Abstract
Members of genus Bifidobacterium are Gram-positive bacteria, representing a large part of the human infant microbiota and moderately common in adults. However, our knowledge about their diversity, intraspecific phylogeny and long-term persistence in humans is still limited. Bifidobacterium longum is generally considered to be the most common and prevalent species in the intestinal microbiota. In this work we studied whole genome sequences of 28 strains of B. longum, including 8 sequences described in this paper. Part of these strains were isolated from healthy children during a long observation period (up to 10 years between isolation from the same patient). The three known subspecies (longum, infantis and suis) could be clearly divided using sequence-based phylogenetic methods, gene content and the average nucleotide identity. The profiles of glycoside hydrolase genes reflected the different ecological specializations of these three subspecies. The high impact of horizontal gene transfer on genomic diversity was observed, which is possibly due to a large number of prophages and rapidly spreading plasmids. The pan-genome characteristics of the subspecies longum corresponded to the open pan-genome model. While the major part of the strain-specific genetic loci represented transposons and phage-derived regions, a large number of cell envelope synthesis genes were also observed within this category, representing high variability of cell surface molecules. We observed the cases of isolation of high genetically similar strains of B. longum from the same patients after long periods of time, however, we didn’t succeed in the isolation of genetically identical bacteria: a fact, reflecting the high plasticity of microbiota in children.
Introduction
The genus Bifidobacterium comprises Gram-positive high G+C rods belonging to the phylum Actinobacteria [1]. It is commonly believed that bifidobacteria predominate in microbiota of breast-fed and formula-fed infants [2]. It is also estimated that bifidobacteria constitute nearly 11% of intestinal microbiota in children aged 1–4 years and account for a significant portion of the gut microbial consortium in adults [2,3]. Intestinal bifidobacteria have evolved to specialize in the fermentation of a variety of carbohydrates that are not digested by a host macroorganism using a complex metabolic network including unique galacto-N-biose/lacto-N-biose and fructose-6-phospate phosphoketolase pathways [4]. Consecutively, more than 8% of the identified genes in most studied bifidobacterial genomes are predicted to participate in carbohydrate transport and metabolism [5]. Bifidobacteria are widely used as probiotics as they are considered to confer health benefits to their human hosts. In particular, bifidobacteria produce water-soluble vitamins [6] that can be absorbed by the host [7]. Immunoregulatory properties of bifidobacteria, such as the ability to suppress the inflammatory responses, are well-documented by in vitro and in vivo studies [8,9]. The spectra of specific cytokines induced or suppressed by individual Bifidobacterium species or strain can vary greatly [10–12]. Certain strains of bifidobacteria are known to produce bacteriocins active against both Gram-positive and Gram-negative bacteria, including pathogens [13]. Additionally, such biological properties as bile and acid resistance that are considered to be of importance for probiotic activity also vary significantly among bifidobacterial species as well as between different strains within a single species [14].
While the species composition of bifidobacterial population in human intestinal tract undergoes significant changes with the age, Bifidobacterium longum is generally considered to be the most common and prevalent species found in this habitat both in infants and adults [2,15,16]. The species of B. longum comprises three known subspecies: longum, infantis and suis [17]. The former two subspecies are commonly found in human intestinal microbiota. However, while B. longum subsp. longum is widely distributed in both adults and infants, B. longum subsp. infantis appears to be specialized in the fermentation of human milk oligosaccharides and thus can be detected in infants but not in adults [18,19]. The subspecies of B. longum subsp. suis is considered to be characteristic to porcine intestinal microbiota, and is closely related to B. longum subsp. longum [20].
Intraspecies genomic diversity of B. longum has been studied in DNA-DNA hybridization studies [21] and by comparing a limited number of complete genome sequences [22,23]. A significant role of horizontal gene transfer (HGT) in the evolution of B.longum was predicted based on the first complete genome sequence of this species [24]. Recently, a number of additional new whole genome sequencing (WGS) projects of B. longum strains of human origin have been completed [23,25,26] thus allowing for the comprehensive comparative genomics studies of this species. Such an investigation would enable, in particular, the roles of HGT and other mechanisms in the generation of genomic diversity of B. longum to be thoroughly evaluated.
The mechanisms of establishment and persistence of bifidobacterial strains within the human intestinal microbial community are not well understood. The DNA fingerprinting-based study of the intestinal bifidobacteria demonstrated major changes in strain composition in children during a 5-year period, but at least in some cases the dominant strain of B. longum appeared to remain unchanged [27]. In our previous study, we sequenced genomes of these persisting strains and confirmed their close relatedness but not complete identity [28].
In the present study, we extended the genetic knowledge of the intraspecies genomic diversity of B. longum residing in human gut by performing comparative analysis of 28 genomes, including the sequences of strains isolated from the same individuals during a longitudinal observational study.
Materials and Methods
Ethics Statement
The study was approved by the Ethics Committee of Pirogov Russian National Research Medical University. Written informed consent was obtained from parents of each subject.
Strain isolation and genome sequencing
The strains selected for WGS in this study were isolated at several sampling points over an 11-year time period from feces of three healthy children. Homogenized feces were serially diluted in freshly autoclaved 0.9% NaCl and plated onto Bifidobacterium-agar (Himedia Labs, India). Petri dishes were incubated at 37°C for 48h in anaerobic jars (Schuett Biotech, Germany) filled with anaerobic gas mixture (85% N2, 10% H2, 5% CO2). The morphologically distinct types of bacterial colonies were subcultured and assessed by microscopic Gram stain examination and potential bifidobacterial isolates were selected for the study. The cultures were preserved by freeze-drying of suspensions in 10% sucrose/1% gelatin (w/v) solution. The preliminary designation of isolates to B. longum subsp. longum and B. longum subsp. infantis subspecies was performed using PCR with 16S rRNA gene-targeted species-specific primer sets [29]. DNA typing of bifidobacteria was performed using PAGE analysis of PCR-amplified variable number tandem repeat (VNTR) loci ##12, 23 and 25 essentially as described by Matamoros et al. [30] to discriminate between different strains of the same subspecies isolated at a particular sampling point from the individuals.
Вifidobacterial DNA was extracted by the method of Stahl [31] with minor modifications. Briefly, 4 ml of overnight cultures were centrifuged, washed once with TES buffer (50 mM NaCl, 100 mM TrisHCl, pH 8.0, and 70 mM EDTA) and resuspended in 250 ml of the same buffer supplemented with 25% sucrose, 30 mg/ml lysozyme, and 70 U/ml mutanolysin, and incubated at 42 C for 1 h. The subsequent steps were identical to the original protocol. Sequencing of the genomic DNA was performed at Genotek LLC (Russia) on Illumina HiSeq 2000 platform using TruSeq HT V3 kits. Reads were de novo assembled with CLC Genomics Workbench, the coverage varied from 1059x to 3037x.
The orthologous loci of CRISPR-1 system were amplified using primers 5’-CCCTATGGATGGTGGAAATCAG-3’ and 5’-CCCTATGGATGGTGGAAATCAG-3’. Polymerase chain reactions were performed in a total volume of 20 μl containing 1× PCR buffer, 0.25 μmol l−1 of each primer, 0.15 mmol l−1 of each dNTP, and 1 U of Taq polymerase (SibEnzyme, Russia). Amplification was performed using 30 cycles of (95°C, 30 s; 60°C; 30 s, 72°C; 3 min). For amplification of CRISPR-2 system loci we used nested PCR. The following external primers were used: 5'-GTTGCTCGACATGGGATATGG-3' and 5'-TGGATCTGGTACAGGGTGAC-3'. Sequences of the internal primers were as follows: 5'-GTATACGCCTACGCAATCGG-3' and 5'-AACATCCGCCGATAAACAGTC-3'. Reaction was performed using 15 cycles at the first stage of nested PCR and 15 cycles at the second stage under the same conditions as for locus CRISPR-1. Sanger sequencing of PCR products, obtained from strains 44B, 1-6B, 35B and 2-2B, was performed by primer walking at Evrogen JSC (Russia). Integration of streptococcal mobile genetic element into the genome of B. longum subsp. infantis EK3 was confirmed using PCR with primers 5’-CCACTTCTCCAGCGGATGTT—3’ and 5’- TGACCGCAAGAAGGTGTCTC-3’. Amplification was performed using 30 cycles of (95°C, 30 s; 58°C; 30 s, 72°C; 2 min).
Sequence analysis
All genome sequences analyzed in the study were uniformly (re)annotated using RAST with default settings and with "Fix frameshifts" parameter, which enables search and joining of genes fragmented by frameshift sequencing errors or mutations by comparing with the template genes in the nearest neighbors [32]. Whole genome alignment was performed using progressive Mauve [33]. The Average Nucleotide Identity (ANI) between the strains was calculated using JSpecies [34]. IS elements were annotated using ISsaga in the automatic mode [35]. Restriction-modification systems were annotated using blastp on REBASE database [36,37].
For phylogenetic inference we selected sequences of 43 presumptive housekeeping genes from the strains of B. longum as well as from B. breve UCC2003 [38] (see S1 Table). All of these were present in all of the genomic sequences studied and did not contain any undefined positions. The genes were chosen to be distanced from each other for more than 10 kb in the genome of a reference strain JCM 1217T to avoid possible sequence changes in two or more genes as the result of a single recombination event. In case several housekeeping genes were closely located the largest of them was chosen for analysis.
Gene sequences were aligned using MUSCLE [39] followed by manual curation. Phylogenetic tree was obtained using concatenated nucleotide alignments generated with Neighbor Joining algorithm. To detect recombination event(s) we used PhiPack [40] indirect recombination tests: NSS, Max χ2, PHI test using normal probability distribution and PHI test with 100 000 permutations of nucleotide alignments. Phylogenetic trees corrected for recombination events were reconstructed using ClonalFrame software with 100 000 iterations [41]. Three replicate runs were done to assess convergence of results [42,43]. This method is computationally intensive so no bootstrapping was performed. Alignment and phylogenetic inference of 16S rRNA genes and pKJ36/pB44 family plasmids were also performed using MUSCLE and Neighbor Joining algorithms.
Orthologs search was performed using OrthoMCL using parameters recommended by software developers: e-value cut-off 1e-5 and MCL inflation index I = 1.5 [44]. To evaluate the number of homoplasies in a dataset describing presence or absence of each ortholog group within the genomes of B. longum, we calculated pairwise compatibility score for each pair of ortholog groups as described in [40]. The core-and pan-genome size dynamics of B. longum subsp. longum were inferred using 10 000 random permutations of sequential inclusion of bacterial strains. The type of pan-genome was determined using a power law model described by Tettelin et al. [45] using mean values as well as medians of the number of ortholog groups. To explore the variation of the power law coefficient 50 000 "delete-half" subsamples were made and the coefficient was inferred using 1000 random permutations of sequential inclusion of strains within each subsample The ortholog groups within the pan-genome were divided into core, moderately distributed, and rare genes, based on the presence of orthologs in all, in several but not all, and in only one strain, respectively. Functional grouping of genes was made using RPS-BLAST on COG database [46], conservative domain search was made using Pfam database [47]. The comparison of functional group frequencies among genes of known functions in different parts of pan-genome was performed using Fisher's exact test with Benjamini-Hochberg controlling procedure.
