Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Jul 27;112(32):10038–10043. doi: 10.1073/pnas.1507645112

Gut microbiota facilitates dietary heme-induced epithelial hyperproliferation by opening the mucus barrier in colon

Noortje Ijssennagger a,b,c,1, Clara Belzer a,d, Guido J Hooiveld b, Jan Dekker a,e, Saskia W C van Mil c, Michael Müller a,b, Michiel Kleerebezem a,e,f, Roelof van der Meer a,b
PMCID: PMC4538683  PMID: 26216954

Significance

Consumption of red meat is associated with increased colorectal cancer risk. We show that the gut microbiota is pivotal in this increased risk. Mice receiving a diet with heme, a proxy for red meat, show a damaged gut epithelium and a compensatory hyperproliferation that can lead to colon cancer. Mice receiving heme together with antibiotics do not show this damage and hyperproliferation. Our data indicate that microbial hydrogen sulfide opens the protective mucus barrier and exposes the epithelium to cytotoxic heme. Antibiotics block microbial sulfide production and thereby maintain the mucus barrier that prevents heme-induced hyperproliferation. Our study indicates that fecal trisulfide is a novel biomarker of mucus barrier integrity, which could be of relevance in human colon disease diagnostics.

Keywords: colorectal cancer, red meat, mucus barrier, mucolysis, (tri)sulfides

Abstract

Colorectal cancer risk is associated with diets high in red meat. Heme, the pigment of red meat, induces cytotoxicity of colonic contents and elicits epithelial damage and compensatory hyperproliferation, leading to hyperplasia. Here we explore the possible causal role of the gut microbiota in heme-induced hyperproliferation. To this end, mice were fed a purified control or heme diet (0.5 μmol/g heme) with or without broad-spectrum antibiotics for 14 d. Heme-induced hyperproliferation was shown to depend on the presence of the gut microbiota, because hyperproliferation was completely eliminated by antibiotics, although heme-induced luminal cytotoxicity was sustained in these mice. Colon mucosa transcriptomics revealed that antibiotics block heme-induced differential expression of oncogenes, tumor suppressors, and cell turnover genes, implying that antibiotic treatment prevented the heme-dependent cytotoxic micelles to reach the epithelium. Our results indicate that this occurs because antibiotics reinforce the mucus barrier by eliminating sulfide-producing bacteria and mucin-degrading bacteria (e.g., Akkermansia). Sulfide potently reduces disulfide bonds and can drive mucin denaturation and microbial access to the mucus layer. This reduction results in formation of trisulfides that can be detected in vitro and in vivo. Therefore, trisulfides can serve as a novel marker of colonic mucolysis and thus as a proxy for mucus barrier reduction. In feces, antibiotics drastically decreased trisulfides but increased mucin polymers that can be lysed by sulfide. We conclude that the gut microbiota is required for heme-induced epithelial hyperproliferation and hyperplasia because of the capacity to reduce mucus barrier function.


Colorectal cancer, the second leading cause of cancer death in Western countries, is associated with diets high in red meat (1), whereas consumption of white meat does not have this association (2). Heme, the iron-porphyrin pigment, is present at much higher levels in red compared with white meat. Epidemiological studies show that heme intake is related to colon cancer risk (3, 4). Our previous studies show that when rodents consume heme, their colonic contents become more cytotoxic (5, 6). This increased cytotoxicity injures the colonic epithelial surface cells. To replace the injured surface cells, hyperproliferation from the stem cells in the crypts is initiated. Together with inhibition of apoptosis, this compensatory hyperproliferation leads to hyperplasia (6), which eventually can develop into colorectal cancer.

Dietary heme is poorly absorbed in the small intestine; ∼90% of dietary heme enters the colon (7). Besides the toxic effect of heme on the colonic mucosa, dietary heme affects the microbiota. The relationship between intestinal microbiota and colon cancer has long been suspected (8). In humans, a red meat diet increases Bacteroides spp. in feces (9). We recently showed that in mice, a heme diet changed the microbiota drastically, majorly increasing the Gram-negative bacteria (mainly Bacteroidetes, Proteobacteria, and Verrucomicrobia) (10). The gut microbiota can induce hyperproliferation via mechanisms occurring in the colon lumen, such as modulation of oxidative and cytotoxic stress or by influencing the mucus barrier. Oxidative stress induces the formation of peroxidized lipids, which react with heme to form the cytotoxic heme factor (CHF), thereby increasing cytotoxic stress (5, 11). In a time course study, we showed that there is a lag time in the formation of CHF and in the induction of hyperproliferation when mice are transferred from a control to heme diet (11). This lag time could be due to a time-dependent adaptation of the microbiota to the heme diet. Notably, heme does not increase cytotoxicity and epithelial hyperproliferation in the small intestine (12), indicating that formation of CHF only occurs in the colon where bacterial density is high. Moreover, these experiments suggested that CHF-induced hyperproliferation coincided with a reduced mucus barrier function (11), leading to enhanced contact of colonocytes with microbiota and toxic substances. In the present study, we investigate whether bacteria play a causal role in heme-induced cytotoxicity and hyperproliferation by using broad-spectrum antibiotics (Abx). Our results illustrate the crucial role of the gut microbiota in heme-induced hyperproliferation and indicate the involvement of microbial hydrogen sulfide formation in reduction of the polymeric mucin network to degrade the protective mucus barrier and expose the colon mucosa to CHF.

Results

Heme- and Abx-Induced Changes in the Colonic Lumen.

Mice were divided into four groups receiving either a control diet (C-group), a heme diet (H-group), a control diet with Abx treatment (CA-group), or a heme diet with Abx treatment (HA-group). After 2 wk of intervention the H- and HA-group had a lower body weight compared with their controls (Table 1). Fecal dry and wet weight was significantly increased in the HA-group.

Table 1.

Effects of heme and Abx on body weight and fecal parameters

Variable Control Heme Control + Abx Heme + Abx
Body weight (g) 27.7 ± 0.5a 24.9 ± 0.5b 27.2 ± 0.3a 24.8 ± 0.4b
Fecal wet weight (g/d) 0.49 ± 0.08a 0.60 ± 0.05a 0.62 ± 0.09a 1.20 ± 0.19b
Fecal dry weight (g/d) 0.12 ± 0.01a 0.11 ± 0.01a 0.12 ± 0.01a 0.19 ± 0.02b
TBARS (MDA equivalents, µmol/L) 12.70 ± 1.43a 59.84 ± 2.46b 11.06 ± 1.63a 46.06 ± 3.92c
Cytotoxicity (% lysis) 1.09 ± 0.45a 66.90 ± 10.45b 0.05 ± 0.04a 31.30 ± 8.98c

Data are represented as mean ± SEM (n = 9/group). Differences between the groups were tested by ANOVA with a Bonferroni post hoc test and different superscripts indicate significant differences (P < 0.05).

To confirm that Abx decreased the abundance of bacteria, quantitative PCR (qPCR) analyses with specific primers targeting total bacteria, Bacteroidetes, or Firmicutes were performed (Fig. 1A). Abx treatment significantly reduced the abundance of total bacteria and Firmicutes ∼100-fold and Bacteroidetes ∼1,000-fold. Moreover, the H-group had a significantly increased abundance of Bacteroidetes compared with the C-group, which corroborates previous observations (10). Abx thus drastically decreased the bacterial density, affecting both Gram-positive Firmicutes and Gram-negative Bacteroidetes. To study how this impacts the normal microbial modification of host compounds, we determined the fecal bile acid composition. No conjugated bile acids were detected in fecal water in the C- and H-group, where unconjugated and secondary bile acids were predominant (Fig. 1B). However, with Abx almost all bile acids were primary and conjugated with glycine or taurine (ratio about 3), showing that Abx blocked microbial bile deconjugation and dehydroxylation almost completely.

Fig. 1.

Fig. 1.

(A) Counts of total bacteria, Bacteroidetes, and Firmicutes measured by qPCR. Control bars are set at 100%, and other bars are relative to controls; mean ± SEM (n = 9/group). (B) Bile acid profiles determined by HPLC; mean ± SEM (n = 3/group). Letters indicate significant different groups (P < 0.05), ANOVA with Bonferroni post hoc test. Gly, glycine conjugated; Sec, secondary; Tau, taurine conjugated.

Heme increases oxidative and cytotoxic stress in the colon (10, 11). Reactive oxygen species (ROSs) induce the formation of lipid peroxides that react with heme to form CHF, thereby increasing the cytotoxicity of luminal contents (5, 11). We determined lipid peroxidation product levels by measuring thiobarbituric acid reactive substances (TBARS) in fecal water. TBARS were low in the C- and CA-group (Table 1) and increased significantly and to a similar extent in the H- and HA-group, implying that heme, both in presence and absence of Abx, induced ROS stress. Analogously, fecal water cytotoxicity (Table 1) was significantly increased in the H- and HA-group compared with their controls. Because Abx drastically reduced microbiota density (100- to 1,000-fold), but only slightly reduced cytotoxicity (2-fold) and TBARS (1.3-fold), it is unlikely that bacteria play a major role in the formation of TBARS and cytotoxicity.

Heme- and Abx-Induced Changes in the Colonic Mucosa.

