Significance
We developed Escherichia coli expressing deacetoxycephalosporin C synthase (DAOCS) as a whole-cell biocatalyst to convert penicillin G to G-7-aminodeacetoxycephalosporanic acid (G-7-ADCA). The major strategy used was to reconstitute the tricarboxylic acid (TCA) cycle of E. coli with DAOCS catalyzed reaction; thus the metabolic flux of central metabolism was forced to go through DAOCS catalyzed reaction to produce G-7-ADCA. This strategy was combined with engineering efforts to reduce the accumulation of acetate and the degradation of penicillin G and G-7-ADCA to improve the conversion rate of penicillin G by DAOCS significantly. Therefore, this work demonstrates the feasibility to redirect the TCA cycle to drive a desired enzyme reaction, and this strategy could be applied to other enzymes that catalyze TCA cycle-coupleable reactions.
Keywords: DAOCS, TCA cycle, reconstitution, whole-cell catalyst, G-7-ADCA
Abstract
Many medically useful semisynthetic cephalosporins are derived from 7-aminodeacetoxycephalosporanic acid (7-ADCA), which has been traditionally made by the polluting chemical method. Here, a whole-cell biocatalytic process based on an engineered Escherichia coli strain expressing 2-oxoglutarate–dependent deacetoxycephalosporin C synthase (DAOCS) for converting penicillin G to G-7-ADCA is developed. The major engineering strategy is to reconstitute the tricarboxylic acid (TCA) cycle of E. coli to force the metabolic flux to go through DAOCS catalyzed reaction for 2-oxoglutarate to succinate conversion. Then the glyoxylate bypass was disrupted to eliminate metabolic flux that may circumvent the reconstituted TCA cycle. Additional engineering steps were taken to reduce the degradation of penicillin G and G-7-ADCA in the bioconversion process. These steps include engineering strategies to reduce acetate accumulation in the biocatalytic process and to knock out a host β-lactamase involved in the degradation of penicillin G and G-7-ADCA. By combining these manipulations in an engineered strain, the yield of G-7-ADCA was increased from 2.50 ± 0.79 mM (0.89 ± 0.28 g/L, 0.07 ± 0.02 g/gDCW) to 29.01 ± 1.27 mM (10.31 ± 0.46 g/L, 0.77 ± 0.03 g/gDCW) with a conversion rate of 29.01 mol%, representing an 11-fold increase compared with the starting strain (2.50 mol%).
Most clinically important semisynthetic cephalosporins are manufactured from 7-aminodeacetoxycephalosporanic acid (7-ADCA) or 7-aminocephalosporanic acid (7-ACA). The traditional chemical process to produce 7-ADCA by ring expansion of penicillin G is expensive and pollutive (1, 2); thus, a bioconversion process is highly desirable. To this end, a process based on fermentation of Penicillium chrysogenum transformants expressing cefE (encoding deacetoxycephalosporin C synthase from Streptomyces clavuligerus, scDAOCS) in culture medium supplemented with adipate was first developed to produce adipyl 7-ADCA (3), which can be further converted to 7-ADCA by glutaryl acylase (3). A second process is based on the expression of the cefE gene from S. clavuligerus in a cefEF-disrupted Acremonium chrysogenum; the engineered strain can convert penicillin N accumulated in the cefEF disrupted mutant into deacetoxycephalosporin C (DAOC), which can be deacylated to 7-ADCA (1). Alternatively, a bioconversion process that directly converts penicillin G to G-7-ADCA by DAOCS had also been considered and investigated (4). This process holds promise to be the most commercially viable route to produce 7-ADCA. Imperative to the success of this strategy is the development of mutant DAOCS enzymes that can efficiently catalyze the conversion of the cheap substrate, penicillin G, to G-7-ADCA.
The scDAOCS from S. clavuligerus (also known as penicillin expandase) is the key enzyme that catalyzes the ring expansion of penicillin substrates into the corresponding cephalosporins (5, 6). It is a Fe (II)- and 2-oxoglutarate (2OG)-dependent oxidase (Fig. 1A). Several structures of DAOCS had been reported (7, 8). Presteady-state kinetics and binding studies of DAOCS (9) suggested that DAOCS employs a mechanism similar to other 2OG-dependent oxygenases, where the binding of 2OG occurs first with subsequent formation of a ternary DAOCS·Fe(II)·2OG·penicillin substrate complex (9). The natural substrate of DAOCS is penicillin N, and its activity toward other penicillin analogs, such as penicillin G, is low (4). To apply DAOCS in a bioconversion process, great efforts had been devoted to improving the catalytic activity of DAOCS toward penicillin G (10). These works led to the discoveries of many improved mutants with increased activity toward penicillin G (10). In this study, we chose a scDAOCS mutant (H7) (2) with significantly increased activity toward penicillin G (22.48-fold for specific activity and 80.74-fold for kcat/Km), as the biocatalyst to develop a bioconversion process of penicillin G in Escherichia coli. Previously, Cho et al. (4) reported successful bioconversion of penicillin G to G-7-ADCA using resting cells and extracts of S. clavuligerus NP1. Further studies revealed that the addition of ethanol or catalase stimulated the bioconversion of penicillin G (11, 12). Heterologous expression of DAOCS in Streptomyces lividans W25 resulted in significantly increased bioconversion of penicillin G (0.24 g/L after 24 h at the optimized condition, with 10 g/L penicillin G) (13). Whole-cell bioconversion is preferred because it does not require the exogenous addition of cosubstrates, such as, 2OG. In this work, we considered E. coli as a whole-cell catalyst of DAOCS catalyzed reaction because it is a well-characterized host with a clean genetic background.