Glycoside hydrolases in the genome sequences of B. longum were annotated using CAZymes Analysis Toolkit [48]. The families 23, 25, 73 and 103, comprising peptidoglycan hydrolases or peptidoglycan lyases, were excluded from the analysis since their abundances would more likely reflect the number of prophages in a genome rather than metabolic capabilities of a strain. The mean-centered scaled quantities of members of each remaining family were used for principal component analysis (PCA). Non-uniformity of distribution of glycoside hydrolase families between subspecies was estimated using Kruskal-Wallis test with Holm-Bonferroni correction.
Phage-related sequences in the genomes sequences were detected using PHAST [49] with manual curation of the results. The search for plasmids was performed based on homology with known plasmid sequences and the coverage of contigs. The circularization of plasmid sequences was made using the overlapping ends of contigs acquired by mapping of reads using Bowtie 2 [50].
Putative CRISPR loci were identified using CRISPRFinder [51] and flanking sequences were checked for the presence of cas genes. The protospacers were located by running BLASTn searches within nr/nt and wgs databases [37].
Results and Discussion
Strain isolation and selection
Most of the strains (10 out of 12, see Fig 1) sequenced for this study were isolated as numerically predominant bifidobacteria at several sampling time points during an extended, 11-year long, observational study of intestinal microbiota in three healthy children. For all strains identified as B. longum we performed VNTR analysis as a preliminary measure of their genetic similarity. Numerically predominant strains isolated from the children at every sampling point and showing unique VNTR patterns or forming similarity groups with other strains were selected for further studies.
Two distinct groups of B. longum strains isolated from two children subjects could be established according to VNTR analysis (Fig 1). The first group was formed by strain 44B (isolated from Child 1 at the age of 9 months) and strain 1-6B (isolated from the same child at the age of 5 years). The second group included the strains from Child 2: 35B (isolated at age of 11 months), 2-2B (isolated at the age of 6 years) and 7-1B (isolated at age of 11 years). The similar strains within these groups could be the derivates or each other or represent a distinct phylogenetic lineages. Four of these strains (44B, 1-6B, 35B and 2-2B) were described previously [27,28] and their draft WGSs were reported.
To evaluate general genetic diversity of B. longum species we also sequenced the genomes of several additional strains, namely strains 1-5B and 17-1B that were also isolated from a Child 1, but could not be grouped by VNTR analysis. We also sequenced unrelated strains EK3, EK5 and EK13 from a Child 3, and two additional unrelated strains of human origin, described in previous works: 72B and VMKB44, both isolated from child feces [52,53]. In total, the draft genome sequencing of eight B. longum strains of human origin was performed, and four 4 additional strains from the same cohort were sequenced earlier (44B, 1-6B, 35B, and 2-2B) [28]. Among these 12 strains 11 belonged to B. longum subsp. longum, while the strain EK3 belonged to B. longum subsp. infantis. All strains underwent 4–5 passages between isolation and sequencing, except for VMKB44 which undergone considerably more in vitro transfers. For the purpose of comparative genomic analysis a number of publicly available (as per September, 2014) complete and draft genomic sequences of B. longum strains were included in the analysis. Although the low quality sequences can bias the results, the higher the number of included genomes could allow for more representative view on the species genomics. All sequences were uniformly reannotated using RAST with “Fix frameshifts” parameter, which performs homology-based search of gene fragments to minimize negative effect of possible sequencing errors as well as to find recent pseudogenes. Neither draft assemblies from metagenomes, nor the genomic sequences from several derivatives from a single strain were included. In total, 20 genomic sequences available from the other studies were included, so that the final number of genomes analyzed in this study was 28: 8 complete and 20 draft (Table 1, see S2 Table for details on the genome sequencing of the strains). Most of the analyzed strains with known source of isolation were obtained from the human feces except for a strain LMG 21814T (isolated from pig feces) and strain AGR2137 (isolated from cow rumen).
Table 1. General properties of the B. longum genomes analyzed in this study.
Strain name | GenBank accession number | Reference | Genome sequence status | Sequence length, Mbp | Subspecies identified in this study |
---|---|---|---|---|---|
ATCC 15697T | NC_011593 | [38] | Complete | 2.83 | infantis |
EK3 | JNWC00000000 | this study | 45 contigs | 2.56 | infantis |
AGR2137 | ATWX00000000 | - | 49 contigs | 2.27 | suis |
JDM301 | NC_014169 | [54] | Complete | 2.48 | suis |
LMG 21814T | JGZA00000000 | [55] | 36 contigs | 2.34 | suis |
12_1_47BFAA | NZ_ADCN00000000 | - | 86 contigs | 2.40 | longum |
157F | NC_015052 | [56] | Complete | 2.40 | longum |
1-5B | JNVX00000000 | this study | 28 contigs | 2.37 | longum |
17-1B | JNVZ00000000 | this study | 23 contigs | 2.47 | longum |
1-6B | AJTF00000000 | [28] | 171 contigs | 2.69 | longum |
2-2B | AJTJ00000000 | [28] | 141 contigs | 2.63 | longum |
35B | AJTI00000000 | [28] | 131 contigs | 2.51 | longum |
44B | AJTM00000000 | [28] | 62 contigs | 2.56 | longum |
72B | JNWA00000000 | this study | 39 contigs | 2.37 | longum |
7-1B | JNVY00000000 | this study | 37 contigs | 2.41 | longum |
ATCC 55813 | ACHI00000000 | [57] | 140 contigs | 2.37 | longum |
BBMN68 | NC_014656 | [26] | Complete | 2.27 | longum |
CCUG 52486 | NZ_ABQQ00000000 | - | 55 contigs | 2.45 | longum |
CECT 7347 | NZ_CALH00000000 | - | 128 contigs | 2.33 | longum |
DJO10A | NC_010816 | [23] | Complete | 2.38 | longum |
E18 | AUYD00000000 | [58] | 7 contigs | 2.37 | longum |
F8 | NC_021008 | - | 21 contigs | 2.37 | longum |
EK5 | JNWC00000000 | this study | 35 contigs | 2.23 | longum |
EK13 | JNWD00000000 | this study | 48 contigs | 2.47 | longum |
JCM 1217T | NC_015067 | [56] | Complete | 2.39 | longum |
KACC 91563 | NC_017221 | [25] | Complete | 2.39 | longum |
NCC2705 | NC_004307 | [24] | Complete | 2.26 | longum |
VMKB44 | JRWN00000000 | this study | 36 contigs | 2.51 | longum |
A recent study showed the presence of conjugative megaplasmids in B. longum subsp. longum strains 44B, 1-6B and 2-2B [59]. However, due to the draft status of these genomic sequences we couldn't accurately determine what contigs in the assemblies correspond to the plasmid. The same situation potentially could be present in the other draft genome sequences of B. longum. So, in our analysis we used the term 'genome' in a broad sense, including not only the chromosome of the strain, but also possible episomal elements.
Intraspecies phylogeny of B. longum
Using the procedure described in Materials and methods section, we selected a set of 43 presumptive housekeeping genes (S1 Table) that were present in all studied genomes of B. longum and their homologous counterparts in B. breve UCC2003 [38], performed multiple alignments of concatenated sequences and a phylogenetic analysis using Neighbor joining algorithm. As a result, we managed to cluster the strains into the three major groups (Fig 2). Each of these groups contained a type strain for one of the three subspecies of B. longum (JCM 1217T for the B. longum susbp. longum, ATCC 15697T for the B. longum subsp. infantis and LMG 21814T for the B. longum subsp. suis). Hence, we associated those three clusters with the three subspecies. Importantly, the phylogenetic clustering based on the analysis of gene content and average nucleotide identity (ANI, S1 Fig, described below) showed identical results in the subspecies identification. However, several conflicts between our clustering and the original strain descriptions were noted: strain JDM301 which was initially described as B. longum subsp. longum falls into B. longum subsp. suis group, while B longum stains 157F, ATCC 55813 and CCUG 52486 initially described as B. longum susbp. infantis clearly belong to B. longum subsp. longum. The latter two conflicts were also previously noted by LoCascio et al. [18], suggesting the strains had been mis-identified in the original studies.
The indirect recombination tests (NSS, Max χ2, PHI test using normal probability distribution, PHI test with 100000 permutations), of PhiPack software package [40] provided the p-value of 0 on the concatenated sequences of the chosen housekeeping genes, indicating the presence of recombination events. Accordingly, while curating the alignments manually we observed numerous events of HGT between the three subspecies of B. longum, that supposedly occurred through homologous recombination with gene conversion. Moreover, we found transfers of gene fragments from the most closely related species, Bifidobacterium breve, which formed the sequence of the gene coding for glucosamine-fructose-6-phosphate aminotransferase (glmS, NZ_CALH01000030.1) in B. longum subsp. longum CECT 7347 (S1 Fig), and the gene encoding UDP-N-acetylglucosamine enolpyruvyl transferase (murA, JGZA01000026.1) in B. longum subsp. suis LMG 21814T.
HGT may significantly affect the phylogeny reconstruction leading to the distorted tree topology, increased branch lengths and general low robustness of the phylogenetic inference. Therefore, we employed the ClonalFrame software that implements a Bayesian phylogenetic approach to acquire a phylogeny reconstruction unaffected by recombinations using the same set of genes from the 28 strains of B. longum with B. breve UCC2003 used as an outgroup. (Fig 2). We also inferred the relative impact of mutations and HGT on genomic variability in B. longum using the ClonalFrame software on the dataset, containing only the genes of B. longum strains. The calculated ratio of recombination events to point mutations was 0.047, and the ratio of nucleotide substitutions by recombination to point mutations was 0.72.
Our study confirmed that the 16S rRNA sequence is informative enough for the discrimination between B. longum subsp. infantis and B. longum subsp. longum [29]. The most pronounced nucleotide differences between the subspecies of B. longum are located within the V6 region of 16S rRNA gene. However, the discrimination between human-associated subspecies and B. longum subsp. suis was shown to be less robust. Two of the three B. longum subsp. suis genome sequences available contain assembled 16S rRNA gene sequences: the B. longum subsp. suis LMG 21814T 16S rRNA gene is similar to 16S rRNA genes of B. longum subsp. longum (99.5%-99.7% identity), while the 16S rRNA gene of strain B. longum subsp. suis JDM301 is identical with the 16S gene of B. longum subsp. infantis ATCC 15697T. Further phylogenetic analysis confirmed clustering of B. longum subsp. suis JDM301 with B. longum subsp. infantis based on 16S rRNA sequences with high bootstrap confidence level (Fig A in S2 Fig). This observation could hardly be explained by phylogenetic noise, since it would take 7 random nucleotide substitutions to make one sequence fully identical to the other related sequence (Fig B in S2 Fig). One possible explanation is the paraphyly of B. longum subsp. suis, which however contradicts to the topology of tree based on housekeeping genes. Thus, the most likely explanation of the observed data is intraspecific HGT of 16S rRNA gene after the divergence of B. longum subspecies. a rare, but possible event.