Morphology analyses of H&E-stained colon tissue (Fig. 2A) confirmed the previously reported heme-induced increased crypt depth (H- vs. C-group). Abx treatment did not affect the colon morphology in the CA- vs. C-group but completely restored tissue morphology in the HA- vs. H-group. The crypt depth increase in the H-group did not result from inflammation because neutrophil and macrophage infiltration in the lamina propria was comparable to the C-group. Analogous to earlier reports (6), cell proliferation quantification using Ki67 staining (Fig. 2 B and C) shows that the heme diet strongly induced cell proliferation (H- vs. C-group), leading to expansion of the proliferative compartment and increased crypt depth. Abx treatment led to slightly reduced numbers of cells per crypt in the CA- vs. C-group, but did not significantly affect their labeling index or amount of proliferative cells. However, Abx treatment in the heme diet (HA- vs. H-group) completely suppressed heme-induced hyperproliferation and hyperplasia to levels observed in the C- and CA-groups (Fig. 2C). In conclusion, heme-induced hyperproliferation and hyperplasia in mouse colon only occurs in the presence of the gut microbiota.

Fig. 2.

Fig. 2.

(A) Histochemical H&E staining and (B) immunohistochemical Ki67 staining of colon of control and heme-fed mice. (C) Quantification of Ki67-positive cells per crypt, total number of cells per crypt, and labeling index (percentage of proliferative cells per crypt); mean ± SEM (n = 9/group). Letters indicate significant different groups (P < 0.05), ANOVA with Bonferroni post hoc test.

Abx Block the Heme-Induced Expression of Cell Cycle Genes.

Using whole genome transcriptomics we investigated whether the physiological changes were reflected in gene expression profiles. The heme diet (H- vs. C-group) led to 5,507 differentially expressed genes (q < 0.01), of which almost 90% (4,859) were not significantly affected in the HA vs. CA comparison (Fig. S1A). The 4,859 genes specific for the H-group were analyzed by GSEA, indicating that mainly cell cycle related processes were affected by heme (Fig. S1B). Moreover, mining of these genes for the involved transcription factors (Fig. S1C), revealed that Cdkn2a, Smarcb1, and the tumor suppressors Tp53 and Rb1 were inhibited, whereas oncogenes such as Myc and Foxm1, as well as cell cycle regulators E2f1 and Tbx2, were activated by heme. Importantly, these processes and transcription factors were not modulated in the HA-group compared with the CA-group. There were only 369 differentially expressed genes unique for the HA-group (Fig. S1A). Notably, none of the modulated processes identified in the HA-group related to the end points of our study. Because of the specific heme-Abx interaction, the Abx-mediated differential gene expression profiles and processes were substantially different in the heme diet background (Tables S1 and S2) compared with the control diet background (Tables S3 and S4). These observations indicate that heme-induced mucosal gene expression changes of cell cycle-related processes require the presence of the microbiota, which is in agreement with the microbiota requirement for the increased labeling index (Fig. 2C).

Fig. S1.

Fig. S1.

(A) Venn diagram showing the numbers of heme and heme plus Abx-specific regulated genes and of overlapping genes (q < 0.01). (B) GSEA showing positive enriched processes. Sources of gene sets are indicated in superscript and represent (1) gene ontology, (2) reactome, and (3) KEGG. Size represents the number of genes in the gene-set and NES is normalized enrichment score, which is the enrichment score for the gene set after it has been normalized to account for variations in gene set size. (C) Ingenuity analysis showing activated or inhibited transcription factors (z-score > 2 and P < 0.05) in both treatments specifically and in overlapping genes.

Table S1.

Fifty highest up-regulated genes (q < 0.01) in mouse colon scrapings for the comparison of heme Abx vs. heme

Gene symbol Gene description SI ± SEM Fold change (heme + Abx vs. heme) SI ± SEM Fold change (control + Abx vs. control)
Heme Heme + Abx Control Control + Abx
SI SEM SI SEM SI SEM SI SEM
Gbp2 Guanylate binding protein 2 96 24 412 102 4.0 303 77 962 234 NS
Slc6a19 Solute carrier family 6 (neurotransmitter transporter), member 19 81 14 320 53 3.9 21 2 60 6 2.8
Enpep Glutamyl aminopeptidase 145 10 557 41 3.8 209 21 265 18 NS
Slc5a4b Solute carrier family 5 (neutral amino acid transporters, system A), member 4b 52 5 197 23 3.7 14 0 16 1 NS
Abcc2 ATP-binding cassette, subfamily C (CFTR/MRP), member 2 115 15 425 49 3.7 40 5 42 3 NS
Ace2 Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 67 7 239 32 3.5 93 6 165 4 1.8
Cyp3a25 Cytochrome P450, family 3, subfamily a, polypeptide 25 21 1 79 14 3.5 21 3 15 1 NS
Sis Sucrase isomaltase (alpha-glucosidase) 29 3 105 23 3.3 117 19 147 16 NS
2010106E10Rik RIKEN cdna 2010106E10 gene 60 7 191 13 3.2 70 5 82 3 NS
Trac T-cell receptor alpha constant 97 14 274 27 2.8 127 10 320 24 2.5
1810030J14Rik RIKEN cDNA 1810030J14 gene 666 76 1,664 82 2.5 2,451 249 2,909 158 NS
Cyp4f39 Cytochrome P450, family 4, subfamily f, polypeptide 39 38 4 92 6 2.5 23 2 23 1 NS
Dbp D site albumin promoter binding protein 111 22 274 40 2.4 608 33 399 60 NS
Naaladl1 N-acetylated alpha-linked acidic dipeptidase-like 1 522 7 1,275 71 2.4 880 88 925 50 NS
Slc13a1 Solute carrier family 13 (sodium/sulfate symporters), member 1 141 22 336 25 2.4 786 120 974 71 NS
Rsad2 Radical S-adenosyl methionine domain containing 2 57 9 139 21 2.4 56 1 152 15 2.7
Npc1l1 NPC1-like 1 37 3 100 23 2.4 33 2 49 4 NS
Gcg Glucagon 586 25 1,354 60 2.3 491 22 580 7 NS
Sstr1 Somatostatin receptor 1 112 8 255 8 2.3 234 19 226 6 NS
Gm10768 Predicted gene 10768 10 1 24 3 2.2 7 1 8 0 NS
Per3 Period homolog 3 (Drosophila) 81 10 174 19 2.1 286 14 198 27 NS
Cyp2f2 Cytochrome P450, family 2, subfamily f, polypeptide 2 107 5 223 13 2.1 426 32 218 13 −2.0
Ddx60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 83 14 173 26 2.1 115 10 486 78 4.1
Gbp6 Guanylate binding protein 6 90 9 191 29 2.0 188 27 323 49 NS
Ccl5 Chemokine (C-C motif) ligand 5 99 5 203 20 2.0 163 7 267 18 1.6
Tgm3 Transglutaminase 3, E polypeptide 1,397 179 2,766 166 2.0 4,496 132 3,340 110 NS
Ang4 Angiogenin, ribonuclease A family, member 4 158 6 320 27 2.0 570 126 581 81 NS
Oasl2 2'-5′ Oligoadenylate synthetase-like 2 217 39 432 66 2.0 247 12 905 123 3.6
Cml5 Camello-like 5 16 0 31 2 2.0 20 1 19 1 NS
Rtp4 Receptor transporter protein 4 93 14 187 29 2.0 111 10 331 42 3.0
Slc37a2 Solute carrier family 37 (glycerol-3-phosphate transporter), member 2 329 41 641 58 2.0 933 67 830 76 NS
Apob Apolipoprotein B 501 34 982 67 1.9 752 26 797 41 NS
Gm129 Predicted gene 129 50 5 98 11 1.9 160 15 104 13 NS
Slc6a20a Solute carrier family 6 (neurotransmitter transporter), member 20A 98 5 190 6 1.9 234 12 228 10 NS
Rnf212 Ring finger protein 212 124 5 245 23 1.9 132 16 117 6 NS
Ces1d Carboxylesterase 1D 343 21 654 25 1.9 335 32 284 8 NS
Slc10a2 Solute carrier family 10, member 2 169 20 321 25 1.9 376 63 536 46 NS
Gsdmc3 Gasdermin C3 1,006 92 1,906 101 1.9 2744 138 2,631 181 NS
Ces1g Carboxylesterase 1G 1,947 44 3,710 177 1.9 757 138 766 47 NS
Edn1 Endothelin 1 212 43 380 20 1.9 495 22 267 32 −1.9
Cck Cholecystokinin 47 2 88 5 1.9 44 1 42 2 NS
Gdpd2 Glycerophosphodiester phosphodiesterase domain containing 2 78 4 145 7 1.9 97 14 114 8 NS
Ifit3 IFN-induced protein with tetratricopeptide repeats 3 55 3 106 13 1.9 79 3 210 45 2.5
G6pc Glucose-6-phosphatase, catalytic 19 2 37 5 1.9 14 1 16 1 NS
Slc7a8 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 135 6 250 14 1.8 296 25 235 21 NS
Bmp3 Bone morphogenetic protein 3 270 8 498 21 1.8 564 49 395 21 −1.4
Trim30d Tripartite motif-containing 30D 96 10 176 13 1.8 248 16 369 47 NS
Irf7 IFN regulatory factor 7 355 21 649 26 1.8 495 19 1,052 97 2.1
Slc35e3 Solute carrier family 35, member E3 156 8 285 14 1.8 167 12 106 5 −1.6
Ccl8 Chemokine (C-C motif) ligand 8 30 3 55 6 1.8 22 3 81 8 3.7

Table includes only genes with a signal intensity > 20 in at least one condition. n = 4 per group for Control, Control Abx, and Heme; n = 6 per group for Heme Abx. SI, signal intensity.

Table S2.

