hr4: 1,442, and hr7: 1,504 bp), were also amplified. Primers (Table 1) were designed from the SpltNPVII sequence (GenBank ID: EU780426.1). Amplified fragments were subsequently cloned into pUC19, confirmed by direct sequencing (Sanger sequencing, ABI 3730XL), and named pSphr1-7. These were used to determine replication efficiency. The SpltNPVII ie-1 promoter (∼510 bp) was amplified and cloned into the Xho and HindIII sites of pGL3-Basic (Promega, Madison, WI) to generate the plasmid pSp-ie1P/luc. All hr fragments were then subcloned into the pGL3-Basic vector with the ie-1 promoter, which contains the reporter gene luciferase (luc) placed downstream of the multiple cloning sites (BamHI and SalI) generating pSphr1-7/luc (Fig. 1).

Table 1.

Primers used for construction of reporter plasmids

Primer	Sequence (5'–3')
Sp-hr1-F	CGGGATCCACTTTGACGAAGACGCATTTGC (BamHI)
Sp-hr1-R	CG GTCGAC AGATGCATCTTCCTTGAAATCG (SalI)
Sp-hr2-F	CGAGATCTATAGGCCATAGTCTCGAGAGTAC (BglII)
Sp-hr2-R	CGGTCGACGTGATCTCATCGCGGATGATGAA (SalI)
Sp-hr3-F	CGGGATCCACGTCGTAGAGCATAGCTTGGAA (BamHI)
Sp-hr3-R	CGCTCGAGAACGGATGCTGTTCGATAGACG (XholI)
Sp-hr4-F	CG GGATCC AGAACCTATCGATCGCGAAAC (BamHI)
Sp-hr4-R	CG CTCGAG AGTGACTCGATTCTATCGAATG (XholI)
Sp-hr5-F	CGGGATCCCGTTACGTACTCGTCATGAGAG (BamHI)
Sp-hr5-R	CGGTCGACATCGTGACCGATGACGCCATCGA (SalI)
Sp-hr6-F	CGGGATCCCAACGAAACCCATCGTTTCGGC (BamHI)
Sp-hr6-R	CGGTCGACTAGTACCACATCGATCAGTGTAG (SalI)
Sp-hr7-F	CGGGATCCAGCGACGACGTCGACAGTGTAC (BamHI)
Sp-hr7-R	CGCTCGAGCAATCTTGAAGCTGGTATAGAC (XholI)
pSp-ie1P-F	GACTCGAGCAGCTCCTTGTGCAAATAGG (XholI)
pSp-ie1P-R	TCAAGCTTTACGGCAAACTGAAACAAGACAG (HindIII)
Q-PCR-F	GTTGGTAGCTCTTGATCCGGCA (DpnI)
Q-PCR-R	AATAGACAGATCGCTGAGATAG (DpnI)
pSp64-F	GATCTGGCTTTTAGTACTTGATCTTTGCTTTCGTCCACGATCCTCGATGAAAGCAAACATCAAGTACTAAAAGGATCCCGCCTCGAGG (BglII)
pSp64-R	TCGACCTCGAGGCGGGATCCTTTTAGTACTTGATGTTTGCTTTCATCGAGGATCGTGGACGAAAGCAAAGATCAAGTACTAAAAGCCA (SalI)

Restriction enzyme sites are underlined.

Fig. 1.

Diagrams of reporter vector constructs. Schematic representation of the reporter vectors used to assess the enhancement activity of Sphr1-7. The luciferase reporter gene (luc) is indicated by arrows. The Sp-ie1 promoter and Sphrs are indicated. Multiple cloning sites (mcs) are represented by multiple vertical bars. Key restriction enzyme sites are abbreviated as follows: Kp, KpnI; Hn, HindIII; Bm, BamHI; Sl, SalI; Xh, XhoI.

To explore the nature of hr-stimulated replication and enhancement, the typical 64-bp-long conserved repeat sequence of hrs, which contains half a BglII or SalI site in the forward and reverse sequence, respectively (Table 1, pSp64), was synthesized by Sun Biotech Company (Beijing). The synthesized sequence was then cloned into pUC19 (pSp64) and pSp-ie1P/luc (pSp64-ie1P/luc) by BamHI and SalI digestion, respectively.