As predicted by VNTR typing the strains 1-6B and 44B (isolated from child 1) formed a very tight cluster (99.8% identity). A comparable degree of identity (99,7%) was observed between the strains 2-2B, 35B and 7-1B, isolated from child 2. However, none of the strains in these groups were found to be completely identical. While the most closely related strains, 2-2B and 35B, demonstrated a very high sequence identity of the chosen housekeeping genes (only 6 out of 65310 bp used for the alignment were different, and 4 of these 6 differences were found to be unambigous using manual curation of raw reads, i.e. the identity percentage was 99,99%), the distances between other strains isolated from the same children at different time points (Fig 1) were found to be several folds larger. For example, we found major differences in the sequences of the genes coding for aspartyl-tRNAsynthetase (aspS), UDP-N-acetylmuramoylalanyl-D-glutamate 2,6-diaminopimelate ligase (murE), prolyl-tRNA synthase (proS), adenylosuccinate lyase (purB), and RNA polymerase σ-subunit (rpoD) between the strains 1-6B and 44B that indicate possible recombination events after the divergence of the lineages leading to these two strains.
To make the clustering based on an alternative approach we also measured the whole-genome average nucleotide identity (ANI) between all pairs of the strains (S3 Fig). It was calculated with Jspecies software [34] using pipeline described by Goris et al: a genome sequence from one of the strains in a pair was cut into 1020 bp fragments, which were searched in the other genome using bastn; the ANI between the query genome and the reference genome was calculated as the mean identity of all blastn matches that showed more than 30 % overall sequence identity (recalculated to an identity along the entire sequence) over an alignable region of at least 70% of their length [60]. Thus, this calculation included loci changed by mutations or transferred via homologous recombination, but not those acquired by other mechanisms of HGT. The ANI-based clustering of strains supported the division of B. longum into three distinct subspecies, and found the same strains as in the housekeeping gene clustering to be highly similar. Thus the ANI between the two strains of B. longum subsp. infantis was 98.28%, the mean ANI between the strains of subsp. suis was 98.35%, and the mean ANI between the strains of B. longum subsp. longum was 98,89% (98,88% after the exclusion of highly similar strains 1-6B, 44B, 2-2B, 25B and 7-1B). Interestingly, the identity between the B. longum subsp. longum and B. longum subsp. infantis varied between 95% and 96% (mean ANI 95,66%), approaching the threshold for classification prokaryotic organisms in the same species. At the same time, identities between other pairs of subspecies were higher (mean ANI 96,37% between subspecies infantis and suis, 96,99% between subspecies longum and suis).
General genome comparison
To determine the general characteristics of B. longum genome we analyzed all 28 available draft and completed genomic sequences. For the draft sequences we estimated the genome size as a sum of all contigs lengths, which could be smaller than the real genome size due to contig copy number variation. We found that genome size was unimodally distributed with median value of 2.39Mbp (S4 Fig). The largest genome (2,83Mbp) among the strains analyzed in this study belonged to the strain ATCC 15697T, the type strain of Bifidobacterium longum subsp. infantis. Generally, the strains of subsp. infantis had larger genomes than the strains of subsp. longum (Mann–Whitney U test, p = 0.02). No significant difference in the genome size between subsp. suis and subsp. longum was detected.
An early work on comparative genomics of B. longum suggested the attenuation during multiple culture transfers on artificial media as the major source of the differences in genome size between the different strains of B. longum [23]. However, the draft genomes of B. longum subsp. longum, sequenced and assembled in this study using the identical protocol, showed high diversity of summed sequence lengths ranging from 2.25 to 2.51 Mpb. Moreover, the largest draft genome sequence belonged to the strain VMKB44 that had had the longest history of culture transfers within this set. Thus we speculate that natural variations have higher impact on genome size in B. longum than the culturing history of the strain.
The mean GC-content of B. longum genome was found to be 59.97±0.23%. In most strains it varied between 59.63% and 60.33%, with the exception of strain B. longum subsp. infantis EK3, whose GC-content was found to be 59.38%. Although, this number was calculated from draft genome data, he real chromosome of this strain could have even lower proportion of GC pairs. One contig from this assembly (JNWB01000008.1, 3733 bp) with a high sequence coverage corresponding to roughly 20 copies in genome has a GC-content of 36.71% and represents a putative mobile element, possibly acquired from a member of genus Streptococcus. Using the analysis of raw paired-end reads we found that different copies of this element are adjacent with different contigs of the assembled sequence. As an example, one of the copies was localized near the bifidobacterial prolyl-tRNA synthase gene (proS). Using PCR with the primers specific to the mobile element and proS gene we confirmed that this element is integrated in the genome of strain EK3 rather than being a contamination of the DNA sample. Analysis of this contig using blastx shows, that it contains an open reading frame encoding mercuric ion reductase. However, it is unknown whether this streptococcal gene is actually expressed in B. longum. The structural genome characteristics of B. longum species were determined using the eight completed genomes included in this study. Whole genome alignment showed high level of synteny with only one large rearrangement observed in the genome of B. longum subsp. infantis ATCC 15697T (Fig 3). Three loci, containing rRNA genes, were found to be present in each available completed genome sequences (S5 Fig). However, while in some strains each locus contained only one rRNA operon, in others one of these loci contained two operons, forming a tandem repeat. Accordingly, the total number of rRNA operons varied from 3 to 4. The number of tRNA genes among most strains with complete genome sequences varied between 55 and 60, except for JCM 1217T and ATCC 15697T, which were found to harbor 76 and 79 tRNA genes, respectively.
Mobile genetic elements play an important role in the generation of genomic diversity and horizontal gene transfer in bacteria [61].Using ISsaga pipeline of annotation [35] based on the ISfinder database [62], we performed an automated prediction of IS elements, the simplest prokaryotic mobile genetic elements, in eight completed genomes of B. longum. While the genomes of subspecies longum and suis contained 28–40 unique IS elements, the larger genome of B. longum subsp. infantis ATCC 15697 harbored 61 loci. Some of the IS families were found in all completed genomes of B. longum (IS3, ISL3, IS21, IS30, IS21), but most of them were present only in a few or even in a single completed genome. The total number of IS elements per genome in B. longum varied between 42 and 90 (Table 2), which is appreciably higher than previously found in B. breve by Bottacini et al. (from 12 to 54) [63]. We have also performed a search in B. breve using the same strain set as in the cited work and detected from 22 to 53 IS-elements, significantly less than found in B. longum (Mann–Whitney U test, p = 0.005). This observation is in accordance with the previous report [6] that found B. longum species, especially the B. longum subsp. infantis, to harbor the largest and the most diverse set of IS elements.
Table 2. Total numbers of IS elements of different families in the complete B. longum genome sequences.
ATCC 15697 | JDM301 | 157F | BBMN 68 | DJO10A | JCM 1217 | KACC 91563 | NCC2705 | |
---|---|---|---|---|---|---|---|---|
IS1595_ssgr_ISPna2 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 |
IS200_IS605_ssgr_IS1341 | 5 | 0 | 1 | 0 | 0 | 2 | 0 | 0 |
ISL3 | 5 | 7 | 6 | 6 | 8 | 8 | 4 | 9 |
IS5_ssgr_IS427 | 2 | 0 | 0 | 0 | 0 | 0 | 2 | 0 |
IS607 | 2 | 2 | 0 | 0 | 2 | 1 | 0 | 1 |
IS256 | 12 | 5 | 2 | 2 | 3 | 1 | 11 | 6 |
IS256_ssgr_IS1249 | 7 | 9 | 0 | 0 | 4 | 0 | 4 | 0 |
ISNCY | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
IS66 | 0 | 0 | 1 | 2 | 2 | 1 | 1 | 0 |
IS30 | 21 | 5 | 19 | 12 | 10 | 20 | 9 | 4 |
IS3_ssgr_IS150 | 15 | 11 | 8 | 8 | 10 | 5 | 5 | 6 |
ISNCY_ssgr_ISLbi1 | 0 | 2 | 0 | 0 | 0 | 0 | 3 | 0 |
IS200_IS605 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
IS21 | 8 | 8 | 22 | 16 | 14 | 8 | 10 | 8 |
IS3_ssgr_IS51 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
IS3 | 3 | 14 | 6 | 1 | 4 | 6 | 4 | 8 |
IS110 | 9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Total | 90 | 64 | 65 | 50 | 57 | 52 | 53 | 42 |
Bacteriophages represent another important driver of intraspecies variability in bacteria. While no bifidobacterial phages were isolated in culture, a large number of prophage-like elements were detected, and some of them were found to be inducible at the transcription level [6,64]. Nine putative prophage-like elements were found in B. longum by Ventura et al. [64]. A preliminary analysis of other genomes for the presence of prophage elements conducted in this study revealed much more diverse prophage-like sequences. For example, the genome of the strain 157F contains a 62 kb prophage (BLIF_0804-BLIF_0890) that demonstrates no close homology within the other known genomic sequences. Another examples of the prophage without whole-sequence homologs is a 34 kb putative prophage in B. longum 44B (HMPREF1312_1242-HMPREF1312_1295) and a 36 kb putative prophage in B. longum VMKB44 (NL89_04820—NL89_05060). All strains isolated from Child 2 (i.e. 35B, 2-2B and 7-1B) were found to contain a 38 kb prophage (BL71B_01030-BL71B_01340) that was 99% identical within these strains and partially homologous to the prophages from strains EK13 and CCUG 52486.
Gene content of B. longum
To analyze the gene content of B. longum strains we performed standardized re-annotation of all 28 genomes and orthologs clustering. Totally 5324 orthologous groups were identified, including 287 groups that contain multiple paralogous genes at least within one of the genomes and 1527 groups that are represented by a single member in only one genome (singletons). The number of orthologous groups in an average strain was accounted to be 2049±163, less than a half of the total number of orthologous groups that were found in the clade. To construct a similarity heatmap we performed pairwise comparisons of the numbers of matching conserved orthologous groups between all sequenced genomes (Fig 4). Using the hierarchical clustering based on these data, we obtained the same separation B. longum strains into subspecies clusters as described above for ANI and house-keeping genes clustering. However, in contrast to the phylogeny inferred from the house-keeping genes data, B. longum subsp. suis was found to be closer to the subsp. infantis, than to subsp. longum, sharing slightly more ortholog groups with it (1554 vs 1536 on average).
A total of 1198 orthologous groups were present in all strains of B. longum, thus forming the core genome of the species. We also calculated the 'core additions' for each of the subspecies, i.e. orthologous groups conserved in all genomes of a particular subspecies, but absent from all other genomes. For B. longum subsp. infantis the 'core addition' was found to contain 175 orthologous groups. By contrast, the mean value of 'core addition' orthologous groups calculated for all other random divisions of strains into two groups of 2 and 26 randomly picked genomes was found to be 1.018. Such a large number of orthologous groups, found exclusively in the subspecies infantis, provides a clue for an enlarged size of their genome compared to subspecies longum and suis. Nearly a half of these orthologous groups conserved in B. longum subsp. infantis comprised genes encoding hypothetical proteins with no functional assignment. However, the remaining part of subsp. infantis-specific orthologous groups could play an important part in cell metabolism and adaption to host GIT environment. A total of 33 groups were found to be involved in the transmembrane transport of various molecules, including phosphonates (CP001095, Blon_0021-Blon_0022), carbohydrates (Blon_2360-Blon_2361), and ferrous iron (Blon_1648). Also, the subsp. infantis 'core addition' orthologous groups include genes, encoding L-fucose mutarotase (Blon_2305), which represents a component of fucose utilization pathway, putative glyoxalase (Blon_1645), various glycoside hydrolases (mainly sialidases and fucosidases), signal transduction histidine kinases, and transcription regulators. The core additions for other subspecies were significantly smaller. Only 19 orthologous groups were specifically conserved in subsp. longum and absent from other subspecies. Functions of the proteins encoded by the most of them were unknown. Among the identified products were the spermidine synthase (CP000605, BLD_0231) and the carbon starvation protein CstA, probably involved in peptide uptake (BLD_0646). Core addition set for subsp. suis comprised only 12 groups, encoding putative beta-lactamase (JGZA01000015, BLSS_0128), transporters and hypothetical proteins. The lists of all ‘core additions’ are located in Supporting Information (S1, S2 and S3 Files).