Fifty highest down-regulated genes (q < 0.01) in mouse colon scrapings for the comparison of heme Abx vs. heme

Gene symbol Gene description SI ± SEM Fold change (heme + Abx vs. heme) SI ± SEM Fold change (control + Abx vs. control)
Heme Heme + Abx Control Control + Abx
SI SEM SI SEM SI SEM SI SEM
Reg3b Regenerating islet-derived 3 beta 1,385 309 66 7 −19.5 566 297 84 19 NS
Reg3g Regenerating islet-derived 3 gamma 1,115 170 118 10 −9.2 337 167 125 20 NS
Slpi Secretory leukocyte peptidase inhibitor 511 58 167 14 −3.1 60 4 118 28 1.9
AI747448 Expressed sequence AI747448 570 94 225 49 −2.7 71 12 187 21 2.7
Capg Capping protein (actin filament), gelsolin-like 724 32 272 13 −2.7 164 11 196 18 NS
Dhrs9 Dehydrogenase/reductase (SDR family) member 9 639 56 243 17 −2.6 227 15 190 29 NS
Trim29 Tripartite motif-containing 29 197 8 76 6 −2.6 29 1 38 4 NS
Spp1 Secreted phosphoprotein 1 51 5 20 1 −2.6 17 0 22 2 NS
Fabp1 Fatty acid binding protein 1, liver 606 99 249 22 −2.4 19 1 17 1 NS
Mfsd2a Major facilitator superfamily domain containing 2A 138 20 60 6 −2.3 51 5 71 11 NS
Mcpt2 Mast cell protease 2 130 17 57 5 −2.3 26 2 33 3 NS
Nov Nephroblastoma overexpressed gene 654 64 305 35 −2.2 695 79 598 16 NS
Lpcat4 Lysophosphatidylcholine acyltransferase 4 460 28 215 9 −2.1 244 6 281 13 NS
Nt5dc2 5′-nucleotidase domain containing 2 232 12 110 5 −2.1 100 3 112 9 NS
Mcpt1 Mast cell protease 1 65 9 31 3 −2.1 24 2 29 2 NS
Fer1l4 Fer-1-like 4 (C. Elegans) 83 9 41 2 −2.0 27 2 46 4 1.7
Il1rl1 Interleukin 1 receptor-like 1 63 5 31 1 −2.0 20 1 39 3 2.0
Tnfrsf8 Tumor necrosis factor receptor superfamily, member 8 66 6 34 1 −1.9 23 1 42 6 1.8
Duoxa2 Dual oxidase maturation factor 2 137 4 73 3 −1.9 177 27 151 22 NS
Fads3 Fatty acid desaturase 3 316 17 173 6 −1.8 162 6 150 12 NS
Cpn1 Carboxypeptidase N, polypeptide 1 402 22 226 18 −1.8 264 28 256 19 NS
Hist1h2ab Histone cluster 1, h2ab 205 19 115 10 −1.8 68 5 117 12 1.7
E2f2 E2F transcription factor 2 191 6 109 5 −1.8 60 3 110 12 1.8
Rdh9 Retinol dehydrogenase 9 127 4 73 5 −1.8 103 6 78 3 NS
Pnpla1 Patatin-like phospholipase domain containing 1 74 9 42 3 −1.7 57 5 49 5 NS
Fkbp11 FK506 binding protein 11 69 2 40 1 −1.7 43 3 49 1 NS
4632434I11Rik RIKEN cdna 4632434I11 gene 89 5 52 3 −1.7 38 1 57 5 1.5
Plau Plasminogen activator, urokinase 68 7 40 4 −1.7 48 7 60 5 NS
Pla2g2a Phospholipase A2, group IIA (platelets, synovial fluid) 103 7 60 3 −1.7 43 3 68 3 1.6
Spon2 Spondin 2, extracellular matrix protein 114 13 66 5 −1.7 71 3 78 7 NS
Tat Tyrosine aminotransferase 191 21 111 6 −1.7 439 31 268 6 −1.6
Plvap Plasmalemma vesicle associated protein 171 5 101 5 −1.7 114 17 111 10 NS
2310016C08Rik RIKEN cdna 2310016C08 gene 108 16 62 4 −1.7 63 2 58 3 NS
Nrg1 Neuregulin 1 255 9 155 14 −1.7 83 10 199 14 2.4
Myl7 Myosin, light polypeptide 7, regulatory 55 3 33 2 −1.7 33 2 45 4 NS
Expi Extracellular proteinase inhibitor 53 3 32 1 −1.7 43 3 33 2 NS
Nek2 NIMA (never in mitosis gene a)-related expressed kinase 2 288 13 177 11 −1.6 98 6 174 10 1.8
Duox2 Dual oxidase 2 391 25 237 6 −1.6 611 66 490 56 NS
Bmp8b Bone morphogenetic protein 8b 152 7 93 5 −1.6 66 4 68 3 NS
Cdca3 Cell division cycle associated 3 465 18 285 13 −1.6 168 7 282 14 1.7
Ripk3 Receptor-interacting serine-threonine kinase 3 315 16 194 7 −1.6 166 6 237 4 1.4
Rbp4 Retinol binding protein 4, plasma 209 1 129 4 −1.6 178 18 189 13 NS
4930547N16Rik RIKEN cdna 4930547N16 gene 144 6 90 6 −1.6 54 3 86 8 1.6
Aurka Aurora kinase A 290 10 180 10 −1.6 111 5 178 19 1.6
Igsf10 Ig superfamily, member 10 142 7 88 3 −1.6 110 14 134 16 NS
Eef1g Eukaryotic translation elongation factor 1 gamma 143 13 88 3 −1.6 76 7 108 10 1.4
Dlgap5 Discs, large (Drosophila) homolog-associated protein 5 171 5 107 6 −1.6 77 4 122 10 1.6
Cdc25c Cell division cycle 25 homolog C (S. Pombe) 85 4 53 3 −1.6 34 1 54 4 1.6
Dkkl1 Dickkopf-like 1 34 1 21 1 −1.6 23 0 25 1 NS
Cenpa Centromere protein A 393 16 247 11 −1.6 170 9 256 13 1.5

Table includes only genes with a signal intensity > 20 in at least one condition. n = 4 per group for Control, Control Abx, and Heme; n = 6 per group for Heme Abx.

Table S3.

Fifty highest up-regulated genes (q < 0.01) in mouse colon scrapings for the comparison of control Abx vs. control

Gene symbol Gene description SI ± SEM Fold change (heme + Abx vs. heme) SI ± SEM Fold change (control + Abx vs. control)
Heme Heme + Abx Control Control + Abx
SI SEM SI SEM SI SEM SI SEM
Ighv1-85 Ig heavy variable 1–85 99 40 64 16 NS 20 8 135 62 5.7
Ighv8-12 Ig heavy variable V8-12 561 61 439 35 NS 196 41 1,111 246 5.6
Cxcl9 Chemokine (C-X-C motif) ligand 9 75 12 236 59 NS 62 18 326 47 5.6
Gm12250 Predicted gene 12250 32 6 81 22 NS 37 9 190 39 5.1
Ifi44 IFN-induced protein 44 70 7 124 21 NS 66 6 340 82 4.8
Oas3 2'-5′ oligoadenylate synthetase 3 50 5 97 14 NS 51 5 241 41 4.6
Ddx60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 83 14 173 26 2.1 115 10 486 78 4.1
Usp18 Ubiquitin specific peptidase 18 67 9 89 16 NS 48 4 204 39 4.1
Ccl8 Chemokine (C-C motif) ligand 8 30 3 55 6 1.8 22 3 81 8 3.7
Gm5431 Predicted gene 5431 17 3 61 15 NS 49 11 185 48 3.7
Oas2 2'-5′ oligoadenylate synthetase 2 63 8 94 13 NS 56 3 215 42 3.6
Oasl2 2'-5′ oligoadenylate synthetase-like 2 217 39 432 66 2.0 247 12 905 123 3.6
Ifi47 IFN gamma inducible protein 47 69 14 128 28 NS 79 16 265 44 3.4
H2-DMa Histocompatibility 2, class II, locus dma 112 8 175 17 NS 99 9 340 50 3.3
Gm9740 Predicted gene 9740 116 50 191 43 NS 76 8 251 37 3.3
Igkv1-117 Ig kappa chain variable 1–117 522 13 518 54 NS 355 57 1,201 259 3.2
Apol9b Apolipoprotein L 9b 22 2 37 3 NS 21 4 66 11 3.2
Ifit1 IFN-induced protein with tetratricopeptide repeats 1 129 21 255 39 NS 188 13 610 94 3.1
Apol7c Apolipoprotein L 7c 43 7 41 6 NS 29 3 89 7 3.1
Apol9a Apolipoprotein L 9a 73 4 110 13 NS 68 7 213 34 3.1
H2-Q6 Histocompatibility 2, Q region locus 6 185 8 303 25 1.6 178 13 561 91 3.1
Ubd Ubiquitin D 18 1 28 4 NS 17 1 58 15 3.0
H2-Aa Histocompatibility 2, class II antigen A, alpha 525 29 791 55 NS 482 47 1,484 213 3.0
H2-Q9 Histocompatibility 2, Q region locus 9 104 11 160 16 NS 88 3 279 48 3.0
Igtp IFN gamma induced gtpase 47 7 107 26 NS 71 13 222 44 3.0
Rtp4 Receptor transporter protein 4 93 14 187 29 2.0 111 10 331 42 3.0
Gm4951 Predicted gene 4951 28 2 54 10 NS 35 6 118 37 2.9
Slc6a19 Solute carrier family 6 (neurotransmitter transporter), member 19 81 14 320 53 3.9 21 2 60 6 2.8
H2-Ab1 Histocompatibility 2, class II antigen A, beta 1 698 30 965 62 NS 607 68 1,677 189 2.8
Herc6 Hect domain and RLD 6 69 8 135 19 NS 118 9 340 65 2.7
Cd74 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) 877 38 1160 94 NS 775 70 2,112 221 2.7
Gbp3 Guanylate binding protein 3 43 5 71 12 NS 56 9 157 31 2.7
AI747448 Expressed sequence AI747448 570 94 225 49 −2.7 71 12 187 21 2.7
Zbp1 Z-DNA binding protein 1 98 13 148 23 NS 142 21 395 76 2.7
Psmb8 Proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) 70 7 120 14 NS 88 11 249 47 2.7
Rsad2 Radical S-adenosyl methionine domain containing 2 57 9 139 21 2.4 56 1 152 15 2.7
Tap1 Transporter 1, ATP-binding cassette, subfamily B (MDR/TAP) 134 11 243 36 NS 161 18 439 72 2.6
Gm5571 Predicted gene 5571 429 102 439 71 NS 250 29 691 159 2.6
Dnase1l3 Dnase 1-like 3 59 3 104 9 1.7 53 2 138 5 2.6
Nlrc5 NLR family, CARD domain containing 5 45 3 68 7 NS 42 3 110 16 2.5
Trac T-cell receptor alpha constant 97 14 274 27 2.8 127 10 320 24 2.5
Gbp8 Guanylate-binding protein 8 43 3 73 8 NS 47 6 120 17 2.5
Ifit3 IFN-induced protein with tetratricopeptide repeats 3 55 3 106 13 1.9 79 3 210 45 2.5
Ifit2 IFN-induced protein with tetratricopeptide repeats 2 28 1 39 4 NS 32 1 87 21 2.5
Upp1 Uridine phosphorylase 1 322 46 542 66 NS 518 53 1,280 148 2.5
Tfrc Transferrin receptor 493 105 567 38 NS 288 2 708 30 2.4
Dhx58 DEXH (Asp-Glu-X-His) box polypeptide 58 81 7 111 10 NS 74 4 184 23 2.4
Nrg1 Neuregulin 1 255 9 155 14 −1.7 83 10 199 14 2.4
H2-DMb1 Histocompatibility 2, class II, locus Mb1 28 1 44 2 NS 30 5 73 12 2.4
Irgm2 Immunity-related gtpase family M member 2 146 22 343 68 NS 250 34 597 87 2.3