Fig. 1.
Reconstitution of TCA cycle using DAOCS catalyzed reaction. (A) DAOCS catalyzed reaction to convert penicillin G to G-7-ADCA, which is coupled with the conversion of 2OG to succinate to compensate the disrupted TCA cycle. (B) The manipulations to disrupt the TCA cycle and glyoxylate bypass.
Because DAOCS catalyzed reaction needs 2OG as a cosubstrate, which is a key intermediate of the tricarboxylic acid (TCA) cycle, the efficiency of this reaction depends on the amount of 2OG that can be diverted from the TCA cycle. In the TCA cycle (Fig. 1B), 2OG is converted to succinyl-CoA and CO2 by 2OG dehydrogenase multienzyme complex (SucAB in E. coli), then to succinate by succinyl-CoA synthetase (SucCD). We envision that if the TCA cycle were disrupted at the 2OG to the succinate step, the TCA cycle can then be forced to go through a DAOCS catalyzed reaction. Such an outcome is a major goal of this work: that is, to reconstitute the TCA cycle with a DAOCS catalyzed reaction.
Results
Bioconversion of Penicillin G to Produce G-7-ADCA by E. coli Expressing scDAOCS.
First, the feasibility of in vivo bioconversion of penicillin G by heterologous expressing DAOCS in E. coli without an exogenous supply of 2OG was investigated. An E. coli K12 strain BW25113 containing an araBAD deletion was chosen as the bioconversion host, in which the scDAOCS gene can be expressed from the pBAD promoter after induction with l-arabinose. A scDAOCS mutant (M73T/C155Y/Y184H/T213V/V275I/C281Y/I305M) with improved activity toward penicillin G (2) was used as the catalytic enzyme. Recombinant E. coli strain BW/H7 was constructed by transforming plasmid pDB1S-H7 into BW25113 for expressing scDAOCS-H7. In BW/H7, scDAOCS-H7 was mainly expressed as a soluble protein. BW/H7 cells after induction were collected and suspended in the reaction mixture containing 100 mM penicillin G. After 5-h incubation at 30 °C, 2.50 ± 0.79 mM G-7-ADCA was formed, with a conversion rate of 2.5 mol%. The feasibility of bioconversion of penicillin G in an E. coli without an exogenous supply of 2OG was thus validated.
Reconstitution of the TCA Cycle with DAOCS Catalyzed Reaction.
The DAOCS catalyzed reaction needs 2OG as a cosubstrate (Fig. 1A), which is an important intermediate metabolite in the TCA cycle. Thus, the bioconversion reaction is expected to compete with the TCA cycle for 2OG. To redirect the metabolic flux toward the DAOCS catalyzed reaction, the TCA cycle was engineered in vivo by blocking the normal TCA reaction of 2OG to succinate, and thus forcing the TCA cycle to compensate by using the DAOCS catalyzed reaction (Fig. 2). In E. coli, the SucAB and SucCD are responsible for the transformation of 2OG to succinate, whereas AceA is the enzyme involved in the glyoxylate bypass of an incomplete TCA cycle. To engineer the metabolic flux of the TCA cycle, genes encoding SucA, SucB, SucC, SucD, and AceA were knocked out separately in E. coli BW25113, and pDB1S-H7 was transformed into these engineered strains, respectively. In the resulting recombinant strains, DAOCS catalyzed reaction was forced to compensate for the transformation of 2OG to succinate; as such, the TCA cycle was reconstructed in these E. coli mutants. The effects of the reconstructed TCA cycle on G-7-ADCA production were analyzed. The yields of G-7-ADCA by PG01/H7 (△sucA), PG02/H7 (△sucB), PG04/H7 (△sucC), PG06/H7 (△sucD), and PG08/H7 (△aceA) was 10.04 ± 0.77, 4.19 ± 0.73, 3.59 ± 0.75, 1.73 ± 0.73, and 3.79 ± 0.76 mM, respectively, and most strains showed higher production of G-7-ADCA than that of the starting strain BW/H7 (Fig. 3A). Among these mutants, the △sucA mutant showed the most obvious effect of increasing the yield of G-7-ADCA, in which the conversion of 2OG to succinyl-CoA was blocked. Deletion of aceA, the gene encoding the key enzyme for glyoxylate bypass, also caused a moderate increase in G-7-ADCA yield. These results revealed that the TCA cycle and the glyoxylate bypass can be engineered to adopt an alternative route without having significant impact on cell physiology.
Fig. 2.
The combined manipulations to convert E. coli BW25113 into an efficient whole-cell biocatalyst for penicillin G transformation.
Fig. 3.