Pan-genome of B. longum subsp. longum
A choice of bacterial strains may significantly affect pan-genome analyses, regardless of the model used to interpret the data [45]. To date, the subspecies longum has been studied far more thoroughly than other subspecies of B. longum, and 23 out of 28 available genomes belong to this clade. While the representatives of this subspecies form the main part of our dataset, the members of subspecies infantis and suis represent outliers by their gene content. Such sampling heterogeneity may potentially lead to the biased estimations of pan-genome characteristics. Thus, for the analysis of pan-genome features we selected only the strains of B. longum subsp. longum, while the other two subspecies were not analyzed due to extremely low number of strains sequenced.
The size of pan-genome inferred from genome sequences of 23 B. longum subsp. longum strains was 4169 orthologous groups, what represents nearly 78% of the total number of orthologous groups obtained for all three subspecies of B. longum (5324 clusters). This value was more than twice higher than the average number of ortholog clusters in an average strain of B. longum subsp. longum (2027±126). The distribution of orthologous groups by the number of strains in which they could be found had a typical slightly asymmetric U-shape form implying that most of the genes being either extremely rare or by opposite ubiquitous (Fig 5).
Based on this distribution we divided all orthologous groups in a pan-genome into three groups: core genes (present in all of the 23 B. longum subsp. longum strains), moderately common genes (present in several strains) and rare genes (seen in only one out of 23 strains). To determine the differences in functional annotation of clusters within these groups we performed re-annotation of all orthologous groups in a pan-genome using COG database (Fig 6), which provides imperfect but simple and concise functional classification. In total, we obtained 1160 clusters with predicted functions among the core genes, 660 clusters among the moderately common and 220 clusters among the rare genes. The rest of the 51% of orthologous groups could not be annotated using COG database and most of these genes were located among the moderately common genes and rare genes (Fig 6A). The functional annotation showed the non-uniform distribution of several functional classes among functionally annotated genes (Fig 6B). The core genome was found to be enriched with genes involved in translation and posttranslational modification, energy production and conversion, as well as genes for amino acid, coenzyme, and nucleotide transport and metabolism. On the contrary, the genes for cell envelope biogenesis were overrepresented among the moderately common and rare genes, but not the core genes, that reflecting the high level of diversity of various glycosyltransferases, carbohydrate modification proteins and sortases in the pan-genome of B. longum subsp. longum, defining the strain-specificity of surface molecules of these bacteria. The 'Replication, recombination and repair' group was overrepresented among the rare orthologous groups, referring to the genes of mobile elements, such as transposases and site-specific recombinases, distribution of which was found to be nearly strain-specific. Interestingly, carbohydrate transport and metabolism genes although representing a large part of the pan-genome were uniformly distributed among all three groups of COG-annotated genes (9.6% of core, 13.5% of moderately common and 9.6% of rare genes).
To estimate the sizes of the core and the pan-genome of B. longum subsp. longum the plot was built that reflects the number of genes present in the core- and the pan-genome as a function of the number of individual genomes (Fig 7). The absolute difference between mean and median sizes of pan-genome in each point was calculated to be 5.7±2.1 orthologous groups, showing the relative homogeneity of strain samples in comparison with the extreme cases described by Tettelin et al. [45]. Thereby, we used only the mean values for further analysis. The core genome size was found to be well approximated by a sum of power law and decreasing linear function (y = 571.8x-1.167–4.39x + 1459.1, R2 = 0.99998). With addition of the last 3 strains in the set the core genome lost on average 4–5 ortholog groups for each added strain. However, this small decline in the right portion of the curve could be a noise coming from draft genome sequences. Thus it cannot be excluded that the real core genome function reaches plateau. The mean values of the pan-genome size were found to be approximated (R2 = 0.999995) by power law equation y = 2007x0.233. Addition of the last 3 strains in the set increased the pan-genome for 42–45 ortholog groups on average for each added strain.
The number of new ortholog groups added to pan-genome with the inclusion of new genomes was approximated (R2 = 0.998) b equation y = 469.7x-0.76 (Fig 8A). The power law coefficient within this equation was located between -1 and 0, corresponding to the typical open pan-genome model [45]. Assuming that an open genome model is applicable to B. longum subsp. longum a very large number of sequenced genomes would be needed to characterize the entire gene repertoire of the subspecies. According to the function inferred, more than 3000 added strains would be required to lower the increase of pan-genome to 1 ortholog group for each added strain. The pan-genome of B. longum subsp. longum can be considered to be less ‘open’ than that of Pantoea ananatis or Streptococcus agalactiae, but more ‘open’ than that of Streptococcus pneumonia or Listeria monocytogenes [65–68].
Even within the subsp. longum that we used for our analysis of pan-genome characteristics the strain sampling was not fully homogenous, because closely related strains (44B and 1-6B, 2-2B and 35B and 7-1B) were present in our sample and could lead to an underestimation of genetic diversity. To estimate the influence of inhomogeneous strain sampling on the pan-genome analysis we performed half-size subsampling procedure. The power law coefficient of the increase of pan-genome size varied from -0.60 to -0.92 in the subsamples with the mean value of -0.73. No values indicating a closed pan-genome structure were obtained (Fig 8B).
The other possible sources of bias could be too stringent or too soft criteria of clustering of protein-coding genes into ortholog groups. OrthoMCL procedure begins with all-against-all blastp comparison of a full set of proteins from studied genomes, using relatively low thresholds (50% sequence identity, e-value 1e-5). On the next step the obtained similarity matrix is weighed and protein sequences are clustered using MCL algorithm. The tightness (granularity) of clusters is determined primarily by the inflation index, I. For this study we used I = 1.5 as recommended by Li et. al. [44]. To ensure the open structure of B. longum subsp, longum pan-genome we also used values 1.1 and 4.0 as described in [44]. With these parameters the pan-genome of B. longum subsp. longum had a size of 3877 and 4350, respectively. The power law coefficient calculated for I = 1.1 and I = 4.0 was -0.74 and -0.79, respectively, which in either way corresponds to an open pan-genome. Conversely speaking, even by changing the granularity of clustering over a broad range of values we did not obtain results which contradicts to the open pan-genome structure.
Another obstacle towards understanding a pan-genome structure of B. longum susbp. longum population is the large number of ORFs coding for hypothetical proteins. The average genome of B. longum subsp. longum was found to contain 572 orthologous groups (28% of the total number of groups) not classified using COG database. The majority of these groups (79%) lack any conservative domains that belong to Pfam-A or Pfam-B categories of families [47]. In the pan-genome of B. longum subsp. longum non-classified groups accounted for 51% of the total number of orthologous groups (see S6 and S7 Figs for comparison with other subspecies). The large number (50.0%) of short ORFs (<300 bp) among the non-classified genes suggests that many orthologous groups lacking functional annotaions could actually correspond to the mis-annotated ORFs (S8 Fig). Another major fraction of the non-classified orthologous groups could be represented by rare genes with obscure or unknown functions; these genes are mainly found within the putative prophage sequences of B. longum subsp. longum. To estimate the impact of these ORFs with unknown or possibly absent functions on the pan-genome equation we expressed the number of new orthologous groups as a function of the number of strains with all non-classified orthologous groups excluded, and obtained the equation y = 168,0x-0,92 (R² = 0,999). The power law coefficient in this equation implies that the pan-genome remains open. Moreover, with the subsequent exclusion of 'Replication, recombination and repair' category orthologous groups, which are enriched by genes of selfish genetic elements, we obtained the equation y = 141,9x-0,97 (R² = 0,999); showing that the pan-genome in this case is still open and the number of orthologous groups follows a nearly logarithmic trend with addition of new strains [45]. Therefore, the open pan-genome of B. longum subsp. longum couldn't be ruled out even with the use of the strictest approaches, allowing us to conclude, that by addition of a large number of new genomes of B. longum subsp. longum we will continue to discover new genes, reflecting the vast genetic and phenotypic diversity of this species.
Glycoside hydrolase genes in B. longum
It is generally recognized, that the metabolism of bifidobacteria is specialized in the fermentation of a wide spectrum of complex carbohydrates. Several studies have discerned the enzymes and pathways for degradation of plant-derived, animal milk-derived, and human milk glycans [69–71]. However, our analysis of B. longum genomes available to date shows that although the indispensable final stages of carbohydrate metabolism (galacto-N-biose/lacto-N-biose pathway and fructose-6-phospate phosphoketolase pathway) are encoded in all studied genomes, the spectrum of glycoside hydrolases responsible for the utilization of complex carbohydrates, shows significant inter-strain diversity.
Using CAZymes Analysis Toolkit we annotated glycoside hydrolase genes, and then excluded the families of enzymes targeting peptidoglycan, leaving only the enzymes involved in carbohydrate catabolism. The numbers of genes within each glycoside hydrolase family were used for principal component analysis. We employed either, a scaled representation of data, allowing minor families to have significant impact on the result, or a non-scaled representation that maximizes the impact of the abundant families. The subspecies of B. longum were found to be clearly distinct using both approaches. The genomes of B. longum subsp. longum and B. longum subsp. infantis were found to be quite distant from each other, while the strains of B. longum subsp. suis formed an intermediate 'layer' between the former two (Fig 9A).
Ten glycoside hydrolase families were found to be non-uniformly distributed between the subspecies (Fig 9B). These genes can be grouped into three clusters. The first one contains families that are abundant in the genomes of B. longum subsp. infantis and scarcely distributed in other subspecies. This cluster contains family GH92, comprising exo-acting α-mannosidases, family GH20, including exo-acting N-β-acetylglucosaminidases and exo-acting lacto N-biosidases, and the family GH33 that contains sialidases. The second cluster contains the genes that are absent from B. longum subsp. infantis, but could be present in either B. longum subsp. longum and B. longum subsp. suis. It includes family GH27 that combines various enzymes, including α-galactosidase and β-L-arabinopyranosidase; family GH101, comprising endo-α-N-acetylgalactosaminidases; family GH127, containing β-L-arabinofuanosidases, and family GH31, comprising a diverse group of enzymes with α-glucosidase and α-xylosidase activities. The third cluster combines families that seem to be nearly absent from B. longum subsp. longum. This cluster contains families GH29 and GH95, comprising α-L-fucosidases, and family GH109, including α-N-acetylglucosaminidases, operating via NAD-dependent hydrolysis mechanism.