Table includes only genes with a signal intensity > 20 in at least one condition. n = 4 per group for Control, Control Abx, and Heme; n = 6 per group for Heme Abx.

Table S4.

Fifty highest down-regulated genes (q < 0.01) in mouse colon scrapings for the comparison of control Abx vs. control

Gene symbol Gene description SI ± SEM Fold change (heme + Abx vs. heme) Signal intensity (SI) ± SEM. Fold change (control + Abx vs. control)
Heme Heme + Abx Control Control + Abx
SI SEM SI SEM SI SEM SI SEM
Des Desmin 622 84 933 220 NS 2,474 559 674 195 −3.8
Cnn1 Calponin 1 629 95 955 216 NS 2,419 531 680 205 −3.7
Tacr2 Tachykinin receptor 2 87 9 128 23 NS 330 77 93 21 −3.4
Calb2 Calbindin 2 24 3 41 6 NS 102 23 29 5 −3.4
Synpo2 Synaptopodin 2 132 23 188 38 NS 512 123 143 27 −3.3
Actg2 Actin, gamma 2, smooth muscle, enteric 653 81 1,020 213 NS 2,343 483 748 219 −3.3
Pgm5 Phosphoglucomutase 5 286 42 445 89 NS 978 211 295 68 −3.2
Hspb8 Heat shock protein 8 78 11 111 18 NS 236 47 73 12 −3.1
Hspb7 Heat shock protein family, member 7 (cardiovascular) 51 4 65 8 NS 183 39 56 8 −3.1
Chrm2 Cholinergic receptor, muscarinic 2, cardiac 95 13 124 26 NS 280 56 93 27 −3.1
Kcnmb1 Potassium large conductance calcium-activated channel, subfamily M, beta member 1 88 8 108 15 NS 255 52 80 15 −3.1
Kcnip4 Kv channel interacting protein 4 21 3 32 6 NS 86 23 26 6 −3.1
Stmn2 Stathmin-like 2 50 5 89 16 NS 210 40 67 10 −3.1
Flnc Filamin C, gamma 92 6 114 18 NS 285 63 88 14 −3.0
Hspb6 Heat shock protein, alpha-crystallin-related, B6 263 21 325 48 NS 784 166 255 57 −3.0
Myl9 Myosin, light polypeptide 9, regulatory 780 90 1,206 215 NS 2,647 502 885 181 −3.0
Tagln Transgelin 319 40 457 89 NS 1,035 222 338 65 −2.9
Atp2b4 Atpase, Ca++ transporting, plasma membrane 4 125 15 198 39 NS 465 103 152 25 −2.9
Myh11 Myosin, heavy polypeptide 11, smooth muscle 573 83 886 183 NS 2,068 413 698 135 −2.9
Nmu Neuromedin U 17 1 27 4 NS 73 13 26 6 −2.9
Chrna3 Cholinergic receptor, nicotinic, alpha polypeptide 3 41 4 70 11 NS 165 37 54 9 −2.9
Bves Blood vessel epicardial substance 41 4 53 7 NS 125 27 42 6 −2.8
Grp Gastrin releasing peptide 28 2 49 8 NS 125 28 43 8 −2.8
Cd59a CD59a antigen 69 9 105 20 NS 231 55 76 10 −2.8
Popdc2 Popeye domain containing 2 40 4 56 9 NS 126 26 45 11 −2.8
Htr3a 5-hydroxytryptamine (serotonin) receptor 3A 20 1 26 2 NS 53 10 18 3 −2.8
Scube2 Signal peptide, CUB domain, EGF-like 2 37 4 48 8 NS 112 28 36 4 −2.7
Rit2 Ras-like without CAAX 2 21 1 28 3 NS 67 16 23 3 −2.7
Klk15 Kallikrein related-peptidase 15 23 2 31 4 NS 95 12 35 4 −2.7
Pcp4l1 Purkinje cell protein 4-like 1 103 9 152 27 NS 319 54 119 24 −2.7
Pdlim3 PDZ and LIM domain 3 394 42 522 88 NS 1,175 237 417 63 −2.7
Cpe Carboxypeptidase E 100 10 139 16 NS 344 60 126 19 −2.7
Syt1 Synaptotagmin I 35 3 56 7 NS 132 27 47 8 −2.7
Cacnb2 Calcium channel, voltage-dependent, beta 2 subunit 44 3 65 10 NS 148 29 54 9 −2.7
Ppyr1 Pancreatic polypeptide receptor 1 24 2 32 6 NS 75 16 26 4 −2.7
Myom1 Myomesin 1 43 4 55 7 NS 133 31 45 3 −2.6
Rbpms2 RNA binding protein with multiple splicing 2 52 1 78 10 NS 144 30 52 8 −2.6
Snap25 Synaptosomal-associated protein 25 73 6 114 13 NS 259 45 98 15 −2.6
Cryab Crystallin, alpha B 70 4 87 13 NS 218 44 83 15 −2.5
Penk Preproenkephalin 70 9 110 17 NS 264 53 99 12 −2.5
Art3 ADP ribosyltransferase 3 49 6 67 9 NS 132 26 50 6 −2.5
Mir145 Microrna 145 100 18 131 22 NS 325 69 124 12 −2.5
Slc30a10 Solute carrier family 30, member 10 47 3 49 4 NS 256 34 105 17 −2.5
Cckar Cholecystokinin A receptor 21 1 31 5 NS 68 13 27 4 −2.5
Slc2a4 Solute carrier family 2 (facilitated glucose transporter), member 4 42 5 69 9 NS 122 23 48 5 −2.5
Tmem90b Transmembrane protein 90B 36 3 48 6 NS 112 25 42 4 −2.4
Myocd Myocardin 65 7 79 9 NS 176 30 70 9 −2.4
Slc7a14 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 30 2 46 7 NS 90 19 35 4 −2.4
Htr2b 5-hydroxytryptamine (serotonin) receptor 2B 14 1 22 3 NS 49 12 19 2 −2.4
Ckb Creatine kinase, brain 525 31 486 70 NS 931 183 372 51 −2.4

Table includes only genes with a signal intensity > 20 in at least one condition. n = 4 per group for Control, Control Abx, and Heme; n = 6 per group for Heme Abx.

Abx Do Not Affect the Heme-Induced Antioxidant Response.

A set of 648 genes was significantly regulated in both the H- and HA-group compared with their controls (Fig. S1A). Of those shared genes, 599 were similarly regulated in both groups. Notably, this group of genes included the activation of several transcription factors, including the PPARs, involved in fatty acid metabolism, and Nrf2, involved in antioxidant response (Fig. S1 B and C). These data imply that oxidative stress and lipid peroxidation products induced the antioxidant response and the induction of PPAR target genes in the mucosa, irrespective of the addition of Abx to the heme diet.

Abx Block the Mucosal Sensing of Heme-Induced Luminal Cytotoxicity.