Luciferase Activity Assay

Spli221 cells were seeded in 24-well plates and allowed to attach at 27°C overnight. Transfection assays were conducted using Lipofectin following the manufacturer’s instructions (Invitrogen). Cells were transfected with transfection solution containing 0.3 µg plasmid DNA (pSphr1-7, pSp-ie1P/luc, pSp64-ie1P/luc, or pGL₃-Basic, respectively) and 2 µl Lipofectin in a total volume of 25 µl. Four hours later, the transfection solution was replaced with fresh medium supplemented with FBS. If virus infection was required, virus was added to the serum-free medium and left for 1 h. Supernatant was then replaced with complete medium. The cells were harvested at 48 h post-transfection (hpt), and cell extracts were prepared following the instructions with the luciferase assay kit (Promega). Cells were washed twice with PBS and lysed in 200 µl of luciferase cell culture lysis reagent. Protein quantities in lysates were measured using the method of Bradford (Smith 1995). Cell lysate (10 µg) was used to determine the luciferase activity in 50 µl of luciferase assay reagent, and measurements of luciferase activity were taken with a GloMax 20/20 Luminometer (Promega). Luciferase activity is expressed as counts per minute (CPM) in 15 s. Data were collected from triplicate assays of three independent transfections.

DNA Replication Assay

Spli221 cells were seeded at a density of about 1 × 10⁶ viable cells per 35-mm dish. These were incubated at 27°C for 24 h to allow the cells to attach. The cells were inoculated with SpltNPVII or without viral infection. One hour later, the inoculation medium was removed and the cells transfected with plasmid DNA using Lipofectin, according to the manufacturer’s instructions (Invitrogen). For transfection, 1 µg hr-containing plasmids in 45 µl H₂O and 5 µl Lipofectin was added to 1 ml serum-free medium on the dish. pUC19 DNA (1 µg) was transfected as a control to evaluate the efficiency of prepared total cellular DNA digested with DpnI. Four hours after transfection, the transfection solution was replaced by fresh medium supplemented with 10% FBS. Each transfection contained at least three separate experiments. The cells were harvested 48 h postinfection (p.i.), and SpltNPVII and total DNA were isolated from infected cells as described by Summers and Smith (1987). An ND-1000 spectrophotometer (NanoDrop, Wilmington, DE) was used to quantify DNA. To distinguish input plasmid DNA from plasmid DNA that replicated in insect cells, the DNA was digested with the restriction enzymes HindIII and DpnI.

Real-Time Quantitative PCR

Digested DNA from the replication assay was used in real-time quantitative PCR (Q-PCR). Q-PCR was carried out as we described previously (Liu et al. 2010). In brief, PCR primers were used to amplify a 314-bp region of the pUC19 vector containing seven DpnI sites (Table 1). Because DpnI cleaves only fully methylated GATC sequences, the DNA replicating in insect cells is resistant to DpnI digestion. To distinguish input plasmid DNA from plasmid DNA that had replicated in insect cells, total DNA was digested with HindIII and DpnI (Hilton and Winstanley 2007, Yao et al. 2010). Each sample was analyzed three times. A standard curve of 5-fold dilution of the above plasmids was made from 10⁴ to 10⁸ copies /µl. The Q-PCR results were determined using the standard curve (Bustin et al. 2009).

Results

Identification and Characterization of Sphrs

SpltNPVII, a new species of the genus Alphabaculovirus, has a genome of approximately 148 kb, consisting primarily of 149 open reading frames. The genome also has seven homologous regions, designated Sphr1 to Sphr7 according to their relative position on the SpltNPVII genome. SpltNPVII hrs comprise many A/T-rich sequences that contain between three and eight highly conserved repeat sequences. All 40 palindromic repeats in Sphr1–Sphr7 are aligned and contain 64-bp-long highly conserved repeated sequences with a 24-bp imperfect palindrome (Fig. 2). The sequence between these imperfect palindromes contains direct or inverted repeats. Furthermore, hr1, hr4, and hr7 contain some variable anomalous repeat sequences. In addition, many other special motifs are present, which may be related to baculovirus genome replication (Table 2).

Fig. 2.