In agreement with the previous studies [6,18] genomic sequences of B. longum subsp. longum and B. longum subsp. infantis reflect the specialization in the catabolism of different types of carbohydrate nutrients. B. longum subsp. longum exhibits higher genomic capacity to utilize the plant-derived glycans, including arabinoxylans, while B. longum subsp. infantis is more suited for the degradation of human milk oligosaccharides that contain characteristic residues of fucose and sialic acid. Interestingly, B. longum subsp. suis appears to have an 'intermediate' carbohydrate catabolism capacity lying between B. longum subsp. infantis and B. longum subsp. longum. No families of glycoside hydrolases were significantly overrepresented or underrepresented in B. longum subsp. suis compared to the other two subspecies.
Plasmids in the sequenced strains of B. longum
The small cryptic plasmids, belonging to multiple families and having different modes of replication are known to be widespread in B. longum subsp. longum [6]. For example, strain DJO10A harbors two plasmids, the larger one (pDOJH10L) was shown to be a cointegrate, containing regions of high similarity with the well-studied plasmids pNAC2 and pKJ50, while the smaller one (pDOJH10S) have no known homologs [72]. The strain 157F was also found to harbor two plasmids, one of which (p157F-NC1) was similar to pDOJH10L, and the other one belonged to a widespread family, including the plasmid pKJ36 (p157F-NC2) [56]. The plasmids found in the strain KACC 91563 include a large plasmid with a large region of homology to a pB80-like plasmids (BLINAS_P1) and a cointegrate molecule composed of two members of pKJ36 family (BLINAS_P2) [25]. These examples show not only the diversity of B. longum subsp. longum plasmids, but also the combinatorial nature of their variability. However, no plasmids have been discovered in the other two subspecies of B. longum.
In this study we surveyed the genomic sequences of B. longum, sequenced for this study, for the presence of small cryptic plasmids. In total, 8 out of 12 strains were found to contain putative plasmid sequences (Table 3). All of them were circularizable based on the repeated sequences at the ends of contigs extended by read mapping (Fig 10). The plasmid-to-genome coverage ratio varied between 4.0 and 20.2 for all plasmids studied, with the exception of putative chromosome-integrated plasmid from strain 35B, represented by a separate contig with plasmid-to-genome coverage ratio 1.0.
Table 3. Small cryptic plasmids from B. longum strains sequenced for this study.
Plasmid | Strain | Plasmid-to-chromosome coverage ratio | Length of presumptive circular sequence, bp | Accession number |
---|---|---|---|---|
p1-5B1 | 1-5B | 10.5 | 3919 | KP691640.1 |
p1-6B1 | 1-6B | 4.9 | 3919 | KP691636.1 |
p17-1B | 17-1B | 13.2 | 3919 | KP691641.1 |
p1-5B2 | 1-5B | 6.6 | 3624 | KP691639.1 |
p1-6B2 | 1-6B | 4.0 | 3624 | KP691635.1 |
p35B | 35B | 1.0 | 3624 | AJTI01000126.1 |
p2-2B | 2-2B | 5.4 | 3624 | KP691633.1 |
pB44 | VMKB44 | 20.2 | 3624 | AY066026.1 |
p72B | 72B | 11.0 | 3624 | KP691638.1 |
pEK13 | EK13 | 12.7 | 7050 | KP691637.1 |
Most plasmids discovered had a length of 3624 bp and belonged to the well-studied family of bifidobacterial plasmids, which includes plasmid pKJ36 and pB44 [52]. Members of this family are known to be widely distributed among B. longum subsp. longum [6]. Additionally, the plasmid pBBKW-1, isolated from B. kashiwanohense, seems to be a cointegrate containing two copies of a pKJ36/pB44 family plasmid. This family of plasmids replicates through the rolling circle mechanism and carry genes coding for replication protein (Rep), mobilization protein (Mob), and other proteins of unknown function, such as the transmembrane protein MembB. Plasmids of this family have been used for the construction of shuttle cloning vectors, including one of the plasmid from this study, pB44 of B. longum subsp. longum VMKB44 [52]. Sequence comparison has shown, that pKJ36/pB44 family plasmids p1-5B2 and p1-6B2 found in strains 1-5B and 1-6B (both isolated from Child 1 at the age of 5), respectively, shared 100% identity with each other and 99.5% identity with pB44. Plasmids p35B and p2-2B found in strains 35B and 2-2B (isolated from Child 2 in two different time points), respectively, were also completely identical to each other, almost identical to p72B (99.9% identity), and closely related to the p1-5B2/p1-6B2 pair of molecules (98.8% identity, see S9 Fig for a phylogenetic tree of pKJ36/pB44 family plasmids).
Other putative small cryptic plasmids found in genomic sequences didn't have the whole length homology to the previously described plasmid families, but seem to originate from other plasmids through a series of recombination events.
Plasmids p1-5B1, p1-6B1, and p17-1B found in the strains 1-5B, 1-6B, and 17-1B, respectively, had 100% identical sequences of 3919 bp. These molecules are comprised of three blocks of sequence highly homologous to the previously described bifidobacterial plasmids pNAL8M (1068 bp, 99% identity), pNAC1 (1957 bp, 89% identity) and pFI2576 (719 bp, 92% identity) [73–75]. The ORFs mapped on these plasmids include genes for Rep protein homologous to pNAC1 replication protein and MembA protein homologous to that encoded by pNAL8M. A fragment of the rep gene homologous to pFI2576 Rep, and an ORF coding for a hypothetical protein with 30–50% identity to known Mob proteins of bifidobacteria were also mapped on plasmids from this group. Products of the other reading frames of this plasmid were hypothetical proteins with no function assigned.
The plasmid pEK13 from the strain EK13 has a length of 7050 bp, and is larger than most known cryptic plasmids in bifidobacteria. The nucleotide sequence includes a fragment corresponding to nearly the whole length of a previously described plasmid pB80 [52] of B. bifidum (4978 bp, 99% identity). Another large fragment of pEK13 is homologous to the plasmid pNAC1 (2885 bp, 96% identity). The two regions of homology overlap each other at both ends giving rise to the two imperfect repeats of 404 and 408 bp, which share 82.5% identity. Moreover, in each of these overlaps one half is more similar to one of the 'parental' plasmids, and the other half is more similar to the other 'parental' plasmid. This structure unambiguously indicates that the plasmid pEK13 originated as a result of cointegration of two ancestral plasmids through homologous recombination. Interestingly, a 1 kb region of the plasmid pNAC1 that is absent from pEK13 is located upstream of the rep gene and is flanked by the origin of replication and putative recombination site. One can speculate that its loss was a separate event before or after the co-integration event. The resulting sequence of pEK13 includes genes for two Rep proteins (both seem to be functional), Mob protein, MembA protein, and several hypothetical proteins.
A recent study has shown the existence of conjugative megaplasmids among several members of the genus Bifidobacterium, including B. longum subsp. longum strains 44B, 1-6B, and 2-2B [59]. A characteristic feature of these plasmids is the presence of an unusual CRISPR-Cas system (discussed below).
CRISPR-Cas and restriction-modification systems in B. longum
CRISPR-Cas systems provide prokaryotes with the mechanism of adaptive heritable resistance against phages and plasmids mediated by the incorporation of foreign DNA fragments into prokaryotic genome with subsequent cleavage of corresponding foreign DNA or, in some cases, RNA molecules [76]. These systems are widely distributed in prokaryotes, and in many cases the distribution seems to be strain-specific. Due to the hypervariable nature of CRISPR loci, the study of their sequence may allow for the investigation of a strain history with higher resolution and accuracy compared to other methods.
In our analysis of genomic sequences of B. longum we discerned 4 distinct CRISPR-Cas system types (Table 4, Fig 11, S10 Fig). The first type (#1) has recently been shown to be a part of a megaplasmid in strains 44B, 1-6B and 2-2B [28,59]. This system has new and a particularly unusual structure: it includes one set of cas genes and two CRISPR loci with repeat sequences that differ in one nucleotide. This system has been described by Bottacini et al. [59] as two different adjacent systems, but the single set of cas genes (including essential genes cas1 and cas2, each present in a single copy) contradicts the idea of independence of these two systems. Thus we suppose that considering this region as single system may better reflect its properties. The rule "spacers closest to cas genes are variable and the distant ones are conservative" [77] works for both of the CRISPR loci in this system. The conservative spacers are located at the 3' end of the loci (by the direction of cas genes), showing that the both loci can acquire new fragments of foreign DNA. A region of such structure could originate by translocation of a fragment of CRISPR locus or by fusion of two homologous but diverged adjacently located systems. System's #1 Cas locus contains genes, coding for the proteins of Cascade complex, which is typical for bacterial CRISPR-Cas class I systems [76]. However, it lacks the cas3 gene that is indispensable in the prototype systems of this class. Interestingly, strains 44B and 1-6B isolated from child 1 had exactly the same spacers sequences, reflecting the common origin of these two strains. However, despite the common origin of strains 2-2B, 35B, and 7-1B, the CRISPR-Cas system #1 was only present in strain 2-2B and was absent in the genomic sequences of strains 35B and 7-1B, which was additionally confirmed by PCR.
Table 4. CRISPR-Cas systems found in the B. longum genome sequences.
System number | System type | Repeat sequence | Strains, where the system is present |
---|---|---|---|
1 | N/A | ATCTACCCCGCACATGCGGGGATAAACC (locus 1), ACCTACCCCGCACACGCGGGGATAAACC(locus 2) | 44B, 1-6B, 35B |
2 | Class II | CAAGCTTATCAAGAAGGGTGAATGCTAATTCCCAGC | 44B, 35B, 7-1B, DJO10A, 12_1_47BFAA, KACC 91563, CECT 7347 |
3 | dpsyc variant | CTTGCATACGTCAAAACGTATGCACTTCATTGAGGA | 17-1B |
4 | Class I | GTTTGCCCCGCATGCGCGGGGATGATCCG (BBMN68), GTTTGCCCCGCACGCGCGGGGATGATCCG (EK3) | BBMN68, EK3 |
Other CRISPR-Cas systems in B. longum belong to the known types, and their cas proteins have multiple homologs in other species of bifidobacteria as well as in the other members of the phylum Actinobacteria. The system #2, which is related to the well-studied CRISPR-Cas class II, is widely distributed among the strains of B. longum and present in strains 44B, 35B, 7-1B, DJO10A, 12_1_47BFAA, KACC 91563, and CECT 7347. The CRISPR loci of the strains 2-2B, 35B, and 7-1B, isolated from child 2, are identical with the exception of one spacer (third from the 3’-end) that was absent from the strain 2-2B. The strains 44B and 1-6B, isolated from Child 1, have the same spacers in the sequenced regions of CRISPR loci of this system, however, we did not succeed in obtaining a full-length PCR product from strain 1-6B, suggesting that the integrity of the locus is disrupted in the genome of this strain. This system is also possibly damaged by translocation of the 3'-end of the locus (if not a result of mis-assembly) in the strain 12_1_47BFAA and by the insertion of IS256 family IS element in the leader sequence of the CRISPR locus in the strain KACC 91563.
The system #3 belongs to the Dpsyc type of CRISPR-Cas systems. In B. longum it could only be found in strain 17-1B. The system #4 has a typical structure of the CRISPR-Cas class I. The two similar #4 systems were found in strains BBMN68 and EK3, differing by only one nucleotide in their repeat sequences. Also, the CRISPR locus in BBMN68 is damaged by the insertions of IS elements, belonging to the families IS21 and IS3.