In the colon, the mucus preserves the epithelial barrier by protecting the surface epithelial cells through creating a diffusion barrier for toxic micelles (13). In the HA-group, substantial luminal cytotoxicity was present but did not induce hyperproliferation, indicating that CHF did not reach the surface epithelial cells. We investigated epithelial sensing of cytotoxicity using the marker genes survivin (Birc5), immediately early response 3 (Ier3), the necrosis facilitator Ripk3, and secretory leukocyte protease inhibitor (Slpi), which are up-regulated by cell injury as described earlier (11, 14). In the present study, heme up-regulated the expression of these cytotoxicity sensors only in the H-group but not in the HA-group (Fig. 3A). In addition, Fig. 3B shows that heme only injured surface cells, which corroborates our laser capture analysis (6). Taken together, these results indicate that the microbiota is required for the cytotoxic micelles to reach the surface epithelium, as the diffusion barrier of the mucus layer was maintained by Abx.

Fig. 3.

Fig. 3.

(A) Gene expression of injury markers Birc5, Ier3, Ripk3, and Slpi. (B) immunohistochemical colonic Slpi staining of control and heme-fed mice. (C) Gene expression of mucin genes 1–4 and Galnt 3 and 12. Expression levels of control is set at 1. Expression of other bars is relative to controls; mean ± SEM (n = 4 for C, H, and CA; n = 6 for HA). Letters indicate significant differences (P < 0.05), ANOVA with Bonferroni post hoc test.

An increased mucus barrier could be caused by increased mucin synthesis or by decreased mucin degradation. Expression levels of secreted Muc2 and cell-associated Muc4 were decreased in the HA- compared with the H-group (Fig. 3C). Moreover, the Kyoto Encyclopedia of Genes and Genomes pathway mucin type O-glycan biosynthesis was significantly repressed in the HA- compared with the H-group, according to GSEA analysis (q = 0.049). For instance, Galnt 3 and 12, involved in the first step of o-glycosylation, were down-regulated by Abx (Fig. 3C), indicating that mucus layer production is most probably decreased by Abx. Regarding mucus degradation, it is well established that the microbiota degrades mucins and uses their carbohydrates and amino acids as substrates for growth. In addition, sulfate-reducing bacteria (SRBs) use mucin-derived sulfate as electron acceptor in anaerobic respiration forming sulfides. As the Abx treatment drastically reduced the microbiota density, we hypothesized that Abx increased the mucus barrier by preventing microbial degradation of mucin. Notably, the abundance of the mucin-degrading Akkermansia muciniphila was eightfold increased by heme, whereas Abx reduced the abundance of this mucin degrader more than 1,000-fold (Fig. 4A). This result implies that the relative reduction of the Akkermansia population by Abx exceeded the overall effect of Abx on the total microbial load, supporting that Abx treatment could increase mucus barrier function by strongly reducing the levels of mucin degraders such as Akkermansia.

Fig. 4.

Fig. 4.

(A) Bacterial counts of A. muciniphila and SRB determined by qPCR. Controls are set at 100%, and other bars are relative to controls; mean ± SEM (n = 8–9/group). Letters indicate significant different groups (P < 0.05). (B) Rate and extent of S-S bond splitting and synthesis of trisulfide bonds; mean ± SD (n = 3–6/group). *Significant difference with thiol groups (P < 0.05). (C) Reaction scheme by which sulfide splits S-S bonds. (D) Concentrations of sulfides in fecal water; mean ± SEM (n = 8–9/group). (E) Excretion of fecal mucins, expressed as µmoles O-glycan per day (n = 6–9/group). (F) Western blot analysis of fecal mucin with or without DTT as reducing agent and with sulfide. Samples were stained with anti-Muc2 antibody. Each lane represents a pool of n = 9/group. Letters indicate significant different groups (P < 0.05), ANOVA with Bonferroni post hoc test.

Sulfide Reduces S-S Bonds, Leading to Mucolysis.

Mucus is high in intra- and intermolecular S-S bonds, stabilizing its polymeric, network-like structure. When S-S bonds are broken, mucin monomers dissociate and/or denaturate, leading to decreased viscosity and higher mucus accessibility for bacterial degradation (15). SRBs can use mucus-derived sulfate as oxidant in anaerobic respiration, generating sulfide. We hypothesized that sulfide could have a mucolytic effect by reducing the intermolecular S-S bonds, which contributes to an enhanced mucus barrier in the Abx groups due to the decreased abundance of SRBs (Fig. 4A) and the corresponding decrease of luminal sulfide production. We tested the reducing potency of several sulfur containing compounds on the model compound DTNB [5,5′-dithiobis-(2-nitrobenzoic acid)] containing a central S-S bond. Splitting of this S-S bond in DTNB leads to increased absorbance at 412 nm, and the assay allows the determination of the overall S-S splitting extent as well as the initial S-S splitting rate (Fig. 4B). Cysteine, glutathione, and N-acetylcysteine (NAC) were able to split the S-S bond with a similar rate between 24 and 31 µM/min, whereas the negative control Na2SO4 did not affect DTNB integrity. Importantly, sulfide gave a significantly higher rate of S-S bond splitting, 62.4 ± 5.9 µM/min, indicating that sulfide has a twofold more potent mucolytic effect compared with the amino acid thiols that have been shown to split S-S bonds and make mucins less viscous (16). Moreover, the overall extent of S-S bond splitting by sulfide was also twofold higher compared with the other amino acid thiols. Based on Ellman's mechanism (17), this indicates that a reactive persulfide anion originates from the splitting of the first S-S bond, which can subsequently target a second S-S bond, creating a trisulfide bond. We developed a method to quantitatively determine trisulfide bonds based on the difference between total bound sulfides and acid labile sulfides (18). Indeed, trisulfide bonds were generated when sulfide was used to reduce S-S bonds in DTNB (Fig. 4B), but not on amino acid thiol (NAC, GSH, or cysteine) treatment of DTNB. The theoretical (Fig. 4C) and measured ratio (Fig. 4B) of sulfide-dependent formation of thiol to trisulfide is 2, indicating that all sulfide reacts with DNTB to form trisulfide bonds.

To test whether similar redox reactions also occurred in vivo, total sulfides and trisulfides were determined in mice fecal water (Fig. 4D). Heme increased the levels of total bound sulfides, which is in agreement with literature showing that heme addition to the growth medium stimulates bacterial reduction of sulfate to sulfide (19). Concentrations of trisulfide in fecal water of mice not receiving Abx were much higher (with H > C) than those of mice receiving Abx, indicating that Abx suppressed sulfide-dependent splitting of S-S bonds and thus colonic mucolysis. In line with this, Abx drastically increased fecal excretion of mucin (Fig. 4E), because the slightly lower steady-state mucin synthesis (Fig. 3C) is not anymore balanced by its bacterial degradation. Fecal mucin was present as a high-molecular-weight form of Muc2 that could not penetrate the gel in SDS/PAGE analysis (Fig. 4F), whereas with DTT as a reducing agent most of the Muc2 appeared as a band of low MW in the gel. To corroborate the reducing effect of sulfide, Muc2 Western blotting was repeated for the CA- and HA-groups and showed that also sulfide lysed the polymeric Muc2 almost completely (Fig. 4F). Overall, these results indicate that in normal colon physiology, microbial sulfide opens the polymeric Muc2 network to bacterial degradation resulting in a lumen-to-surface permeability gradient through the mucus layer. Abx block these microbial processes and thereby increase the mucus barrier.

Discussion

This study shows that dietary heme changes the microbiota and increases ROS and cytotoxicity in the colonic lumen. In addition, heme injures the surface epithelium leading to compensatory hyperproliferation, hyperplasia, and differential expression of tumor suppressor and oncogenes, which increases colorectal cancer risk (20, 21). These luminal and epithelial effects of heme are similar to those detailed in our recent studies (6, 10, 11). Also the Abx effects on the microbiota replicate those shown by us in an earlier study (22). The crucial finding of the present study is that when the microbial abundance is drastically reduced by Abx, heme does not injure the surface epithelium and does not induce the carcinogenic changes in the crypts, mentioned above. The absence of carcinogenic changes is not due to the slightly lower levels of cytotoxicity and ROS in the HA-group, which can be explained by the higher luminal dilution factor because of the increased fecal wet weight. Recently, we reported that heme diets induce, in the colon lumen, covalent heme modification resulting in the very lipophilic and toxic CHF, which is solubilized in mixed micelles (11). Abx block the mucosal sensing of these cytotoxic micelles, as they prevent the heme-induced changes in epithelial histology and in up-regulation of injury markers such as Slpi. In contrast, Abx do not block mucosal sensing of luminal ROS, as the Nrf2-mediated antioxidant response was initiated and PPARs were activated by oxidized lipids in both heme diet groups. This differential mucosal sensing shows that, with Abx, the mucus layer is still permeable to small molecules, such as oxidized lipids, but no longer to larger micellar aggregates containing CHF. The absence of hyperproliferation in the HA-group also shows that mucosal exposure to ROS does not cause hyperproliferation. This result is in line with our previous observation that ROS is instantly formed after consumption of the heme diet, whereas there is a delay in the appearance of luminal cytotoxicity and the induction of hyperproliferation (11).

Our study implies that the colon microbiota facilitates heme-induced epithelial injury and hyperproliferation by opening the mucus barrier by the concerted action of hydrogen sulfide-producing and mucin-degrading bacteria. The principal steps of this hypothesis (Fig. 5) are (i) mucolysis by hydrogen sulfide to open the compact, protective mucus layer for (ii) further bacterial degradation, thereby (iii) allowing diffusion of luminal, cytotoxic micelles to the mucosal surface. Consequently, surface epithelial cells are less protected against luminal cytotoxicity, leading to induction of compensatory hyperproliferation. The diffusion barrier function of the mucus layer is illustrated by Muc2 KO mice, which display colitis and epithelial hyperproliferation, as well as spontaneous development of colorectal cancer (23). In addition, an in vitro study shows that apically applied mucin creates a diffusion barrier, preventing the contact between cytotoxic micelles and colonocytes (13). That microbiota increase the permeability of mucus barrier is illustrated by a study of recolonized vs. Abx-treated rats showing that bacteria colonizing the isolated colonic segment increase epithelial injury by luminally added toxic compounds (24). Unfortunately, there are no established methods to determine the permeability of the mucus layer in vivo. Although the mucus layer can be stained in appropriately fixed intestinal samples, this does not provide information about its permeability, as its thickness and permeability are not inversely related (15).