ClustalW alignment of the 40 SpltNPVII imperfect palindromes. Alignment of all 40 palindromic repeats from Sphr1 to Sphr7 and deduced Sphrs consensus sequences. Sequences are presented in the forward or reverse orientation. Gray shading above the consensus sequence indicates the level of conservation, from black (completely conserved) to light (less conserved) shading.

Table 2.

Number and types of sequence motifs found within Sphr1–Sphr7

Motif	hr1	hr2	hr3	hr4	hr5	hr6	hr7
P	6	4	7	8	3	5	7
DR	4	1	2	1	0	3	1
IR	0	0	1	2	0	1	1
R	6	0	0	8	0	0	7
CCAAT	0	1	0	0	0	0	3
CGATT	1	0	2	1	1	0	3
MLTF/USF	6	1	1	4	0	0	14
Sum of motifs	23	7	13	24	4	9	23

P, imperfect palindromes TTTCATCGAGACTTGTGGATGAAA, nonpalindromic bases are underlined; DR (GATGATGCAATAAAAACAA) and IR (TTGTTTTTATTGCATCATC) represent direct and inverted repeats, respectively; R represents anomalous repetitive sequences within hr1, hr4, and hr7; MLTF/USF, CANNTG probable RNA polymerase II transcription factor binding site. Sum of motifs, including P, DR, IR, R, MLTF/USF, CCAAT, and CGATT motifs.(R in hr1: ATCTCGAACTTAACGTAGGTTTCAAGGAAAATGCGTTTGTAAAATCTTTTACA A AAGATTTTTAAAATGTCACG; R in hr4: TTCGGCGAAAGATACATTCTAAAATTTTTGTAAAAATTTTTTAGATAGACTTGATCTTGAAATAGGCATCAAC; R in hr7: CAAGATAACGACATTTGAAAAGATTTTTTATAAAGTTTTAGCAGATGCTTTTCG TCGAAATTAATACTAACTT.)

Enhancement Activity of Sphrs

To determine whether the seven homologous regions of SpltNPVII could improve the activity of the strong ie-1 promoter, all hrs were subcloned into pGL3-Basic with the ie-1 promoter, and pSphrs-mediated enhancement was examined by measuring the luciferase activity expressed in spli cells with or without infection. The data suggested that all hrs acted as strong enhancers under both infected and noninfected conditions. The pSphrs-mediated enhancement of the Sp-ie1 promoter varied from 2.9-fold to more than 13-fold in infected spli cells. hr5 plasmid DNA only stimulated the luciferase activity by 2.9-fold of the control, while hr1 and hr7 increased luciferase activity by 11.83- and 13.16-fold respectively (Fig. 3). Enhancement by the other four hrs varied between 6- and 9-fold. This result suggests that the hrs of SpltNPVII stimulated enhanced ie-1 promoter activity when viral factor(s) were present. In addition, the enhancement efficiencies of Sphrs varied from 1.26- (hr5) to 6.93-fold (hr7) in noninfected cells (Fig. 3), about half that of infected cells.

Fig. 3.

Enhancement of Sp-ie1 promoter activity by Sphr1 to Sphr7. Black histograms represent relative luciferase activities of each Sphr-carrying construct in relation to that of the pSp-ie1P/luc (hr-less) construct in infected cells (m.o.i., 0.5). Gray histograms represent noninfected cells. pSp-ie1P/luc was used as control. Standard deviations of three independent experiments are presented.

Replicative Ability of Sphrs

DpnI restriction endonuclease recognition sites (GATC) in dam⁺ bacteria contain fully methylated deoxyadenosine residues, while in eukaryotic cells, these are not methylated (Geier and Modrich 1979). DpnI digests sequences that are fully methylated, so DpnI digestion can be used to differentiate between input plasmid DNA and plasmid DNA that has replicated in eukaryotic cells. The initial experiment indicated that no newly replicated Sphr-containing plasmid DNA was present in noninfected cells. Therefore, the ability of all Sphr-containing fragments to replicate was examined using a SpltNPVII-dependent DNA replication assay. Data suggested that all Sphrs were able to replicate in the presence of SpltNPVII as a helper virus (Table 2). The total SpltNPVII-infected cellular DNA was isolated for real-time PCR. The replication potential of the seven hrs varied from 1.52 × 10⁵ copies/µg SpltNPVII-infected cellular DNA (hr5) to more than 4.88 × 10⁶ copies/µg DNA (hr4), after deducting the control pUC19 copies (1,730 ± 70 copies/µg SpltNPVII-infected cellular DNA) in spli cells; Sphr1, hr3, and hr7 were detected at 9.48×10⁵, 6.15×10⁵, and 6.98×10⁵ copies/µg DNA, respectively; Sphr2 and hr6 were detected at lower levels, 3.06×10⁵ and 2.05×10⁵ copies/µg DNA, respectively (Fig. 4). Therefore, all seven hrs were able to function as SpltNPVII DNA origins.