Another major contributors to the bacterial defense against plasmids and bacteriophages are the restriction-modification (R-M) systems. These systems generally act by methylating specific sites in bacterial DNA and digesting and eliminating DNA molecules, containing non-modified sites. Using the REBASE database [36] search with subsequent manual curation we detected 12 distinct orthologous groups of putative restriction endonuclease genes in the genomes of B. longum strains, eight of which were located adjacent to the predicted DNA methylase genes (and the predicted specificity proteins genes in case of type I systems). No restriction endonucleases genes were found to be present in the core genome of the species. The most widespread restriction modification systems were: one type I system (BLD_1959—BLD_1962 in the strain DJO10A) often clustered with the Mrr type IV restriction endonuclease (BLD_1958) and EcoRII-like type II system (BLD_0355—BLD_0356 in the strain DJO10A). These two systems were present in 20 and 18 strains, respectively. Several strains were also found to contain a predicted type III restriction modification system (BL171B_01860—BL171B_01865 in the strain 17-1B). The total number of restriction endonucleases per genome in B. longum varied between 1 and 6 (median of 3). The genomes of B. longum subsp. infantis possessed only one putative restriction endonuclease gene (BLIJ_0294 in the strain ATCC 15697), which contains a frameshift in the strain ATCC 15697, but seems to be intact in the strain EK3. The encoded protein shares 79% identity with the restriction endonuclease BbrUIIIR from B. breve (Bbr_1118 in strain UCC2003). However, the adjacent regions lack any detectable DNA methylase genes B. longum subsp. infantis strains, suggesting that this endonuclease gene is either inactive or has changed its function.
Genes potentially affecting bacterial competition and colonization
An important task in the genomics of bifidobacteria is to establish the genes responsible for the major components of probiotic activities, such as the ability to colonize the intestinal ecological niche, the immunomodulatory effect, and the ability to interfere with pathogenic microbes. Undoubtedly, the study of abundance and diversity of these genes could also be extremely important for the understanding of the forces shaping composition of the intestinal microbiota in general, as well as for the targeted search for candidates for probiotic strains and for genetic engineering-based improvement of probiotic strains. In our study we attempted to find in the sequenced genomes of B. longum strains some of the known genes whose involvement in probiotic activities of B. longum was confirmed experimentally. The results of the search are represented in Table 5.
Table 5. The presence of genes, involved in intestinal colonization and microbial antagonism, in the sequenced strains of B. longum.
Locus name | Locus example | subsp. infantis | subsp. suis | subsp. longum | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ATCC 15697 | EK3 | JDM301 | AGR2137 | LGM 21814 | 157F | E18 | JCM 1217T | BBMN68 | NCC2705 | KACC 91563 | 12_1_47BFAA | DJO10A | CECT 7347 | F8 | 7-1B | 35B | 2-2B | 1-6B | 44B | ATCC 55813 | 1-5B | 17-1B | CCUG 52486 | EK5 | EK13 | 72B | VMKB44 | ||
Type IVb tight adherence (Tad) pilus-encoding gene cluster | BLD_1295- BLD_1298 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Prepilin peptidase TadV gene | BLD_0613 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Putative transporter and adhesin gene | BLD_1516 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Sortase-dependent pilus-encoding gene cluster | BLD_1467 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | |||||||||
Lantibiotic prepeptide gene | BLD_1648, BLD_1650 (DJO10A) | + | + | + | + | ||||||||||||||||||||||||
Lantidiotic immunity protein | BLD_1652 (DJO10A) | + | + | + | + | + | + | + | + | ||||||||||||||||||||
Gene of fructose transporter protecting from Shiga-like toxin | BLD_0045 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | ||
Serpin gene | BLD_0126 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
Bile salt hydrolase gene | BLD_0536 (DJO10A) | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
The type IVb tight adherence (Tad) pilus-encoding gene cluster and the gene coding for prepilin peptidase TadV [38] were shown to be present in all strains of B. longum. Similarly, the putative ABC transporter shown previously to play a role in the adhesion [78] was also detected in all genomes. In contrast, the gene cluster encoding sortase-dependent pili [79], was found only in two thirds of B. longum strains.
Synthesis of lanthionine-containing bacteriocins (lantibiotics), known to possess a wide spectrum activity [80], may play an important role in the antagonistic activity of bifidobacteria against various pathogens. Clusters of lantibiotic biosynthesis genes were previously described in B. longum DJO10A and ATCC 15697T [6,80]. In our study we also revealed their presence in several other strains (e.g. 12_1_47BFAA and CECT 7347). The structure of the gene clusters varies greatly between strains, suggesting that not all strains are actually capable of synthesizing a functional bacteriocin. However, the presence of defective gene clusters could be important for providing resistance to the corresponding lantibiotic.
Secreted serine protease inhibitor (serpin), which acts as an efficient inhibitor of pancreatic and neutrophil elastase [81], is not widespread in the genus Bifidobacterium [82]. Nevertheless, in our study all sequenced B. longum genomes contained the corresponding gene. The gene encoding bile salt hydrolase [83] also seems to be a part of the core genome of the species. The fructose transporter gene whose presence was shown previously to provide protection in an animal model of E. coli O157:H7 infection [56] was found in all genomes of B. longum except for the two strains of B. longum subsp. infantis.
Comparison of the strains, isolated from the same patients
Several strains in this study were isolated from the same children at different ages. Comparison of these genomes could provide invaluable information about the strain dynamics in the intestinal microbiota during the long time periods and the evolutionary forces shaping the composition of intestinal microbiota in humans.
As stated above, the similarity within the sets of B. longum subsp. longum strains 44B —1-6B (isolated from child 1) and 35B —2-2B —7-1B (isolated from child 2) turned to be extremely high. The close relatedness can be inferred from nucleotide sequences of core genes, the composition of non-core genes, the sequences of such variable loci as CRISPR and the total average nucleotide identity. However, none of these strains were truly identical using each of these criteria, suggesting that all of these strains are genetically different even considering the draft status of their genomic sequences. Strains 2-2B and 35B could be the very close relatives other due to low amount of differences in housekeeping gene sequences. and the observed variations in gene content could be explained by a presence of megaplasmid [59] in 2-2B. The absence of 1 spacer in CRISPR-Cas #2 of strain 2-2B and the putative integration of plasmid in strain 35B are also minor differences. However, the strain B. longum subsp. longum 72B, isolated later from the same child, represents farther relative. Thus, the strains 35B, 2-2B, and 7-1B don't seem to represent any sort of 'lineage' by their relative positions on the phylogenetic tree, instead representing a random sample of a closely-related group of strains probably coexisting within the intestinal microbiome.
Strains 1-5B and 1-6B, isolated from Child 1 at the same time point, were found to be phylogenetically unrelated, but each had two different plasmids, both showing 100% identity between two strains. The plasmid p17-1B, identical to p1-5B1 and p1-6B1, has also been discovered in the different non-related strain 17-1B, isolated from the same patient five years later. This result could be explained by the high frequency of transmission of small cryptic plasmids between bifidobacteria. However, the mechanisms of such transmission have to be further elucidated. Taking into account the recent discovery of conjugative megaplasmids in bifidobacteria [59] one could speculate that small mobilizable plasmids use the Tra machinery of megaplasmids for mobilization with their own Mob proteins used as an interface for recognition of cis-located oriT sites [84].
Conclusions
The taxonomy and systematics of B. longum species was subjected to multiple changes in the recent decades. The groups "longum", "infantis" and "suis" had been first described as three distinct species, followed by their unification as the biovars of B. longum. Finally the three groups were reclassified as three subspecies [17,85]. In this study, the members of the subspecies were found to be clearly distinct using nearly all genetic criteria—the concatenated sequences of multiple core genes, average nucleotide identity and the total gene content. Using the comparative genomics approach we also confirmed the different ecological specialization of the subspecies: overrepresentation of the genes involved in metabolism of the milk-derived oligosaccharides in subsp. infantis and the metabolism of the plant-derived carbohydrates in subsp. longum. However, this study (as well as the study [18]) revealed many cases of misidentifications between three subspecies, reflecting their general phenotypic similarity and elusiveness of the border between them, which complicates the classical methods of bacterial identification. While the sequencing of 16S rRNA is known to be a robust method for discriminating between human-associated subspecies longum and infantis [29], the subspecies suis may be easily misidentified.
According to the data obtained using ClonalFrame, the overall impact of HGT on the evolution of the human-associated subspecies of B. longum was found to be considerably high. The effect of homologous recombination on the diversity of housekeeping genes was found to be comparable to the effect of point mutations, similar to the result acquired for Bacillus and Escherichia [86]. This could be explained at least in part by the abundance of phages and the existence of conjugative plasmids in the populations of humans-associated bifidobacteria. The pan-genome of B. longum subsp. longum (and in some way the pan-genome of the species B. longum) was found to be open meaning that new orthologous groups of genes could be discovered in every newly sequenced strain. The non-conservative part of the genome was found to be enriched with genes of cell envelope biosynthesis, such as rhamnose biosynthesis clusters and glycosyltransferase genes, reflecting the high individuality of host-microbe and microbe-microbe interaction systems in every strain of B. longum subsp. longum.
An interesting question for further studies is the relative impact of different HGT mechanisms on the evolution of the three subspecies of B. longum. An important role in the generation of genomic diversity may be played by temperate phages. The genomes used in a present study contained a large number of prophage sequences, but none of these prophages have been isolated in culture and studied experimentally, so the efficiency of phage-related gene transfer in B. longum still needs to be determined. Another important source of genomic diversity in bifidobactreria could be associated with plasmids, both small cryptic ones and the recently described megaplasmids. In this study, we observed several cases of isolation of fully identical plasmids from far-related strains isolated from the same patient at the same time, suggesting the possibility of fast plasmid transfer between bifidobacteria. An intriguing fact is that the frequency of plasmid-containing strains is distributed unequally among the three subspecies of B. longum. While plasmids are highly prevalent in B. longum subsp. longum, it seems like plasmids in the other two subspecies are very scarce if not absent at all [87]. Interestingly, the only plasmid-containing strain of B. longum subsp. infantis 157F was reclassified as B. longum subsp. longum in this study. The causes of such difference between the subspecies are unknown, and the impact of this phenomenon on the genomic diversity in B. longum should be further evaluated.
In this study we described two individual cases of long-term persistence of closely related strains of B. longum subsp. longum in human intestinal microbiota. However, we haven't succeeded in the isolation of fully identical strains from the same individual at different time points. One could hypothesize, that the situation observed can be explained by the high plasticity of intestinal microbiota on the strain level combined with the fine-tuned selection of subsets of the strains highly adapted for each individual host organism. The factors involved in this selection require further intensive studies and can include the host genotype, the repertoire of immune cell receptors, environmental and diet factors, and the individual composition of other microbes in gut microbiota.
Supporting Information
Acknowledgments
Authors thank Dr. Ekaterina Khokhlova for her technical help with genome sequencing.
Data Availability
All the genome sequences described in this work are available from DDBJ/EMBL/GenBank (accession numbers JNWC00000000, JNVX00000000, JNVZ00000000, JNWA00000000, JNVY00000000, JNWC00000000, JNWD00000000, JRWN00000000,KP691640, KP691636, KP691641, KP691639, KP691635, KP691633, KP691637, KP691638).
Funding Statement
The authors received no specific funding for this work.
References
- 1. Biavati B, Vescovo M, Torriani S, Bottazzi V. Bifidobacteria: history, ecology, physiology and applications. Ann Microbiol. 2000;50: 117–131. [Google Scholar]
- 2. Turroni F, Peano C, Pass DA, Foroni E, Severgnini M, Claesson MJ, et al. Diversity of bifidobacteria within the infant gut microbiota. PLoS One. 2012;7: e36957 10.1371/journal.pone.0036957 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Ringel-Kulka T, Cheng J, Ringel Y, Salojärvi J, Carroll I, Palva A, et al. Intestinal microbiota in healthy U.S. young children and adults—a high throughput microarray analysis. PLoS One. 2013;8: e64315 10.1371/journal.pone.0064315 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Fushinobu S. Unique sugar metabolic pathways of bifidobacteria. Biosci Biotechnol Biochem. 2010;74: 2374–84. [DOI] [PubMed] [Google Scholar]
- 5. Pokusaeva K, Fitzgerald GF, van Sinderen D. Carbohydrate metabolism in Bifidobacteria. Genes Nutr. 2011;6: 285–306. 10.1007/s12263-010-0206-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Lee J-H, O’Sullivan DJ. Genomic insights into bifidobacteria. Microbiol Mol Biol Rev. 2010;74: 378–416. 10.1128/MMBR.00004-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Said HM. Recent advances in transport of water-soluble vitamins in organs of the digestive system: a focus on the colon and the pancreas. Am J Physiol Gastrointest Liver Physiol. 2013;305: G601–10. 10.1152/ajpgi.00231.2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Turroni F, Taverniti V, Ruas-Madiedo P, Duranti S, Guglielmetti S, Lugli GA, et al. Bifidobacterium bifidum PRL2010 modulates the host innate immune response. Appl Environ Microbiol. 2013;80: 730–40. 10.1128/AEM.03313-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Miyauchi E, Ogita T, Miyamoto J, Kawamoto S, Morita H, Ohno H, et al. Bifidobacterium longum alleviates dextran sulfate sodium-induced colitis by suppressing IL-17A response: involvement of intestinal epithelial costimulatory molecules. PLoS One. 2013;8: e79735 10.1371/journal.pone.0079735 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Khokhlova EV, Smeianov VV, Efimov BA, Kafarskaia LI, Pavlova SI, Shkoporov AN. Anti-inflammatory properties of intestinal Bifidobacterium strains isolated from healthy infants. Microbiol Immunol. 2012;56: 27–39. 10.1111/j.1348-0421.2011.00398.x [DOI] [PubMed] [Google Scholar]
- 11. Medina M, Izquierdo E, Ennahar S, Sanz Y. Differential immunomodulatory properties of Bifidobacterium logum strains: relevance to probiotic selection and clinical applications. Clin Exp Immunol. 2007;150: 531–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Ménard O, Gafa V, Kapel N, Rodriguez B, Butel M-J, Waligora-Dupriet A-J. Characterization of immunostimulatory CpG-rich sequences from different Bifidobacterium species. Appl Environ Microbiol. 2010;76: 2846–55. 10.1128/AEM.01714-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Martinez FAC, Balciunas EM, Converti A, Cotter PD, de Souza Oliveira RP. Bacteriocin production by Bifidobacterium spp. A review. Biotechnol Adv. 2013;31: 482–8. 10.1016/j.biotechadv.2013.01.010 [DOI] [PubMed] [Google Scholar]
- 14. Delgado S, O’Sullivan E, Fitzgerald G, Mayo B. In vitro evaluation of the probiotic properties of human intestinal Bifidobacterium species and selection of new probiotic candidates. J Appl Microbiol. 2008;104: 1119–27. 10.1111/j.1365-2672.2007.03642.x [DOI] [PubMed] [Google Scholar]
- 15. Turroni F, Foroni E, Pizzetti P, Giubellini V, Ribbera A, Merusi P, et al. Exploring the diversity of the bifidobacterial population in the human intestinal tract. Appl Environ Microbiol. 2009;75: 1534–45. 10.1128/AEM.02216-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Ishikawa E, Matsuki T, Kubota H, Makino H, Sakai T, Oishi K, et al. Ethnic diversity of gut microbiota: species characterization of Bacteroides fragilis group and genus Bifidobacterium in healthy Belgian adults, and comparison with data from Japanese subjects. J Biosci Bioeng. 2013;116: 265–70. 10.1016/j.jbiosc.2013.02.010 [DOI] [PubMed] [Google Scholar]
- 17. Mattarelli P, Bonaparte C, Pot B, Biavati B. Proposal to reclassify the three biotypes of Bifidobacterium longum as three subspecies: Bifidobacterium longum subsp. longum subsp. nov., Bifidobacterium longum subsp. infantis comb. nov. and Bifidobacterium longum subsp. suis comb. nov. Int J Syst Evol Microbiol. 2008;58: 767–72. 10.1099/ijs.0.65319-0 [DOI] [PubMed] [Google Scholar]
- 18. LoCascio RG, Desai P, Sela DA, Weimer B, Mills DA. Broad conservation of milk utilization genes in Bifidobacterium longum subsp. infantis as revealed by comparative genomic hybridization. Appl Environ Microbiol. 2010;76: 7373–81. 10.1128/AEM.00675-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Garrido D, Barile D, Mills DA. A molecular basis for bifidobacterial enrichment in the infant gastrointestinal tract. Adv Nutr. 2012;3: 415S–21S. 10.3945/an.111.001586 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Delétoile A, Passet V, Aires J, Chambaud I, Butel M-J, Smokvina T, et al. Species delineation and clonal diversity in four Bifidobacterium species as revealed by multilocus sequencing. Res Microbiol. 2010;161: 82–90. 10.1016/j.resmic.2009.12.006 [DOI] [PubMed] [Google Scholar]
- 21. Klijn A, Mercenier A, Arigoni F. Lessons from the genomes of bifidobacteria. FEMS Microbiol Rev. 2005;29: 491–509. [DOI] [PubMed] [Google Scholar]
- 22. Sela DA, Chapman J, Adeuya A, Kim JH, Chen F, Whitehead TR, et al. The genome sequence of Bifidobacterium longum subsp. infantis reveals adaptations for milk utilization within the infant microbiome. Proc Natl Acad Sci U S A. 2008;105: 18964–9. 10.1073/pnas.0809584105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Lee J-H, Karamychev VN, Kozyavkin SA, Mills D, Pavlov AR, Pavlova NV, et al. Comparative genomic analysis of the gut bacterium Bifidobacterium longum reveals loci susceptible to deletion during pure culture growth. BMC Genomics. 2008;9: 247 10.1186/1471-2164-9-247 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Schell MA, Karmirantzou M, Snel B, Vilanova D, Berger B, Pessi G, et al. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc Natl Acad Sci U S A. 2002;99: 14422–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Ham J-S, Lee T, Byun M-J, Lee K-T, Kim M-K, Han G-S, et al. Complete genome sequence of Bifidobacterium longum subsp. longum KACC 91563. J Bacteriol. 2011;193: 5044 10.1128/JB.05620-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Hao Y, Huang D, Guo H, Xiao M, An H, Zhao L, et al. Complete genome sequence of Bifidobacterium longum subsp. longum BBMN68, a new strain from a healthy chinese centenarian. J Bacteriol. 2011;193: 787–8. 10.1128/JB.01213-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Shkoporov AN, Khokhlova EV, Kulagina EV, Smeianov VV, Kafarskaia LI, Efimov BA. Application of several molecular techniques to study numerically predominant Bifidobacterium spp. and Bacteroidales order strains in the feces of healthy children. Biosci Biotechnol Biochem. 2008;72: 742–8. [DOI] [PubMed] [Google Scholar]
- 28. Shkoporov AN, Efimov BA, Khokhlova E V, Chaplin A V, Kafarskaya LI, Durkin AS, et al. Draft Genome Sequences of Two Pairs of Human Intestinal Bifidobacterium longum subsp. longum Strains, 44B and 1-6B and 35B and 2-2B, Consecutively Isolated from Two Children after a 5-Year Time Period. Genome Announc. 2013;1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Matsuki T, Watanabe K, Tanaka R, Fukuda M, Oyaizu H. Distribution of bifidobacterial species in human intestinal microflora examined with 16S rRNA-gene-targeted species-specific primers. Appl Environ Microbiol. 1999;65: 4506–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Matamoros S, Savard P, Roy D. Genotyping of Bifidobacterium longum subsp. longum strains by multilocus variable number of tandem repeat analysis. J Microbiol Methods. 2011;87: 378–80. 10.1016/j.mimet.2011.10.005 [DOI] [PubMed] [Google Scholar]
- 31. Stahl M, Molin G, Persson A, Ahrne S, Stahl S. Restriction Endonuclease Patterns and Multivariate Analysis as a Classification Tool for Lactobacillus spp. Int J Syst Bacteriol. 1990;40: 189–193. [Google Scholar]
- 32. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 2008;9: 75 10.1186/1471-2164-9-75 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Darling AE, Mau B, Perna NT. progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. Stajich JE, editor. PLoS One. 2010;5: e11147 10.1371/journal.pone.0011147 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Richter M, Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci U S A. 2009;106: 19126–31. 10.1073/pnas.0906412106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Varani AM, Siguier P, Gourbeyre E, Charneau V, Chandler M. ISsaga is an ensemble of web-based methods for high throughput identification and semi-automatic annotation of insertion sequences in prokaryotic genomes. Genome Biol. 2011;12: R30 10.1186/gb-2011-12-3-r30 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Roberts RJ, Vincze T, Posfai J, Macelis D. REBASE—a database for DNA restriction and modification: enzymes, genes and genomes. Nucleic Acids Res. 2010;38: D234–6. 10.1093/nar/gkp874 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215: 403–10. [DOI] [PubMed] [Google Scholar]
- 38. O’Connell Motherway M, Zomer A, Leahy SC, Reunanen J, Bottacini F, Claesson MJ, et al. Functional genome analysis of Bifidobacterium breve UCC2003 reveals type IVb tight adherence (Tad) pili as an essential and conserved host-colonization factor. Proc Natl Acad Sci U S A. 2011;108: 11217–22. 10.1073/pnas.1105380108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32: 1792–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Bruen TC, Philippe H, Bryant D. A simple and robust statistical test for detecting the presence of recombination. Genetics. 2006;172: 2665–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Didelot X, Falush D. Inference of bacterial microevolution using multilocus sequence data. Genetics. 2007;175: 1251–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Maughan H, Redfield RJ. Tracing the evolution of competence in Haemophilus influenzae . PLoS One. 2009;4: e5854 10.1371/journal.pone.0005854 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Russell JA, Goldman-Huertas B, Moreau CS, Baldo L, Stahlhut JK, Werren JH, et al. Specialization and geographic isolation among Wolbachia symbionts from ants and lycaenid butterflies. Evolution. 2009;63: 624–40. 10.1111/j.1558-5646.2008.00579.x [DOI] [PubMed] [Google Scholar]
- 44. Li L, Stoeckert CJ, Roos DS. OrthoMCL: identification of ortholog groups for eukaryotic genomes. Genome Res. 2003;13: 2178–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Tettelin H, Riley D, Cattuto C, Medini D. Comparative genomics: the bacterial pan-genome. Curr Opin Microbiol. 2008;11: 472–477. [DOI] [PubMed] [Google Scholar]
- 46. Tatusov RL, Natale DA, Garkavtsev I V, Tatusova TA, Shankavaram UT, Rao BS, et al. The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acids Res. 2001;29: 22–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. Pfam: the protein families database. Nucleic Acids Res. 2014;42: D222–30. 10.1093/nar/gkt1223 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Park BH, Karpinets T V, Syed MH, Leuze MR, Uberbacher EC. CAZymes Analysis Toolkit (CAT): web service for searching and analyzing carbohydrate-active enzymes in a newly sequenced organism using CAZy database. Glycobiology. 2010;20: 1574–84. 10.1093/glycob/cwq106 [DOI] [PubMed] [Google Scholar]
- 49. Zhou Y, Liang Y, Lynch KH, Dennis JJ, Wishart DS. PHAST: a fast phage search tool. Nucleic Acids Res. 2011;39: W347–52. 10.1093/nar/gkr485 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9: 357–9. 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35: W52–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Shkoporov AN, Efimov BA, Khokhlova E V, Steele JL, Kafarskaia LI, Smeianov V V. Characterization of plasmids from human infant Bifidobacterium strains: sequence analysis and construction of E. coli-Bifidobacterium shuttle vectors. Plasmid. 2008;60: 136–48. 10.1016/j.plasmid.2008.06.005 [DOI] [PubMed] [Google Scholar]
- 53. Shkoporov AN, Kafarskaia LI, Afanas’ev SS, Smeianov V V, Kirillov MI, Postnikova EA, et al. [A molecular-and-genetic analysis of species and strain diversity of bifidobacteria in early childhood]. Vestn Ross Akad Med Nauk. 2006; 45–50. Russian. [PubMed] [Google Scholar]
- 54. Wei Y-X, Zhang Z-Y, Liu C, Zhu Y-Z, Zhu Y-Q, Zheng H, et al. Complete genome sequence of Bifidobacterium longum JDM301. J Bacteriol. 2010;192: 4076–7. 10.1128/JB.00538-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Milani C, Lugli GA, Duranti S, Turroni F, Bottacini F, Mangifesta M, et al. Genomic encyclopedia of type strains of the genus Bifidobacterium . Appl Environ Microbiol. 2014;80: 6290–302. 10.1128/AEM.02308-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Fukuda S, Toh H, Hase K, Oshima K, Nakanishi Y, Yoshimura K, et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature. 2011;469: 543–7. 10.1038/nature09646 [DOI] [PubMed] [Google Scholar]
- 57.Yang Y-S, Chen M-C, Liao C-C. Bifidobacteria strains with acid, bile salt and oxygen tolerance and their culture method. US Patent 5711977. 1998.