Fig. 5.

Fig. 5.

Proposed mechanism of how microbiota facilitates heme-induced compensatory hyperproliferation. (Upper) Processes when normal microbiota is present (i.e., without Abx) leading to compensatory hyperproliferation. (Lower) How Abx cause the mucus layer to be protective against cytotoxic micelles. R-S-S-R indicates native intra- and intermolecular disulfide bonds in the mucus that can be reduced by H2S to thiols (R-S-H) and trisulfides (R-S-S-S-R).

Central to our hypothesis is that hydrogen sulfide can reduce and thus split S-S bonds, which opens the mucus layer. The compactness of this layer is determined by disulfide bond-stabilized polymer Muc2 network of C-terminal dimers and N-terminal trimers (15). Partial proteolysis by host proteases, which is visible in our denaturating gels of fecal mucin, does not change the structure of this network (15). However, splitting of S-S bonds dissolves it (i.e., mucolysis) resulting in reduced viscosity and increased permeability of the mucus layer (15). Typical S-S breaking agents are N-acetyl-cysteine (NAC), used in the treatment of cystic fibrosis, l-cysteine, and 2-mercaptoethanol, all known to decrease mucin viscosity in vivo and in vitro (16). Our DTNB results show that sulfide, compared with these thiols, is twofold more potent in breaking S-S bonds. The pKa of hydrogen sulfide is about 1 unit lower than that of the thiols, implying that the concentration of the nucleophilic agent (i.e., the anion) in the splitting of S-S is higher with hydrogen sulfide. Moreover, as sulfide donates two electrons, it splits two S-S bonds, whereas thiols only split one. Elaborating on Ellman’s mechanism of S-S splitting (17), we reasoned that the highly nucleophlic persulfide, formed in the first reaction, generates a trisulfide bond in the second one. Our in vitro results show that trisulfide formation is indeed specific for S-S reduction by sulfide. Our fecal analysis shows that trisulfide is also formed in vivo and stimulated by dietary heme, probably because bacterial sulfate reduction is heme dependent (19). Abx strongly reduce overall bacterial abundance and suppress this trisulfide formation almost completely, supporting our mechanism that trisulfide is formed by bacterial sulfide. In line with this, Abx greatly increased fecal excretion of Muc2 in a high-molecular-weight polymeric form, as shown by nonreducing SDS/PAGE. Moreover, this polymeric Muc2 dissociates almost completely after reduction by DTT or sulfide, supporting the hypothesis that S-S bond splitting by sulfide opens the mucus barrier. This hypothesis is supported further by the recent finding that increasing the number of S-S bonds in the Muc2 network increases the mucus barrier in mouse colon (25).

Our mechanism of S-S bond splitting by sulfide is corroborated by a recent nutritional study by Devkota et al. (26), showing that monoassociation of germ-free mice with the sulfide-producing proteobacterium Bilophila wardsworthia, in the presence of taurocholate, results in breaking of the mucus barrier. The authors suggest that this is either due to sulfide (produced from taurine) or to unconjugated deoxycholate. However, the authors did not find barrier breaking in the presence of glycocholate, which is also metabolized to deoxycholate but does not generate sulfide. Therefore, we feel that their results can only be explained by the action of taurine-derived sulfide opening the mucus barrier via a mechanism analogous to what we propose here. Thus, it would be worthwhile to measure fecal trisulfides in that study.

Also in humans the colonic mucus layer functions as a barrier. As in mice, it prevents bacterial colonization of the epithelial surface and protects the surface cells from exposure to luminal toxic compounds (27). Three prevalent microbial profiles, so-called “enterotypes,” have been proposed to exist in human microbiota (28). Interestingly, for two of those enterotypes, mucin-degrading bacteria are identified as microbial drivers. One enterotype is rich in Prevotella and the co-occurring Desulfovibrio. Prevotella degrades mucin and Desulfovibrio may enhance the rate-limiting sulfatase step by hydrolyzing glycosyl-sulfate esters. The second mucin-degrading enterotype is rich in Ruminococcus and Akkermansia, both able to degrade mucins. We showed previously that dietary heme drastically increases the abundance of Prevotella and Akkermansia (10), which may be of relevance for these two enterotypes. The third enterotype is rich in Bacteroides using carbohydrates and proteins as substrates for fermentation (28). It would be of interest to see whether mucus barrier differences between different enterotypes exist or that diseases of the gut, such as colorectal cancer and IBD, are associated with mucin-degrading enterotypes.

Overall, we conclude that the microbiota facilitates the heme-induced hyperproliferation by opening the mucus barrier. Bacterial hydrogen sulfide can reduce the S-S bonds in polymeric mucin, thereby increasing the mucus layer permeability for mucin-degrading bacteria and for cytotoxic micelles. Consequently, epithelial surface cells are injured by the cytotoxic heme and compensatory hyperproliferation is initiated. This hyperproliferation might eventually lead to colorectal cancer (20). Our model and our results imply that fecal trisulfides can serve as a suitable marker of colonic mucolysis. Therefore, it would be of interest to measure levels of trisulfide in the human enterotypes, mentioned above, and in gut diseases in which the mucus barrier is compromised, such as irritable bowel syndrome (29).

Materials and Methods

Animal Handling and Design of the Study.

Experiments were approved by the Ethical Committee on Animal Testing of Wageningen University and were in accordance with national law. Eight-week-old male C57BL6/J mice (Harlan) were housed individually in a room with controlled temperature (20–24 °C) and relative humidity (55 ± 15%) and a 12-h light dark cycle. Mice were fed diets and demineralized water ad libitum. We designed our study as a 2 × 2 factorial experiment with heme and antibiotics as independent factors/treatments. Mice (n = 9/group) received either a “Westernized” control diet [40 energy% fat (mainly palm-oil), low calcium (30 µmol/g)] or this diet supplemented with 0.5 µmol/g heme for 14 d, as previously described (30). Broad-spectrum Abx, containing ampicillin (1 g/L), neomycin (1 g/L), and metronidazole (0.5 g/L), were administered in drinking water during the time of intervention. There were four experimental groups: control, heme, control plus Abx, and heme plus Abx. Feces were quantitatively collected during days 11–14, frozen at −20 °C, and subsequently freeze dried. After 14 d, the colon was excised, mesenteric fat was removed, and the colon was opened longitudinally, washed in PBS, and cut into three parts. The middle 1.5 cm of colon tissue was formalin-fixed and paraffin embedded for histology. The remaining proximal and distal parts were scraped, pooled per mouse, snap-frozen in liquid nitrogen, and stored at −80 °C until further analysis. Colonic contents were sampled for microbiota analysis. Chemicals were from Sigma-Aldrich, unless indicated otherwise.

Fecal Analyses.

Fecal water was prepared by reconstituting freeze-dried feces with double distilled water to obtain a physiological osmolarity of 300 mOsm/L, as described previously (5). Cytotoxicity of fecal water was quantified by potassium release from human erythrocytes after incubation (5) and validated with human colon carcinoma-derived Caco-2 cells (31). See SI Materials and Methods for TBARS, bile acids, and fecal mucin measurements.

Immunohistochemistry.

Histological H&E and immunohistochemical Ki67 (6) and Slpi (32) stainings were performed on paraffin-embedded colon sections as described previously. To quantify Ki67-positive colonocytes, 15 crypts per animal were counted. The number of Ki67-positive cells per crypt, total number of cells per crypt, and labeling index were determined.

RNA Isolation and Microarray Analysis.

RNA was isolated from colon scrapings and hybridized on Affymetrix GeneChip Mouse Gene 1.1 ST arrays (SI Materials and Methods). Genes satisfying the criterion of false discovery rate <1% (q < 0.01) were considered significantly expressed. Array data were submitted to the Gene Expression Omnibus with accession no. GSE40670.

Bacterial DNA Extraction and qPCR.

DNA was extracted from ∼0.1 g fresh fecal pellet from the colon using the method described by Salonen et al. (33). By qPCR, total bacteria were quantified using generic 16S rRNA primers and Bacteroidetes and Firmicutes using phylum-specific 16S rRNA primers (SI Materials and Methods).

Reduction of Disulfide (S-S) Bonds.

S-S splitting potency of sodium sulfide (Na2S) and thiols was determined using DTNB as the model disulfide compound. Western blot analysis of fecal mucin was performed to determine whether DTT and sulfide reduces disulfide bonds in Muc2 (SI Materials and Methods).

Measurement of Trisulfide Bonds.

Trisulfides were calculated as the difference between total bound sulfides and acid-labile sulfides measured in individual fecal waters by GC-MS (SI Materials and Methods).

Statistics.

In vivo data are presented as mean ± SEM. Differences between groups were tested for main effects by two-way ANOVA. In vitro data are given as mean ± SD, and differences between groups were tested by one-way ANOVA with the Bonferroni multiple comparison test. P < 0.05 was considered significant.

SI Materials and Methods

TBARS.