A series of engineering strategies used to reconstitute TCA cycle of E. coli with DAOCS catalyzed reaction. (A) Effects of blocking the pathway of 2OG to succinate in BW on G-7-ADCA production. (B) Effects of engineering acetate metabolism on G-7-ADCA and acetate production during bioconversion. (C) Effects of engineering glyoxylate bypass on G-7-ADCA production. (D) Effects of ampC knockout on G-7-ADCA production. The parental strain E. coli BW25113 and its mutants transformed with pDB1S-H7 were cultured at 30 °C for 16 h and the cells were suspended in reaction mixture containing 100 mM penicillin G as substrate for G-7-ADCA production. The bioconversion reactions were performed at 30 °C and 200 rpm for 20 h.
Reduce Acetate Accumulation by △poxB::acs to Improve the Bioconversion of G-7-ADCA.
Penicillin G and G-7-ADCA are susceptible to decomposition in an acidic environment. A decrease in acetate production will not only prevent acidification of the reaction medium to maintain a more stable pH environment for the DAOCS bioconversion reaction, but will also avoid the carbon loss from the system, increasing the availability of acetyl CoA to drive the bioconversion of G-7-ADCA. To reduce acetate production, a combination of knocking out the pyruvate oxidase gene (poxB) and overexpressing of acetyl-CoA synthetase (Acs) was applied as reported by Tao et al. (14). E. coli PG03/H7 (△sucA△poxB::acs) was constructed and evaluated for its bioconversion of penicillin G. In this recombinant strain, the accumulation of acetate was reduced by 38.3% (Fig. 3B), and G-7-ADCA production was further increased by 11% to 11.10 ± 0.70 mM, similar to that of PG01/H7. It is worth noting that the growth of PG03/H7 was better than that of PG01/H7.
The Effects of Deregulation of Glyoxylate Pathway and Increased TCA Flux on DAOCS Catalyzed Reaction.
IclR is a repressor of the E. coli aceBAK operon, which encodes enzymes of the glyoxylate pathway (Fig. 2). When IclR is inactivated, repression of the expression glyoxylate genes is released, and the glyoxylate pathway is activated. This strategy could be used to reduce the flux through the TCA cycle (15). PG05/H7 (△sucA△poxB::acs△aceA) and PG07/H7 (△sucA△poxB::acs△iclR) were constructed to investigate the effects of increasing glyoxylate pathway on DAOCS catalyzed reactions. The production of G-7-ADCA by PG05/H7 and PG07/H7 was 12.19 ± 0.92 and 8.79 ± 0.24 mM, with a conversion rate of 12.19 and 8.79 mol%, respectively. These results were consistent with the prediction that increased flux through the TCA cycle (PG05/H7) is beneficial to G-7-ADCA production, because deletion of aceA should reduce the flux of the glyoxylate pathway and increase that of the TCA cycle (16), whereas inactivation of iclR (PG07/H7) should have opposite effects. The small changes observed suggest that glyoxylate bypass only had a minor contribution to the catabolism of 2OG. Thus, by pushing the flux of the TCA cycle, the DAOCS catalyzed reaction could be forced to increase (Fig. 3C).
To test this hypothesis further, we increased the supply of glucose as a simple mean to increase the flux of the TCA cycle. When glucose is taken up by E. coli, it is first broken down into pyruvate by glycolysis; pyruvate is then further converted to acetyl-CoA, which then enters the TCA cycle. Our results showed that different concentrations of glucose indeed had a significant impact on G-7-ADCA production in the PG01/H7 (△sucA) strain. As the concentration of glucose increased from 0.1 to 0.5%, the production of G-7-ADCA increased in concert (Fig. 4 A and B). For glucose concentrations higher than 0.5% (such as 1–2% wt/vol), no significant increase of G-7-ADCA production was observed (Fig. 4 C and D). Such effects of glucose on G-7-ADCA production were not found in BW/H7, in which the TCA cycle is not coupled with the DAOCS catalyzed reaction. These results further demonstrated that the flux of the TCA cycle can be coupled with the DAOCS catalyzed reaction, and by pushing the TCA cycle, the efficiency of the whole-cell biocatalysis for G-7-ADCA production can be improved.
Fig. 4.
(A–D) Effects of glucose concentrations on G-7-ADCA production. The recombinant strains of BW/H7, PG01/H7, and PG03/H7 were cultured at 30 °C for 16 h and the cells were suspended in reaction mixture containing 100 mM penicillin G supplemented with 0.1–2% (wt/vol) glucose for G-7-ADCA production. The bioconversion reactions were carried out at 30 °C and 200 rpm for 8 h. Samples was withdrawn every 2 h and subjected to analysis.
Knocking Out ampC to Reduce the Decomposition of Penicillin G and G-7-ADCA.
Decomposition of penicillin G and G-7-ADCA (17) was observed during the bioconversion process in this study. When cell lysis solution (10 OD cell-free extract in 100 mM Tris buffer) of E. coli strain BW25113 was incubated with penicillin G and G-7-ADCA, both were degraded within several hours (Fig. S1). The gene encoding β-lactamase (AmpC) was knocked out in BW25113 and PG01 to obtain PG12/H7 (△ampC) and PG14/H7 (△sucA△ampC) to avoid this problem. Strain PG12/H7 expressing scDAOCS-H7 produced on average 9.63 ± 1.01 mM G-7-ADCA, with a conversion rate of 9.63 mol%, that was 3.9-fold higher than that of the starting strain BW/H7 (2.50 ± 0.79 mM). The yield of G-7-ADCA of PG14/H7 (△sucA△ampC) expressing scDAOCS H7 was about 17.88 ± 2.55 mM, with a conversion rate of 17.88 mol%, significantly higher than that of the starting strain and PG01/H7 (Fig. 3D). These results clearly indicated that AmpC played an important role in the decomposition of penicillin G and G-7-ADCA in this bioconversion process.