- 58. Zhurina D, Dudnik A, Waidmann MS, Grimm V, Westermann C, Breitinger KJ, et al. High-Quality Draft Genome Sequence of Bifidobacterium longum E18, Isolated from a Healthy Adult. Genome Announc. 2013;1: e01084–13. 10.1128/genomeA.01084-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Bottacini F, O’Connell Motherway M, Casey E, McDonnell B, Mahony J, Ventura M, et al. Discovery of a conjugative megaplasmid in Bifidobacterium breve . Appl Environ Microbiol. 2014; [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, Tiedje JM. DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. Int J Syst Evol Microbiol. 2007;57: 81–91. [DOI] [PubMed] [Google Scholar]
- 61. Frost LS, Leplae R, Summers AO, Toussaint A. Mobile genetic elements: the agents of open source evolution. Nat Rev Microbiol. 2005;3: 722–32. [DOI] [PubMed] [Google Scholar]
- 62. Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006;34: D32–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Bottacini F, O’Connell Motherway M, Kuczynski J, O’Connell KJ, Serafini F, Duranti S, et al. Comparative genomics of the Bifidobacterium breve taxon. BMC Genomics. 2014;15: 170 10.1186/1471-2164-15-170 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Ventura M, Turroni F, Lima-Mendez G, Foroni E, Zomer A, Duranti S, et al. Comparative analyses of prophage-like elements present in bifidobacterial genomes. Appl Environ Microbiol. 2009;75: 6929–36. 10.1128/AEM.01112-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Deng X, Phillippy AM, Li Z, Salzberg SL, Zhang W. Probing the pan-genome of Listeria monocytogenes: new insights into intraspecific niche expansion and genomic diversification. BMC Genomics. 2010;11: 500 10.1186/1471-2164-11-500 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. De Maayer P, Chan WY, Rubagotti E, Venter SN, Toth IK, Birch PRJ, et al. Analysis of the Pantoea ananatis pan-genome reveals factors underlying its ability to colonize and interact with plant, insect and vertebrate hosts. BMC Genomics. 2014;15: 404 10.1186/1471-2164-15-404 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Liu G, Zhang W, Lu C. Comparative genomics analysis of Streptococcus agalactiae reveals that isolates from cultured tilapia in China are closely related to the human strain A909. BMC Genomics. 2013;14: 775 10.1186/1471-2164-14-775 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Donati C, Hiller NL, Tettelin H, Muzzi A, Croucher NJ, Angiuoli S V, et al. Structure and dynamics of the pan-genome of Streptococcus pneumoniae and closely related species. Genome Biol. 2010;11: R107 10.1186/gb-2010-11-10-r107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Viborg AH, Katayama T, Abou Hachem M, Andersen MCF, Nishimoto M, Clausen MH, et al. Distinct substrate specificities of three glycoside hydrolase family 42 β-galactosidases from Bifidobacterium longum subsp. infantis ATCC 15697. Glycobiology. 2014;24: 208–16. 10.1093/glycob/cwt104 [DOI] [PubMed] [Google Scholar]
- 70. Fujita K, Sakaguchi T, Sakamoto A, Shimokawa M, Kitahara K. Bifidobacterium longum subsp. longum Exo-β-1,3-Galactanase, an enzyme for the degradation of type II arabinogalactan. Appl Environ Microbiol. 2014;80: 4577–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Ito T, Saikawa K, Kim S, Fujita K, Ishiwata A, Kaeothip S, et al. Crystal structure of glycoside hydrolase family 127 β-l-arabinofuranosidase from Bifidobacterium longum . Biochem Biophys Res Commun. 2014;447: 32–7. 10.1016/j.bbrc.2014.03.096 [DOI] [PubMed] [Google Scholar]
- 72. Lee J-H, O’Sullivan DJ. Sequence analysis of two cryptic plasmids from Bifidobacterium longum DJO10A and construction of a shuttle cloning vector. Appl Environ Microbiol. 2006;72: 527–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Moon G-S, Wegmann U, Gunning AP, Gasson MJ, Narbad A. Isolation and characterization of a theta-type cryptic plasmid from Bifidobacterium longum FI10564. J Microbiol Biotechnol. 2009;19: 403–8. [DOI] [PubMed] [Google Scholar]
- 74. Guglielmetti S, Karp M, Mora D, Tamagnini I, Parini C. Molecular characterization of Bifidobacterium longum biovar longum NAL8 plasmids and construction of a novel replicon screening system. Appl Microbiol Biotechnol. 2007;74: 1053–61. [DOI] [PubMed] [Google Scholar]
- 75. Corneau N, Emond E, LaPointe G. Molecular characterization of three plasmids from Bifidobacterium longum . Plasmid. 2004;51: 87–100. [DOI] [PubMed] [Google Scholar]
- 76. Makarova KS, Haft DH, Barrangou R, Brouns SJJ, Charpentier E, Horvath P, et al. Evolution and classification of the CRISPR-Cas systems. Nat Rev Microbiol. 2011;9: 467–77. 10.1038/nrmicro2577 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77. Briner AE, Barrangou R. Lactobacillus buchneri genotyping on the basis of clustered regularly interspaced short palindromic repeat (CRISPR) locus diversity. Appl Environ Microbiol. 2014;80: 994–1001. 10.1128/AEM.03015-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78. Shkoporov AN, Khokhlova E V, Kafarskaia LI, Pavlov KA, Smeianov V V, Steele JL, et al. Search for protein adhesin gene in Bifidobacterium longum genome using surface phage display technology. Bull Exp Biol Med. 2008;146: 782–5. [DOI] [PubMed] [Google Scholar]
- 79. Foroni E, Serafini F, Amidani D, Turroni F, He F, Bottacini F, et al. Genetic analysis and morphological identification of pilus-like structures in members of the genus Bifidobacterium . Microb Cell Fact. 2011;10 Suppl 1: S16 10.1186/1475-2859-10-S1-S16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80. Lee J-H, Li X, O’Sullivan DJ. Transcription analysis of a lantibiotic gene cluster from Bifidobacterium longum DJO10A. Appl Environ Microbiol. 2011;77: 5879–87. 10.1128/AEM.00571-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81. Ivanov D, Emonet C, Foata F, Affolter M, Delley M, Fisseha M, et al. A serpin from the gut bacterium Bifidobacterium longum inhibits eukaryotic elastase-like serine proteases. J Biol Chem. 2006;281: 17246–52. [DOI] [PubMed] [Google Scholar]
- 82. Turroni F, Foroni E, O’Connell Motherway M, Bottacini F, Giubellini V, Zomer A, et al. Characterization of the serpin-encoding gene of Bifidobacterium breve 210B. Appl Environ Microbiol. 2010;76: 3206–19. 10.1128/AEM.02938-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83. Kim G-B, Brochet M, Lee BH. Cloning and characterization of a bile salt hydrolase (bsh) from Bifidobacterium adolescentis . Biotechnol Lett. 2005;27: 817–22. [DOI] [PubMed] [Google Scholar]
- 84. Monzingo AF, Ozburn A, Xia S, Meyer RJ, Robertus JD. The structure of the minimal relaxase domain of MobA at 2.1 A resolution. J Mol Biol. 2007;366: 165–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85. Sakata S, Kitahara M, Sakamoto M, Hayashi H, Fukuyama M, Benno Y. Unification of Bifidobacterium infantis and Bifidobacterium suis as Bifidobacterium longum . Int J Syst Evol Microbiol. 2002;52: 1945–51. [DOI] [PubMed] [Google Scholar]
- 86. Vos M, Didelot X. A comparison of homologous recombination rates in bacteria and archaea. ISME J. 2008/10/03 ed. 2009;3: 199–208. 10.1038/ismej.2008.93 [DOI] [PubMed] [Google Scholar]
- 87. Sgorbati B, Scardovi V, Leblanc DJ. Plasmids in the genus Bifidobacterium . J Gen Microbiol. 1982;128: 2121–31. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All the genome sequences described in this work are available from DDBJ/EMBL/GenBank (accession numbers JNWC00000000, JNVX00000000, JNVZ00000000, JNWA00000000, JNVY00000000, JNWC00000000, JNWD00000000, JRWN00000000,KP691640, KP691636, KP691641, KP691639, KP691635, KP691633, KP691637, KP691638).