Fig. 4.

Replication ability of Sphr1 to Sphr7. Values of the replication potential of each Sphr-carrying plasmid were determined by real-time PCR. The copy number of each plasmid after deduction of the background or incomplete digestion template (pUC19 without Sphr): 1,730 ± 70 copies/µg DNA. Standard deviations of three independent experiments are presented.

Nondetectable ori and Enhancer Function of a Single 64-bp Highly Conserved Consensus Sequence

To explore the nature of hr-stimulated SpltNPVII DNA replication and transcription enhancer activities, a luciferase activity assay and real-time PCR were carried out with a single 64-bp imperfect palindrome. Real-time PCR results showed no detectable replication above background (pSp64: 2,015.9 ± 88.6; pUC19: 1,947.3 ± 64.9 copies/µg SpltNPVII-infected cellular DNA). The luciferase activity was not significantly different to the control group (pSp64-ie1P/luc: 25,713 ± 3,572 CPM; pSp-ie1P/luc: 23,574 ± 2,941 CPM). Besides the entire 64-bp highly conserved consensus sequence, other cis-elements may be required for DNA replication.

Correlations Among Replicative Ability, Enhancer Efficiency, and Sphrs Palindromes

To clarify the mechanism of hrs’ ability to act as SpltNPVII DNA replication origins and enhancers, a Spearman’s correlation analysis of replication ability, enhancer efficiency, and the number of imperfect palindromes or other characteristic sequences of all seven hrs (Table 2) was performed. The results showed significant positive correlations between (i) replication potential and the number of palindromes (r = 0.847, Sig: 0.016 < 0.05) and (ii) the numbers of repeat sequences including DR, IR, and R (r = 0.883, Sig: 0.008 < 0.01), and characteristic motifs, including CCAAT, CGATT, and MLTF/USF (Carthew et al. 1985) (r = 0.821, Sig: 0.023 < 0.05), and the total number of palindromes, repetitive sequences, and characteristic motifs (r = 0.857, Sig: 0.014 < 0.05). Correlations also existed between enhancer efficiency and number of palindromes (r = 0.775, Sig: 0.041 < 0.05), and between the numbers of repeat sequences, including DR, IR, and R (r = 0.821, Sig: 0.023 < 0.05), and characteristic motifs, including CCAAT, CGATT, and MLTF/USF motifs (r = 0.893, Sig: 0.007 < 0.01), and the total number of palindromes, repeat sequences, and characteristic motifs (r = 0.964, Sig: 0.000 < 0.01). The cis-elements of palindromes, repeat sequences, and characteristic motifs were significantly positively correlated with both replication potential and enhancer efficiency. However, replication potential was most closely related to the number of repeat sequences and enhancer efficiency to characteristic motifs. In addition, no significant Spearman’s correlation was observed between the replication potential and enhancer efficiency of Sphr1-7 (r = 0.239, Sig: 0.606).

Discussion

In this study, we revealed that SpltNPVII hr sequences are involved in both DNA replication and enhancement of transcription. All Sphrs contained a near-identical 64-bp-long highly conserved consensus sequence (total 40; Fig. 2); within this was a 24-bp imperfect palindrome of a similar size to that of AcMNPV (28 bp). Almost half of the 40 imperfect palindromes were centered around a PvuI site. A similar situation exists in AcMNPV, the hrs of which contain a degenerate EcoRI site (Cochran and Faulkner 1983) and in SeMNPV with its (degenerate) restriction site, BglII (Broer et al. 1998). Previously, investigations using plasmid constructs of AcMNPV hr1a indicated that the central four nucleotides of the palindrome core are essential for ori function (Leisy et al. 1995).