To determine lipid peroxidation products in the gut lumen, TBARS in fecal water were quantified. The assay determines lipid peroxidation by quantifying the concentration of malondialdehyde (MDA) in fecal water. Briefly, fecal water was diluted fourfold with double-distilled water. To 100 µL of this dilution, 100 µL of 8.1% (wt/vol) SDS and 1 mL of 0.11 mol/L 2,6-di-tert-butyl-p-cresol, 0.5% TBA in 10% (vol/vol) acetic acid (pH 3.5) was added. To correct for background, TBA was omitted from the assay. TBARS were extracted, after heating for 75 min at 82 °C, with 1.2 mL l-butanol. The absorbance of the extracts was measured at 540 nm. The amount of TBARS was calculated as MDA equivalents using 1,1,3,3,-tetramethoxypropane as standard.

Bile acids were determined in fecal water of n = 3/group. Fecal waters were evaporated under nitrogen and resolubilized in 20% (vol/vol) acetonitrile in water. Samples were analyzed using reversed-phase HPLC combined with simultaneous amperometric detection of free and conjugated bile acids (34). Fecal mucins were quantified by means of their oligosaccharide side chains, as described in detail earlier (35), and expressed as µmoles O-glycans.

RNA Isolation.

Total RNA was isolated by using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. For microarray hybridization the isolated RNA was further column purified (SV total RNA isolation system Promega, Leiden, The Netherlands). RNA concentration was measured on a nanodrop ND-1000 UV-Vis spectrophotometer (Isogen) and analyzed on an Agilent 2100 bioanalyzer (Agilent Technologies) with 6000 Nano Chips, according to the manufacturer’s protocol. RNA was judged suitable for array hybridization only if samples exhibited intact bands corresponding to the 18S and 28S ribosomal RNA subunits and displayed no chromosomal peaks or RNA degradation products (RNA integrity number > 8.0).

Microarray Analysis.

The Ambion WT Expression kit (P/N 4411974; Life Technologies) in conjunction with the Affymetrix GeneChip WT Terminal Labeling kit (P/N 900671; Affymetrix) was used for the preparation of labeled cDNA from 100 ng of total RNA without rRNA reduction. Labeled samples were hybridized on Affymetrix GeneChip Mouse Gene 1.1 ST arrays, provided in plate format. Hybridization, washing, and scanning of the array plates was performed on an Affymetrix GeneTitan Instrument, according to the manufacturer’s recommendations. RNA labeling was performed in two rounds using a complete block design. Normalized expression estimates were obtained from the raw intensity values applying the robust multiarray analysis (RMA) preprocessing algorithm available in the Bioconductor library AffyPLM with default settings. Subsequently, an empirical Bayes method, called ComBat (36), was used to correct for the systematic error (batch effect) introduced during labeling. Probe sets were redefined according to Dai et al. (37). In this study, probes were reorganized based on the Entrez Gene database, build 37, version 1 (remapped CDF v14). Probe sets that satisfied the criterion of a false discovery rate <1% (q < 0.01) were considered significantly regulated and used for bioinformatics analysis by Ingenuity (Ingenuity Systems; www.ingenuity.com) and gene set enrichment analysis (GSEA; www.broad.mit.edu/gsea/). The number included in the array analysis were n = 4 per group for control, control plus Abx, and heme, and n = 6 for heme plus Abx. Genes with signal intensities below 20 in all mice from all treatments were considered not expressed and excluded from further analysis.

Bacterial DNA Extraction and qPCR.

Approximately 0.1 g fresh fecal pellet was subjected to mechanical and chemical lysis using 0.5 mL buffer [500 mM NaCl, 50 mM Tris⋅HCl (pH 8), 50 mM EDTA, and 4% (wt/vol) SDS] and 0.25 g of 0.1-mm zirconia beads and 3-mm glass beads. Nucleic acids were precipitated by addition of 130 μL, 10 M ammonium acetate, using one volume of isopropanol. Subsequently, DNA pellets were washed with 70% (vol/vol) ethanol. Further purification of DNA was performed using the QiaAmp DNA Mini Stool Kit (Qiagen). Finally, DNA was dissolved in 200 μL Tris/EDTA buffer, and its purity and quantity were checked spectrophotometrically (ND-1000; NanoDrop Technologies).

Total DNA was used for the quantitative estimation of total bacterial numbers per sample by real-time PCR amplification using generic 16S rRNA primers: forward Eub338F, ACTCCTACGGGAGGCAGCAG; and reverse Eub518R, ATTACCGCGGCTGCTGG. Bacteroidetes and Firmicutes populations were quantified by real-time amplification using phylum-specific 16S rRNA primers: Bacteroidetes forward Bact934F, GGARCATGTGGTTTAATTCGATGAT; reverse Bact1060R, AGCTGACGACAACCATGCAG and Firmicutes forward Firm934F, GGAGYATGTGGTTTAATTCGAAGCA; reverse Firm1060R, AGCTGACGACAACCATGCAC, respectively. Akkermansia muciniphila was quantified using genus-specific 16S rRNA primers S-St-Muc-1129-a-a-20 (AM1): CAGCACGTGAAGGTGGGGAC and S-St-Muc-1437-a-A-20 (AM2) CCTTGCGGTTGGCTTCAGAT. The sulfate-reducing capacity of the microbiota was estimated on basis of the gene-specific PCR that targets the dsrA gene that is associated with microbial sulfate respiration, using the following primers: forward RH1dsr, GCCGTTACTGTGACCAGCC and reverse RH3-dsr GGTGGAGCCGTGCATGTT. Bacterial counts are calculated and expressed in percentages relative to the control without Abx.

In Vitro Splitting of Disulfide (S-S) Bonds.

The potency of sodium sulfide (Na2S), N-acetylcysteine (NAC), glutathione (GSH), and cysteine to split S-S bonds were determined using 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB) as model disulfide compound. Splitting of the S-S bond of DTNB can be quantified by measuring absorption at 412 nm (17). Analyses were performed at 20 °C in a Perkin-Elmer spectrophotometer using a 1.5-mL quartz cuvette containing 100 mM potassium phosphate buffer (pH 7.0) and 100 µM DTNB. The reaction was started by adding sulfide or the thiols (final concentration, 25 µM). Reaction rates were determined as the slope of progress curve immediately after mixing. The extent of the overall reaction was determined from the final, stable, absorption, and corrected for blank absorption, using the milimolar extinction coefficient of 14.15. Sodium sulfate (Na2SO4) was used as negative control.

Western Blot Analysis.

Homogenates of freeze-dried feces were made by adding 1 mL PBS containing protease inhibitors (CompleteMini; Roche Diagnostics) to 10 mg freeze-dried pooled feces (n = 9/group). Samples were incubated for 5 min at 100 °C with nonreducing sample buffer (without DTT), with reducing sample buffer (with DTT), or with nonreducing sample buffer with Na2S. Samples were applied to SDS/PAGE [10% (wt/vol) gel] and transferred to polyvinylidene fluoride membranes under 350 mA for 4 h on ice. Twenty micrograms total protein was loaded. The blot was probed overnight at 4 °C with rabbit anti-mouse Muc2 antibody (38) (1:2,500) and then incubated with peroxidase-conjugated goat anti-rabbit antibody (1:5,000; Thermo Scientific). The signals were detected with the enhanced chemiluminescence detection system (Amersham ECL, GE Healthcare).

Measurement of Trisulfide Bonds.

From each individual fecal water 20 µL was added to 2-mL headspace vials containing 450 µL of Tris buffer (90 mM; pH 8.0) with or without 0.9 mM cysteine. Capped vials were incubated 30 min at 35 °C to facilitate cysteine-driven reduction of the central sulfur of the trisulfide bond to inorganic sulfide, as described earlier (18). Subsequently, 20 µL of 6 M HCL was added to the vials to force the sulfide as H2S into the headspace. With a headspace sampler this H2S was then measured on a GC-MS (TraceGC ulta; ThermoFinnigan) using a VF-1ms 30 × 0.25 column (Varian) with helium as carrier gas, and quantified with standard solutions of Na2S × 9 H2O treated identical to the samples. Trisulfide was calculated as the difference in H2S between the vial containing cysteine (i.e., total bound sulfide) and the vial without it (i.e., acid-labile sulfide). To validate this method control samples containing dimethyltrisulfide were analyzed identically and showed a recovery >90%. It should be noted that our assay is not confounded by free inorganic sulfides (such as HS− and S2−) in feces as these are removed during freeze drying. Samples from the in vitro incubations were analyzed identically. H2S was only detected in the cysteine vials containing the samples from the Na2S incubations, illustrating the specificity the trisulfide measurement.

Acknowledgments

We thank Jan van Riel and Kees Olieman for trisulfide analysis; Nicole de Wit for discussions; Jenny Jansen, Shohreh Keshtkar, Arjan Schonewille, Rob Dekker, Sandra ten Bruggencate, and Bert Weijers for technical assistance; and Dicky Lindenbergh-Kortleve and Janneke Samsom for Slpi immunohistochemistry. This work was financially supported by Top Institute Food and Nutrition Grant A-1001 (Wageningen, The Netherlands).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Data deposition: Array data have been deposited in the Gene Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE40670).

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1507645112/-/DCSupplemental.