Fig. S1.
Decomposition of penicillin G (A) and G-7-ADCA (B).
The Effects of Combining the Beneficial Mutations on G-7-ADCA Production.
Finally, the aforementioned beneficial mutations were combined in an engineered strain. Mutations of sucA and aceA should totally block succinate supply and result in an increased 2OG accumulation, whereas mutation of poxB and overexpression of the acetyl-CoA synthetase gene (acs) should reduce acetate accumulation, and ampC knockout eventually prevent the decomposition of penicillin G and G-7-ADCA. The engineered strain PG22/H7 (△sucA△poxB::acs△ampC△aceA) contains all these beneficial traits. For biotransformation by most of the mutant strains, 20 h were long enough for the production levels of G-7-ADCA to reach a plateau (Fig. S2). When we compared all 20 recombinant mutants in a bioconversion experiment than was run in parallel (Table S1), PG22/H7 showed the highest yield of G-7-ADCA around 29.01 ± 1.27 mM, with a conversion rate 29.01 mol%, followed by PG15/H7 (△sucA△poxB::acs△ampC) around 21.48 ± 1.08 mM, with a conversion rate of 21.48 mol% (Fig. 5 A–C). Overall, the bioconversion rate increased more than 10-fold from 2.50 mol% to 29.01 mol%.
Fig. S2.
The time course of the bioconversion by the engineered strains. (A) BW/H7; (B) PG15/H7. Cells after induction were collected and suspended in the reaction mixture containing 100 mM penicillin G, 0.5% glucose and 3.6 mM FeSO4 in 100 mM Mops buffer to form cell suspension (OD600 nm = 40). The bioconversion reactions were performed at 30 °C and 200 rpm. Samples of the reaction mixture were extracted and analyzed for penicillin G and G-7-ADCA by HPLC.
Table S1.
G-7-ADCA yield, conversion rate and corrected relative activity of DAOCS in the bioconversion of the mutants
| Strain | Genotype | G-7-ADCA yield (mM) | Conversion rate (mol %) | Specific yield (g/gDCW) | Corrected relative activity of DAOCS (%) |
| BW/H7 | BW25113 | 2.50 ± 0.79 | 2.50 | 0.07 ± 0.02 | 100 |
| PG01/H7 | △sucA::kan | 10.04 ± 0.77 | 10.04 | 0.27 ± 0.02 | 412 |
| PG02/H7 | △sucB::kan | 4.19 ± 0.73 | 4.19 | 0.11 ± 0.02 | 204 |
| PG03/H7 | △sucA △poxB::acs | 11.10 ± 0.70 | 11.10 | 0.30 ± 0.02 | 527 |
| PG04/H7 | △sucC::kan | 3.59 ± 0.75 | 3.59 | 0.10 ± 0.02 | 202 |
| PG05/H7 | △sucA△poxB::acs △aceA::kan | 12.19 ± 0.92 | 12.19 | 0.32 ± 0.02 | 543 |
| PG06/H7 | △sucD::kan | 1.73 ± 0.73 | 1.73 | 0.05 ± 0.02 | 89 |
| PG07/H7 | △sucA△poxB::acs △iclR::kan | 8.79 ± 0.24 | 8.79 | 0.23 ± 0.01 | 358 |
| PG08/H7 | △aceA::kan | 3.79 ± 0.76 | 3.79 | 0.10 ± 0.02 | 124 |
| PG10/H7 | △poxB::acs-kan | 3.08 ± 0.71 | 3.08 | 0.08 ± 0.02 | 184 |
| PG12/H7 | △ampC::kan | 9.63 ± 1.01 | 9.63 | 0.26 ± 0.03 | 382 |
| PG14/H7 | △sucA△ampC::kan | 17.88 ± 2.55 | 17.88 | 0.48 ± 0.07 | 747 |
| PG15/H7 | △sucA△poxB::acs △ampC::kan | 21.48 ± 1.08 | 21.48 | 0.57 ± 0.03 | 1,028 |
| PG16/H7 | △sucA△aceA::kan | 8.44 ± 0.87 | 8.44 | 0.22 ± 0.02 | 352 |
| PG17/H7 | △aceA△poxB::acs-kan | 3.43 ± 0.79 | 3.43 | 0.09 ± 0.02 | 152 |
| PG18/H7 | △aceA△ampC::kan | 6.17 ± 0.75 | 6.17 | 0.16 ± 0.02 | 240 |
| PG19/H7 | △ampC△poxB::acs-kan | 5.59 ± 0.90 | 5.59 | 0.15 ± 0.02 | 197 |
| PG20/H7 | △sucA△aceA△ampC::kan | 17.42 ± 1.04 | 17.42 | 0.46 ± 0.03 | 929 |
| PG21/H7 | △aceA△ampC△poxB::acs-kan | 7.13 ± 1.04 | 7.13 | 0.19 ± 0.03 | 356 |
| PG22/H7 | △sucA△poxB::acs△ampC△aceA::kan | 29.01 ± 1.27 | 29.01 | 0.77 ± 0.03 | 1,106 |
The experiments were performed for more than three times (n ≥ 3). Corrected relative activities of scDAOCA-H7 in each strain were calculated as G-7-ADCA yield per mg scDAOCS-H7 expressed and used that of BW/H7 as 100%.
Fig. 5.
The cumulative effects of different combinations of △sucA, △aceA, △poxB::acs, and △ampC mutations on G-7-ADCA production. (A) G-7-ADCA yields of double-mutation strains. (B) G-7-ADCA yields of triple mutation strains. (C) G-7-ADCA yields of selected engineered strains. (D) Corrected relative activities of DAOCS of selected engineered strains. The recombinant strains were cultured at 30 °C for 16 h and the cells were suspended in reaction mixture containing 100 mM penicillin G as substrate for G-7-ADCA production. The bioconversion reactions were carried out at 30 °C and 200 rpm for 20 h.
Discussion
DAOCS catalyzes a ring expansion reaction to convert penicillins into cephalosporins; the reaction needs 2OG as a cosubstrate, which undergoes oxidative decarboxylation to form succinate. An in vitro process to carry out such a reaction would require the exogenous supply of 2OG that is a cost burden to the process; in addition the accumulation of the coproduct succinate could inhibit the bioconversion rate of the process (9). An in vivo process using E. coli as a whole-cell catalyst can provide an ideal solution to these problems because 2OG can be supplied in E. coli cells, and succinate will automatically be consumed without accumulation, thus effectively removing its inhibition of the DAOCS catalyzed reaction. However, 2OG is normally metabolized via the TCA cycle; little flux normally goes into the route of producing of G-7-ADCA. To solve this problem, the TCA cycle of the host was forced to use the DAOCS catalyzed reaction: the reconstituted TCA cycle consumed 2OG and produced succinate and G-7-ADCA, as desired. This restores the normal function of the TCA cycle, in which succinate is further recycled into other TCA intermediates. In the TCA cycle, 2OG is converted to S-succinyldihydrolipoamide-E by SucA, the first enzyme catalyzing the conversion from 2OG to succinate. Whereas in sucB, sucC, and sucD single-knockout mutants, S-succinyldihydrolipoamide-E produced by SucA can be further metabolized to succinate by alternative reactions; therefore, only sucA mutation can completely block the conversion of 2OG to succinate; as expected, the sucA mutant showed the highest penicillin G conversion rate compared with that of sucBCD mutants.
E. coli K12 is often used as a cell factory for the production metabolites, because it is a nonpathogenic bacterium with a well-studied genetic background and a powerful genetic tool system for metabolic engineering. Therefore, it was chosen as host to test our hypothesis of reconstituting the TCA using a DAOCS catalyzed reaction. The reconstituted TCA cycle indeed worked as predicted, and the flux can be powered by the addition of glucose. Although there are penicillin-binding proteins in E. coli (18), the amount of penicillin G bound to the cell wall was small in comparison with the amount supplied and penicillin G could diffuse into the cell efficiently (Fig. S3).
Fig. S3.
(A) Concentration of G-7-ADCA and penicillin G after the bioconversion. The residual penicillin G and G-7-ADCA were measured in the 5-h bioconversion by strain PG12/H7 (△ampC, which reduce the decomposition of penicillin G and G-7-ADCA). Penicillin G in the reaction system before the bioconversion reaction was 100 mM. (B) The effect of Triton X-100 on the bioconversion. To promote the diffusion of penicillin into the cells, Triton X-100 (0.01–0.5%) was added in the reaction mixture in the 5-h bioconversion by strain PG12/H7.
Penicillin G and G-7-ADCA are susceptible to decomposition in an acidic environment. Because acetate accumulation often occurs in bioprocesses when high concentration of glucose was used, reduction of acetate formation can help prevent the decomposition of penicillin G and G-7-ADCA in the penicillin G bioconversion process. On the other hand, the lost carbon resulting from acetate formation reduces the flux of acetyl-CoA entering the TCA cycle. Taking the carbon balance in the system into consideration, decrease in acetate production will not only prevent acidification of the reaction medium but also reduce the carbon loss from the system, which may increase the availability of acetyl-CoA to drive the G-7-ADCA production. There are two major acetate-producing pathways in aerobically grown E. coli: the PoxB and phosphotransacetylase-acetate kinase (Pta-AckA) pathways (19, 20). Elimination of the Pta-AckA (△pta△ackA) pathway is an effective method to reduce acetate formation (19, 20). However, the deletion of ackA or pta also impaired growth (19, 20). ΔpoxB was an alternative way to reduce acetate formation without affecting growth; and acetate can be converted by acetyl-CoA synthetase (Acs) to acetyl-CoA. ΔpoxB::acs had been developed as an alternative strategy to reduce acetate formation. Our recent research revealed that the combination of inactivation of poxB and overexpression of acetyl-CoA synthetase gene (acs) in the E. coli K strain was successful in controlling acetate accumulation (14).
Metabolic engineering can sometimes induce unexpected reactions in the host cell, such as fluctuations in protein expression levels. In this work, expression levels of DAOCS in different hosts stayed stable; nevertheless, the relative activities of DAOCS in different strains were corrected with the corresponding expression levels in these strains (Fig. 5D). These results clearly indicated that the improvement in G-7-ADCA yields is the direct effect of increased metabolic flux via the TCA cycle, and the catalytic efficiency of DAOCS was also enhanced with a continuous 2OG supply powered by glucose.
Materials and Methods
Materials.
The bacterial strains and plasmids used in this study are listed in Table S2. E. coli DH5α was used for DNA manipulation. E. coli K12 (BW25113) and its derivative strains were used for scDAOCS-H7 expression and G-7-ADCA production. E.coli knockout strains were obtained from the Keio collection (National BioResource Project, NIG) (21). Vector pDB1S (Table S2) was used for gene expression. Plasmid pCP20 was used to remove the FLP recognition target (FRT) -flanked resistant marker in E. coli K12 (Table S2).
Table S2.
Strains and plasmids used in this study
| Strains and plasmids | Genotype or descriptions | Sources |
| Strains | ||
| E. coli DH5α | F− endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK− mK+), λ– | |
| E. coli K12 BW25113 | lacIqrrnBT14ΔlacZWJ16hsdR514 ΔaraBADAH33ΔrhaBADLD78 | National BioResource Project (NIG,Japan) |
| PG01 | △sucA::Kan | National BioResource Project (Japan) (21) |
| PG02 | △sucB::Kan | National BioResource Project (Japan) (21) |
| PG03 | △sucA △poxB::acs | This study |
| PG04 | △sucC::Kan | National BioResource Project (Japan) (21) |
| PG05 | △sucA △poxB::acs △aceA::Kan | This study |
| PG06 | △sucD::Kan | National BioResource Project (Japan) (21) |
| PG07 | △sucA △poxB::acs △iclR::Kan | This study |
| PG08 | △aceA::Kan | National BioResource Project (Japan) (21) |
| PG10 | △poxB::acs-kan | This study |
| PG12 | △ampC::Kan | National BioResource Project (Japan) (21) |
| PG14 | △sucA △ampC::Kan | Present study |
| PG15 | △sucA △poxB::acs △ampC::Kan | Present study |
| PG16 | △sucA△aceA::Kan | Present study |
| PG17 | △aceA △poxB::acs-kan | Present study |
| PG18 | △aceA△ampC::Kan | Present study |
| PG19 | △ampC△poxB::acs-kan | Present study |
| PG20 | △sucA△aceA△ampC::Kan | Present study |
| PG21 | △aceA△ampC△poxB::acs-kan | Present study |
| PG22 | △sucA△poxB::acs△ampC△aceA::kan | Present study |
| Plasmids | ||
| pDB1s | CloDF13 ori; pBAD promoter; Streptomycin resistance | Present study |
| pCP20 | ApR and CmR plasmid with temperature-sensitive replication and thermal induction of FLP synthesis | Datsenko and Wanner (25) |
| pDB1S-H7 | pDB1s with scDAOCS-H7 mutant from S. clavuligerus | Present study |
Penicillin G was purchased from North China Pharmaceutical. G-7-ADCA was provided by Guan-Zhu Xu (Institute of Microbiology, Chinese Academy of Sciences, Beijing, People’s Republic of China).
Culture Conditions.
E. coli strains were grown at 37 °C on a shaker at 250 rpm in Luria-Bertani (LB) medium (1% tryptone, 0.5% yeast extract and 1% NaCl, pH 7.0) with ampicillin (50 µg/mL) or kanamycin (25 µg/mL), added as required. For scDAOCS-H7 expression, overnight cultures were inoculated into an autoinduction medium, ZYM medium (22), with 1% inoculums and incubated with shaking at 30 °C for 16 h. ZYM contains 1% tryptone; 0.5% yeast extract; 25 mM Na2HPO4; 25 mM KH2PO4; 50 mM NH4Cl; 5 mM Na2SO4; 0.5% glycerol; 0.05% glucose; 0.2% l-arabinose; 2 mM MgSO4, and trace metal mix containing 0.05 mM FeCl3, 0.02 mM CaCl2, 0.01 mM MnCl2, 0.01 mM ZnSO4, and 2 mM each of CoCl2, NiCl2, Na2MoO4, Na2SeO3, and H3BO3.
Construction of Recombinant Expression Vectors.
S. clavuligerus scDAOCS H7 was amplified from pET30a-H7 (2) with primer pairs (P1: AACATGCCATGGACACGACGGTGCCCACCTTCA and P2: CCGGAATTCTTACTATGCCTTGGATGTGCGGCGCA; the restriction sites were underlined in primers.) and inserted into the pDB1S at NcoI and EcoRI sites to produce pDB1S-H7. This plasmid was transformed into E. coli strain BW25113 to obtain recombinant strain BW/H7 for the expression of scDAOCS-H7. The expressed scDAOCS-H7 was analyzed by SDS/PAGE. Gel was analyzed by BrandScan 5.0. Protein concentration was determined by the method of Bradford (23) using BSA as a standard.
Gene Knockout.
P1 transduction was used to transfer selectable mutation from one E. coli strain to another. P1 transduction was performed according to Thomason et al. (24). The resistance genes were eliminated by using a helper plasmid pCP20 encoding the FLP recombinase. The mutant strains were analyzed by PCR and further confirmed by sequencing (25).
Bioconversion Conditions.
Cells cultured at 30 °C for 16 h were collected by centrifugation at 8,000 × g for 10 min, and washed with 0.85% NaCl solution twice. For the biotransformation, cells were suspended in the reaction mixture (2 mL) contained 100 mM penicillin G, 0.5% glucose, 3.6 mM FeSO4 and 100 mM Mops buffer to form cell suspension (OD600 nm = 40). The bioconversion reactions were performed at 30 °C and 200 rpm on a shaker. Samples were centrifuged at 10,000 × g for 5 min, filtrated with a 0.22-μm filter membrane and the resulting supernatants were analyzed for penicillin G and G-7-ADCA by HPLC. At least three independent experiments were performed for each strain.
Decomposition Assay of Penicillin G and G-7-ADCA by Host Cell Lysis Solution.
After 12 h of incubation in LB medium at 37 °C and 250 rpm, culture broths from E. coli BW25113 and E. coli ΔampC were centrifuged at 8,000 × g for 10 min at 4 °C. Cells were washed, suspended in 0.1 M Tris⋅HCl buffer (pH 7.5), and treated by ultrasonication on ice and then centrifuged at 12,000 × g for 5 min at 4 °C. The resulting supernatant was designated as the host cell lysis solution. 10 mM penicillin G and 1 mM G-7-ADCA solution were prepared in 0.1 M Tris⋅HCl buffer (pH 7.5). Substrate solutions (100 μL) were mixed with 100 μL of host cell lysis solution (the final concentration 10 OD/mL) in an Eppendorf centrifuge tube, and incubated in a 30 °C water bath for 0–5 h. A natural decomposition control of substrate was prepared by incubating penicillin G and G-7-ADCA with 0.1 M Tris⋅HCl buffer (pH 7.5) under the same conditions.
Analytical Methods.
Cell density was estimated by measuring the optical density at 600 nm. The expression of recombinant enzymes was analyzed by 12% SDS/PAGE analysis.
The concentrations of penicillin G and G-7-ADCA were measured by HPLC (Agilent 1260 series, Hewlett–Packard), equipped with a ZORBAX Eclipse XDB-C18 column (4.6 × 100 mm; Agilent) and a diode-array detector. Analysis was performed at 25 °C at a flow rate of 0.5 mL/min with a mobile phase of 30% (vol/vol) acetonitrile and 70% (vol/vol) water with 0.1% trifluoroacetic acid. Penicillin G was measured at 220 nm and G-7-ADCA was measured at 260 nm. Retention times for G-7-ADCA and penicillin G were 8.6 and 11.2 min, respectively.
The concentration of acetate in the bioconversion was measure by HPLC (Agilent 1260 series, Hewlett–Packard) equipped with a Bio-Rad Aminex HPX-87H column (7.8 × 300 mm) and a diode-array detector. Analysis was performed at 65 °C with a mobile phase of 6 mM H2SO4 at a flow rate of 0.55 mL/min and measurement at 210 nm.
Acknowledgments
This work was supported by Ministry of Science and Technology of China Grant 2013CB734000, Key Research Program of the Chinese Academy of Sciences Grant KGZD-EW-606, and National Natural Science Foundation of China Grant 31170038.
Footnotes
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1502866112/-/DCSupplemental.
References
- 1.Velasco J, et al. Environmentally safe production of 7-aminodeacetoxycephalosporanic acid (7-ADCA) using recombinant strains of Acremonium chrysogenum. Nat Biotechnol. 2000;18(8):857–861. doi: 10.1038/78467. [DOI] [PubMed] [Google Scholar]
- 2.Ji J, et al. Iterative combinatorial mutagenesis as an effective strategy for generation of deacetoxycephalosporin C synthase with improved activity toward penicillin G. Appl Environ Microbiol. 2012;78(21):7809–7812. doi: 10.1128/AEM.02122-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Crawford L, et al. Production of cephalosporin intermediates by feeding adipic acid to recombinant Penicillium chrysogenum strains expressing ring expansion activity. Biotechnology (N Y) 1995;13(1):58–62. doi: 10.1038/nbt0195-58. [DOI] [PubMed] [Google Scholar]
- 4.Cho H, et al. Elucidation of conditions allowing conversion of penicillin G and other penicillins to deacetoxycephalosporins by resting cells and extracts of Streptomyces clavuligerus NP1. Proc Natl Acad Sci USA. 1998;95(20):11544–11548. doi: 10.1073/pnas.95.20.11544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cooper RD. The enzymes involved in biosynthesis of penicillin and cephalosporin; Their structure and function. Bioorg Med Chem. 1993;1(1):1–17. doi: 10.1016/s0968-0896(00)82098-2. [DOI] [PubMed] [Google Scholar]
- 6.Kovacevic S, Weigel BJ, Tobin MB, Ingolia TD, Miller JR. Cloning, characterization, and expression in Escherichia coli of the Streptomyces clavuligerus gene encoding deacetoxycephalosporin C synthetase. J Bacteriol. 1989;171(2):754–760. doi: 10.1128/jb.171.2.754-760.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Valegård K, et al. Structure of a cephalosporin synthase. Nature. 1998;394(6695):805–809. doi: 10.1038/29575. [DOI] [PubMed] [Google Scholar]
- 8.Valegård K, et al. The structural basis of cephalosporin formation in a mononuclear ferrous enzyme. Nat Struct Mol Biol. 2004;11(1):95–101. doi: 10.1038/nsmb712. [DOI] [PubMed] [Google Scholar]
- 9.Tarhonskaya H, et al. Studies on deacetoxycephalosporin C synthase support a consensus mechanism for 2-oxoglutarate dependent oxygenases. Biochemistry. 2014;53(15):2483–2493. doi: 10.1021/bi500086p. [DOI] [PubMed] [Google Scholar]
- 10.Goo K-S, Chua C-S, Sim T-S. Directed evolution and rational approaches to improving Streptomyces clavuligerus deacetoxycephalosporin C synthase for cephalosporin production. J Ind Microbiol Biotechnol. 2009;36(5):619–633. doi: 10.1007/s10295-009-0549-4. [DOI] [PubMed] [Google Scholar]
- 11.Fernández M-J, et al. Stimulatory effect of growth in the presence of alcohols on biotransformation of penicillin G into cephalosporin-type antibiotics by resting cells of Streptomyces clavuligerus NP1. Appl Microbiol Biotechnol. 1999;52(4):484–488. doi: 10.1007/s002530051549. [DOI] [PubMed] [Google Scholar]
- 12.Gao Q, Demain AL. Improvement in the resting-cell bioconversion of penicillin G to deacetoxycephalosporin G by addition of catalase. Lett Appl Microbiol. 2002;34(4):290–292. doi: 10.1046/j.1472-765x.2002.01084.x. [DOI] [PubMed] [Google Scholar]
- 13.Gao Q, Piret JM, Adrio JL, Demain AL. Performance of a recombinant strain of Streptomyces lividans for bioconversion of penicillin G to deacetoxycephalosporin G. J Ind Microbiol Biotechnol. 2003;30(3):190–194. doi: 10.1007/s10295-003-0034-4. [DOI] [PubMed] [Google Scholar]
- 14.Tao Y, Cheng Q, Kopatsis AD. Metabolic engineering for acetate control in large scale fermentation. Methods Mol Biol. 2012;834:283–303. doi: 10.1007/978-1-61779-483-4_18. [DOI] [PubMed] [Google Scholar]
- 15.Waegeman H, et al. Effect of iclR and arcA knockouts on biomass formation and metabolic fluxes in Escherichia coli K12 and its implications on understanding the metabolism of Escherichia coli BL21 (DE3) BMC Microbiol. 2011;11:70. doi: 10.1186/1471-2180-11-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nimmo HG, et al. Regulation of the enzymes at the branchpoint between the citric acid cycle and the glyoxylate bypass in Escherichia coli. Biochem Soc Symp. 1987;54:93–101. [PubMed] [Google Scholar]
- 17.Wang Y, Yu H, Zhang J, Luo H, Shen Z. Double knockout of β-lactamase and cephalosporin acetyl esterase genes from Escherichia coli reduces cephalosporin C decomposition. J Biosci Bioeng. 2012;113(6):737–741. doi: 10.1016/j.jbiosc.2012.02.003. [DOI] [PubMed] [Google Scholar]
- 18.Sauvage E, Kerff F, Terrak M, Ayala JA, Charlier P. The penicillin-binding proteins: Structure and role in peptidoglycan biosynthesis. FEMS Microbiol Rev. 2008;32(2):234–258. doi: 10.1111/j.1574-6976.2008.00105.x. [DOI] [PubMed] [Google Scholar]
- 19.Dittrich CR, Bennett GN, San KY. Characterization of the acetate-producing pathways in Escherichia coli. Biotechnol Prog. 2005;21(4):1062–1067. doi: 10.1021/bp050073s. [DOI] [PubMed] [Google Scholar]
- 20.Phue JN, Lee SJ, Kaufman JB, Negrete A, Shiloach J. Acetate accumulation through alternative metabolic pathways in ackA− pta− poxB− triple mutant in E. coli B (BL21) Biotechnol Lett. 2010;32(12):1897–1903. doi: 10.1007/s10529-010-0369-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Baba T, et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2006;2(1):2006.0008. doi: 10.1038/msb4100050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 2005;41(1):207–234. doi: 10.1016/j.pep.2005.01.016. [DOI] [PubMed] [Google Scholar]
- 23.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
- 24.Thomason LC, Costantino N, Court DL. E. coli genome manipulation by P1 transduction. Curr Protoc Mol Biol. 2007;79(1):1.17.1–1.17.8. doi: 10.1002/0471142727.mb0117s79. [DOI] [PubMed] [Google Scholar]
- 25.Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 2000;97(12):6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]