A real-time PCR-DpnI method was introduced to quantify nascent DNA. The results confirmed that each of the seven regions may serve as oris of SpltNPVII DNA replication. A transient expression assay demonstrated that the expression of SpltNPVII-ie1 promoter-driven luciferase gene was enhanced in both infected and noninfected cells. Thus, the seven putative origins of SpltNPVII DNA are bifunctional, but whether they are all active simultaneously in vivo remains unclear. In this study, we used a transient replication method based on two steps where the first one is the infection with the baculovirus and the subsequent is the plasmids transfection, which differ from the method of other reports (Wu and Carstens 1996, Carstens 2009). Many experiments conformed our method is more suitable in Bm-N and Spli221 cell (Zhang et al. 1995, Hu et al. 1996). Maybe different experimental approaches are suitable for different baculovirus and cell lines. The role of each as an ori and their enhancer activities varied (Figs. 3 and 4), and so which is/are essential and sufficient for DNA replication remains to be determined. A previous report showed that some hr regions of AcMNPV may be less important or not essential through the production of deletion mutants, each with one or two of the eight hrs deleted (Rodems and Friesen 1993, Carstens and Wu 2007). Thus, no one hr is essential for AcMNPV DNA replication; however, the presence of multiple hr sequences may provide several alternative sites for replication initiation and accelerate the expression of early genes. To determine the function of the highly conserved consensus sequence, one characteristic 64-bp-long sequence was subcloned into a pGL3-Basic vector with the ie1 promoter or a pUC19 vector. However, no detectable effect was observed, both in terms of enhancer activity and as an origin of replication, meaning that this single 64-bp imperfect palindrome had neither ori nor enhancer functions in SpltNPVII-infected cells. The enhancer function of SpltNPVII hrs may be relatively weak, maximum enhancement being only 13.16-fold, even in SpltNPVII-infected cells, whereas BmNPV hr3 could significantly stimulate the transcription efficiency of the homologous ie-1 promoter (>2,400-fold), even though the enhancer ability of BmNPV hr3, with only one intact palindrome, was 79-fold (Chen et al. 2004). In addition, a part of AcMNPV hr5 containing a single, complete palindrome was sufficient to promote replication, indicating that a single repeat is the minimal requirement for plasmid-dependent DNA replication (Leisy et al. 1995, Pearson et al. 1995). However, transcription enhancement by CpGV hr regions, which all consist of a single palindrome, did not increase in BamHI-F subclone 5 with two palindromes (Hilton and Winstanley 2008). Therefore, the single 64-bp highly conserved consensus sequence may not have been sufficient to support replication of the plasmid in SpltNPVII-infected insect cells, or DNA replication may require other cis-elements, especially repetitive sequences including DR, IR, and R repeats.

In this study, significant correlations were observed among replication potential, enhancer efficiency, and numbers of imperfect palindrome or other characteristic sequences of all seven Sphrs. The results indicated that efficiency of replication and enhancement of hrs increased with increasing numbers of palindromes, repeat sequences, and characteristic motifs. Correlation coefficients indicated that the number of repeat sequences is likely more important to ori activity of hrs, but enhancer efficiency is most significantly related to the number of characteristic motifs. Indeed, the enhancer efficiency of hrs almost exactly tracks the total number of palindromes, repeat sequences, and characteristic motifs; so we speculate that enhancement of hrs requires the combination of the presence and distribution of structural motifs in hrs. Although the efficiency of hrs as oris and enhancers were significantly positively correlated with its total number of special cis-elements, no significant correlation was observed between replication potential and enhancer efficiency. The results further suggest that boosting of the efficiency of replication and enhancement were controlled by different cis-elements in hrs because the cis-elements that are most relevant to replication potential are repeat sequences, including DR, IR, and R, while those most important to enhancer efficiency are characteristic motifs, including CCAAT, CGATT, and MLTF/USF. Therefore, more detailed experiments are required to determine whether the effect of multiple SpltNPVII palindromes depends on their numbers and whether direct/inverted repeats and other motifs are involved in the regulation of transcription.