References

  • 1.World Cancer Research Fund . Food, Nutrition, Physical Activity and the Prevention of Cancer: A Global Perspective. American Institute for Cancer Research; Washington, DC: 2007. [Google Scholar]
  • 2.Giovannucci E, et al. Intake of fat, meat, and fiber in relation to risk of colon cancer in men. Cancer Res. 1994;54(9):2390–2397. [PubMed] [Google Scholar]
  • 3.Lee DH, Anderson KE, Harnack LJ, Folsom AR, Jacobs DR., Jr Heme iron, zinc, alcohol consumption, and colon cancer: Iowa Women’s Health Study. J Natl Cancer Inst. 2004;96(5):403–407. doi: 10.1093/jnci/djh047. [DOI] [PubMed] [Google Scholar]
  • 4.Balder HF, et al. Heme and chlorophyll intake and risk of colorectal cancer in the Netherlands cohort study. Cancer Epidemiol Biomarkers Prevent. 2006;15(4):717–725. doi: 10.1158/1055-9965.EPI-05-0772. [DOI] [PubMed] [Google Scholar]
  • 5.Sesink AL, Termont DS, Kleibeuker JH, Van der Meer R. Red meat and colon cancer: The cytotoxic and hyperproliferative effects of dietary heme. Cancer Res. 1999;59(22):5704–5709. [PubMed] [Google Scholar]
  • 6.IJssennagger N, et al. Dietary haem stimulates epithelial cell turnover by downregulating feedback inhibitors of proliferation in murine colon. Gut. 2012;61(7):1041–1049. doi: 10.1136/gutjnl-2011-300239. [DOI] [PubMed] [Google Scholar]
  • 7.Young GP, Rose IS, St John DJ. Haem in the gut. I. Fate of haemoproteins and the absorption of haem. J Gastroenterol Hepatol. 1989;4(6):537–545. doi: 10.1111/j.1440-1746.1989.tb00858.x. [DOI] [PubMed] [Google Scholar]
  • 8.McGarr SE, Ridlon JM, Hylemon PB. Diet, anaerobic bacterial metabolism, and colon cancer: A review of the literature. J Clin Gastroenterol. 2005;39(2):98–109. [PubMed] [Google Scholar]
  • 9.Zimmer J, et al. A vegan or vegetarian diet substantially alters the human colonic faecal microbiota. Eur J Clin Nutr. 2012;66(1):53–60. doi: 10.1038/ejcn.2011.141. [DOI] [PubMed] [Google Scholar]
  • 10.IJssennagger N, et al. Dietary heme alters microbiota and mucosa of mouse colon without functional changes in host-microbe cross-talk. PLoS One. 2012;7(12):e49868. doi: 10.1371/journal.pone.0049868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ijssennagger N, et al. Dietary heme induces acute oxidative stress, but delayed cytotoxicity and compensatory hyperproliferation in mouse colon. Carcinogenesis. 2013;34(7):1628–1635. doi: 10.1093/carcin/bgt084. [DOI] [PubMed] [Google Scholar]
  • 12.Sesink AL, Termont DS, Kleibeuker JH, Van der Meer R. Red meat and colon cancer: Dietary haem-induced colonic cytotoxicity and epithelial hyperproliferation are inhibited by calcium. Carcinogenesis. 2001;22(10):1653–1659. doi: 10.1093/carcin/22.10.1653. [DOI] [PubMed] [Google Scholar]
  • 13.Kindon H, Pothoulakis C, Thim L, Lynch-Devaney K, Podolsky DK. Trefoil peptide protection of intestinal epithelial barrier function: Cooperative interaction with mucin glycoprotein. Gastroenterology. 1995;109(2):516–523. doi: 10.1016/0016-5085(95)90340-2. [DOI] [PubMed] [Google Scholar]
  • 14.Nakamura A, et al. Increased susceptibility to LPS-induced endotoxin shock in secretory leukoprotease inhibitor (SLPI)-deficient mice. J Exp Med. 2003;197(5):669–674. doi: 10.1084/jem.20021824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Johansson ME, Larsson JM, Hansson GC. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial interactions. Proc Natl Acad Sci USA. 2011;108(Suppl 1):4659–4665. doi: 10.1073/pnas.1006451107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sheffner AL. The reduction in vitro in viscosity of mucoprotein solutions by a new mucolytic agent, N-acetyl-L-cysteine. Ann N Y Acad Sci. 1963;106:298–310. doi: 10.1111/j.1749-6632.1963.tb16647.x. [DOI] [PubMed] [Google Scholar]
  • 17.Ellman GL. A colorimetric method for determining low concentrations of mercaptans. Arch Biochem Biophys. 1958;74(2):443–450. doi: 10.1016/0003-9861(58)90014-6. [DOI] [PubMed] [Google Scholar]
  • 18.Jespersen AM, et al. Characterisation of a trisulphide derivative of biosynthetic human growth hormone produced in Escherichia coli. Eur J Biochem FEBS. 1994;219(1-2):365–373. doi: 10.1111/j.1432-1033.1994.tb19948.x. [DOI] [PubMed] [Google Scholar]
  • 19.Tracy O. Pigment production in bacteroides. J Med Microbiol. 1969;2(3):309–315. doi: 10.1099/00222615-2-3-309. [DOI] [PubMed] [Google Scholar]
  • 20.Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell. 1996;87(2):159–170. doi: 10.1016/s0092-8674(00)81333-1. [DOI] [PubMed] [Google Scholar]
  • 21.Pierre F, Taché S, Petit CR, Van der Meer R, Corpet DE. Meat and cancer: Haemoglobin and haemin in a low-calcium diet promote colorectal carcinogenesis at the aberrant crypt stage in rats. Carcinogenesis. 2003;24(10):1683–1690. doi: 10.1093/carcin/bgg130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lichtenstein L, et al. Angptl4 protects against severe proinflammatory effects of saturated fat by inhibiting fatty acid uptake into mesenteric lymph node macrophages. Cell Metab. 2010;12(6):580–592. doi: 10.1016/j.cmet.2010.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Velcich A, et al. Colorectal cancer in mice genetically deficient in the mucin Muc2. Science. 2002;295(5560):1726–1729. doi: 10.1126/science.1069094. [DOI] [PubMed] [Google Scholar]
  • 24.García-Lafuente A, et al. Derangement of mucosal barrier function by bacteria colonizing the rat colonic mucosa. Eur J Clin Invest. 1998;28(12):1019–1026. doi: 10.1046/j.1365-2362.1998.00405.x. [DOI] [PubMed] [Google Scholar]
  • 25.Bel S, et al. Reprogrammed and transmissible intestinal microbiota confer diminished susceptibility to induced colitis in TMF-/- mice. Proc Natl Acad Sci USA. 2014;111(13):4964–4969. doi: 10.1073/pnas.1319114111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Devkota S, et al. Dietary-fat-induced taurocholic acid promotes pathobiont expansion and colitis in Il10-/- mice. Nature. 2012;487(7405):104–108. doi: 10.1038/nature11225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Johansson ME, et al. Bacteria penetrate the normally impenetrable inner colon mucus layer in both murine colitis models and patients with ulcerative colitis. Gut. 2014;63(2):281–291. doi: 10.1136/gutjnl-2012-303207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Arumugam M, et al. MetaHIT Consortium Enterotypes of the human gut microbiome. Nature. 2011;473(7346):174–180. doi: 10.1038/nature09944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Swidsinski A, et al. Comparative study of the intestinal mucus barrier in normal and inflamed colon. Gut. 2007;56(3):343–350. doi: 10.1136/gut.2006.098160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.de Vogel J, Jonker-Termont DS, van Lieshout EM, Katan MB, van der Meer R. Green vegetables, red meat and colon cancer: Chlorophyll prevents the cytotoxic and hyperproliferative effects of haem in rat colon. Carcinogenesis. 2005;26(2):387–393. doi: 10.1093/carcin/bgh331. [DOI] [PubMed] [Google Scholar]
  • 31.Lapré JA, Termont DS, Groen AK, Van der Meer R. Lytic effects of mixed micelles of fatty acids and bile acids. Am J Physiol. 1992;263(3 Pt 1):G333–G337. doi: 10.1152/ajpgi.1992.263.3.G333. [DOI] [PubMed] [Google Scholar]
  • 32.Menckeberg CL, et al. Human buccal epithelium acquires microbial hyporesponsiveness at birth, a role for secretory leukocyte protease inhibitor. Gut. 2015;64(6):884–893. doi: 10.1136/gutjnl-2013-306149. [DOI] [PubMed] [Google Scholar]
  • 33.Salonen A, et al. Comparative analysis of fecal DNA extraction methods with phylogenetic microarray: Effective recovery of bacterial and archaeal DNA using mechanical cell lysis. J Microbiol Methods. 2010;81(2):127–134. doi: 10.1016/j.mimet.2010.02.007. [DOI] [PubMed] [Google Scholar]
  • 34.Dekker R, Van der Meer R, Olieman C. Sensitive pulsed amperometric detection of free and conjugated bile-acids in combination with gradient reversed-phase Hplc. Chromatographia. 1991;31(11-12):549–553. [Google Scholar]
  • 35.Bovee-Oudenhoven IM, Termont DS, Heidt PJ, Van der Meer R. Increasing the intestinal resistance of rats to the invasive pathogen Salmonella enteritidis: additive effects of dietary lactulose and calcium. Gut. 1997;40(4):497–504. doi: 10.1136/gut.40.4.497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Johnson WE, Li C, Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics. 2007;8(1):118–127. doi: 10.1093/biostatistics/kxj037. [DOI] [PubMed] [Google Scholar]
  • 37.Dai M, et al. Evolving gene/transcript definitions significantly alter the interpretation of GeneChip data. Nucleic Acids Res. 2005;33(20):e175. doi: 10.1093/nar/gni179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.van Klinken BJ, et al. Gastrointestinal expression and partial cDNA cloning of murine Muc2. Am J Physiol. 1999;276(1 Pt 1):G115–G124. doi: 10.1152/ajpgi.1999.276.1.G115. [DOI] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES