Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2015 Aug 18;53(9):2983–2989. doi: 10.1128/JCM.01227-15

Comparison of Automated Quantitative Reverse Transcription-PCR and Direct Fluorescent-Antibody Detection for Routine Rabies Diagnosis in the United States

Michelle Dupuis 1,*, Scott Brunt 1, Kim Appler 1, April Davis 1,, Robert Rudd 1
Editor: M J Loeffelholz
PMCID: PMC4540915  PMID: 26179300

Abstract

Rabies virus found worldwide and prevalent throughout the United States continues to be a public health concern. Direct-fluorescent antibody (DFA) detection remains the gold standard for rabies virus diagnostics. Assessing the utility of a high-throughput molecular platform such as the QIAsymphony SP/AS, in conjunction with quantitative reverse transcription-PCR (qRT-PCR), to augment or potentially replace the DFA test, was the focus of this project. Here we describe a triplex qRT-PCR assay, including assembly and evaluation for sensitivity, specificity, and ability to detect variants. Additionally, we compared the qRT-PCR assay to the gold standard direct fluorescent-antibody test. More than 1,000 specimens submitted for routine rabies diagnosis were tested to directly compare the two methods. All results were in agreement between the two methods, with one additional specimen detected by qRT-PCR below the limits of the DFA sensitivity. With the proper continued validation for variant detection, molecular methods have a place in routine rabies diagnostics within the United States.

INTRODUCTION

Rabies virus, in the Lyssavirus genus of the Rhabdoviridae family, is found worldwide and has been described since antiquity (1). The fatality rate of clinical rabies infections remains greater than 99%. There are at least 14 recognized species of lyssaviruses circulating in the world (2), yet in the Western Hemisphere, only classical rabies virus has been identified in terrestrial mammals and bats.

The cost of rabies control in the United States exceeds 300 million dollars annually (http://www.cdc.gov/rabies/location/usa/cost.html). A great portion of this expense results from the cost of administering postexposure prophylaxis (PEP) to individuals meeting risk assessment guidelines for contracting rabies virus after a contact with a rabid or suspect rabid animal. The need for accurate and timely diagnostic tools to identify positive rabies cases will continue, as this disease is prevalent in the continental United States, Canada, and Mexico (3). The direct-fluorescent antibody test (DFA) (4) is a rapid and sensitive method for diagnosing rabies infection, and as a World Organisation for Animal Health (OIE)/World Health Organization (WHO)-prescribed rabies test, it is considered the worldwide gold standard for rabies diagnosis. The accuracy of the DFA relies upon the examination of fresh brain tissue, the experience of a trained microscopist with access to a quality fluorescence microscope, and the availability of high-quality antirabies diagnostic conjugates.

The Rabies Laboratory of the New York State Department of Health (NYSDOH) performs diagnostic testing on approximately 7,000 animal specimens a year. During the summer months, the specimen submission rate can approach 150 to 200 samples per day, making a high-throughput method of detection a necessity. In most laboratories, the DFA can be completed within 3 h from receipt of specimen, and it has proven to be highly specific, sensitive, and reliable. Because a rabies laboratory can provide reliable results on the day of receipt of the specimen, the physician's decision to provide or withhold rabies treatment following a bite from a suspect animal is frequently based upon the laboratory tests performed on the animal's brain. Uniquely high standards of sensitivity and specificity are required of these tests, as a false-negative result is likely to have the consequence of human mortality.

Molecular methods continue to show great promise for detection of lyssaviruses worldwide (513). Multiple molecular strategies have been reported in the literature, many focusing on the detection of all lyssavirus species found worldwide and associated with human disease. These methods include conventional nested reverse transcription-PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) involving multiple primer and/or probe sets. Conventional nested PCR is time and labor-intensive and prone to cross contamination, and in the United States, it is no longer considered to have sufficient specificity for diagnostic use without sequence confirmation (14). To date, real-time methods developed for panlyssavirus detection have included those with multiple TaqMan probes to allow for the detection of variants of concern or SYBR green technology, followed by probe-specific detection. Currently, New York State regulations require secondary confirmatory testing for SYBR green assays. In order to develop a large-scale routine animal testing method that could become an adjunct to, or potentially replace, the DFA test, we sought a robotic system that would handle larger numbers of specimens per batch. Although the sensitivity of the molecular detection methods has been shown to be greater than the sensitivity of DFA (15, 16), there has yet to be a molecular strategy assembled for use in the United States that is cost-effective, concise in its implementation, and ensures the detection of all prevalent rabies variants by selected primer/probe combinations.

In this report, we describe the construction and optimization of a real-time assay for the diagnosis of rabies in routinely submitted animal specimens. The specificity and sensitivity of the real-time assay were evaluated on multiple variants of rabies virus and European bat lyssaviruses 1 and 2.

MATERIALS AND METHODS

Lyssavirus variant library production.

A lyssavirus RNA library was assembled based on select lyssavirus species. Primary brain tissue specimens were obtained from samples collected from a variety of animals submitted for routine rabies testing in New York State and from bat specimens provided by the Texas and Colorado State Health Department Laboratories. Isolates containing European bat lyssavirus 1 (EBLV 1) and EBLV 2, Mexican dog, vampire bat, Mid-Western skunk, and Poland raccoon dog lyssaviruses were supplied previously from CDC (Table 1). The library was prepared from stock viral isolates prepared either in vitro (17) or in vivo (18) or from original brain tissue. The 50% tissue culture infectious dose (TCID50) was calculated for all strains by the method of Reed and Muench (19) in neuroblastoma cell culture (17). Viral nucleic acid was extracted from specimens in the variant library using TRIzol per the manufacturer's recommendations (Invitrogen Life Technologies, Carlsbad, CA) or the QIAsymphony DSP virus/pathogen minikit as per the manufacturer's instructions (Qiagen, Hilden, Germany). RNA was eluted in 100 μl of the Ambion RNA storage solution (Life Technologies) or 110 μl of QIAsymphony DSP virus/pathogen elution buffer and stored at −80°C for further use.

TABLE 1.

Comparison of in vitro virus isolation and qPCR results for samples in the rabies virus variant library

Isolate Associated species Original sample typea TCID50/ml No. of gene copies/mlb RABVD1 LOD (GC/RXN) RABVD2 LOD (GC/RXN)
Eptesicus I Big brown bat (Eptesicus fuscus) 10% brain susp/mouse 1.76E+04 3.10E+11 500 750
Eptesicus II 1260-86 T2 Big brown bat (Eptesicus fuscus) 10% brain susp/mouse 2.34E+06 7.22E+11 4,000 1,000
NYS Hoary Bat 69-83 Hoary bat (Lasiurus cinereus) 10% brain susp/mouse 5.56E+05 1.86E+10 250 9,000
Red Fox 21-83 (Arctic fox variant) Arctic fox (Vulpes lagopus) 10% brain susp/mouse 3.78E+03 3.68E+11 275 1,000
NYS Silver Hair 52-84 Silver-haired bat (Lasionycteris noctivagans) 10% brain susp/mouse 8.15E+05 3.78E+11 150 900
NYS Red Bat Eastern red bat (Lasiurus borealis) 10% brain susp/mouse 8.15E+03 1.58E+12 375 6,000
Mid-Western Skunk UR4-1248 Striped skunk (Mephitis mephitis) 10% brain susp/mouse 8.15E+05 7.38E+11 100 100
Street Raccoon M2 Common raccoon (Procyon lotor) 10% brain susp/mouse 3.78E+05 7.76E+11 100 850
Afghanistan Canine CSF8.23.11 T-3 9.14.11 Domestic dog (Canis lupus familiaris) 1o 1.16E+04 1.91E+09 100 1,000
African Dog 2713-86 Domestic dog (Canis lupus familiaris) 10% brain susp/mouse 2.34E+04 1.22E+12 1,200 3,100
Mexican Dog Domestic dog (Canis lupus familiaris) 10% brain susp/mouse 3.78E+04 5.30E+11 300 400
Mongoose 96 Small Indian mongoose (Herpestes auropunctatus) 10% brain susp/mouse 3.78E+04 1.36E+12 180 1,500
Poland Raccoon Dog Raccoon dog (Nyctereutes procyonoides) 10% brain susp/mouse 1.32E+05 2.40E+11 450 15,000
Vampire Bat VB8602 CDC 435 Common vampire bat (Desmodus rotundus) 10% brain susp/mouse 1.76E+07 8.74E+11 1,300 2,500
CVS-11 Pool I Mo from ATCC 11/00 Laboratory strain 10% brain susp/mouse 3.78E+05 2.21E+12 100 14,000
ERA Laboratory strain Vaccine vial 1.32E+06 1.32E+10 100 12,000
NYS 3736-08 Little brown bat (Myotis lucifugus) 1o Not performed 1.67E+10 1,000 7,500
Colorado Bat 25 Hoary bat (Lasiurus cinereus) 1o Unable to isolate virus 2.92E+11 200 5,200
Colorado Bat 41 Big brown bat (Eptesicus fuscus) 1o Unable to isolate virus 1.53E+12 160 4,100
Colorado Bat 45 California myotis (Myotis californicus) 1o Unable to isolate virus 9.59E+10 475 24,000
Colorado Bat 47 Long-eared myotis (Myotis evotis) 1o Unable to isolate virus 6.53E+10 2,000 6,300
Colorado Bat 56 Brazilian free-tailed bat (Tadarida brasiliensis) 1o Unable to isolate virus 5.20E+12 575 33,000
Texas Bat 103 Canyon bat (Parastrellus hesperus) 1o Unable to isolate virus 2.00E+12 170 10,000
Texas Bat 328 Brazilian free-tailed bat (Tadarida brasiliensis) 1o Unable to isolate virus 3.30E+10 200 7,000
Texas Bat 4445 Evening bat (Nycticeius humeralis) 1o Unable to isolate virus 3.50E+12 575 16,000
Texas Bat 6522 Southern yellow bat (Lasiurus ega) 1o Unable to isolate virus 1.45E+11 100 8,000
Texas Bat 7021 Cave myotis (Myotis velifer) 1o Unable to isolate virus 2.70E+12 220 13,000
EBLV 1, CDC 1729, Denmark serotine bat (Eptesicus serotinus) 10% brain susp/mouse 2.34E+04 NAc No No
EBLV 2, CDC Holland Little brown bat (Myotis dasycneme) 10% brain susp/mouse 3.78E+05 NA No No
a

10% brain susp/mouse, 10% brain suspension/mouse; 1o, primary brain tissue specimen.

b

The limits of detection (LODs) (in gene copies/reaction [GC/RXN]) for RABVD1 and RABVD2 are shown.

c

NA, not available.

qRT-PCR design.

A triplex real-time assay was assembled based on previously published primer and probe sequences (13). The assay was composed of two targets in the nucleoprotein gene (N gene) of the rabies virus genome and an exogenous internal control comprised of transcript RNA of green fluorescent protein (20). The first rabies virus target primer pair and probe, RABVD1, were taken directly from the Nadin-Davis et al. article (13), while the second primer pair and probe, RABVD2-RC, were modified (S. A. Nadin-Davis, personal communication) (Table 2). The RABVD2 primers and probe were obtained both with the previously published sequence and the current modified sequence. The performance comparisons of qRT-PCR were made between the two probes with an increase in sensitivity and the magnitude of the signal generated by the given set of PCR conditions (ΔRN) observed with the newly modified probe sequence (data not shown). The third primer and probe set in the triplex assay was designed to detect a green fluorescent protein (GFP) transcript. This exogenous control was designed to serve as an extraction, reverse transcription, amplification, and inhibition control (Table 2). Subsequent assay optimization was performed using viral nucleic acid from two primary specimens, 1975-06 NYS raccoon (Procyon lotor) and 3415-06 NYS big brown bat (Eptesicus fuscus) variants, both submitted for routine diagnosis in 2006.

TABLE 2.

Primers and probes used for rabies virus detection in a triplex qRT-PCR assay

Primera or probe Sequence (5′ to 3′)b Coding sense and positionsc
RABVD1For ATGTAACACCYCTACAATG +55 to +73
RABVD1Rev GCMGGRTAYTTRTAYTCATA −165 to −146
RABVD1 probe 6FAM–CCGAYAAGATTGTATTYAARGTCAAKAATCAGGT–3BHQ-1 +78 to +111
RABVD2For TRATGACAACYCACAARATGT +630 to +650
RABVD2Rev TGARCAGTCYTCRTARGC −764 to −781
RABVD-RC probe QUASAR670–ATGYTCAATCCGRGAGAAAAACATGTC–BHQ-2 −727 to −698
GFPFor CACCCTCTCCACTGACAGAAAAT
GFPRev TTTCACTGGAGTTGTCCCAATTC
GFP probe JOE–TGTGCCCATTAACATCACCAT–BHQ-1
a

The forward (For) and reverse (Rev) primers and probes are shown.

b

6FAM, 6-carboxyfluorescein; 3BHQ-1, black hole quencher 1.

c

The positions are based on reference PV strain (GenBank accession number M13215). RABVD1 and RABVD2 primers and probes came directly from the 2009 Nadin-Davis et al. article (13) with the exception of the RABVD2-RC probe, which was modified from the published sequence, as suggested by S. A. Nadin-Davis.

A comparison of assay range and relative sensitivity was performed with the qRT-PCR kits of five different manufacturers using the RABVD1 primer and probe set. Selection of the qScript one-step fast qRT-PCR kit, low Rox (Quanta Biosciences, Gaithersburg, MD) was based on a lower detection limit from the dilution series of both rabies virus variants (1975-06 and 3415-06), and an earlier threshold cycle (CT) value per dilution than the other four kits evaluated.

Primer and probe optimization was performed for both the RABVD1 and RABVD2-RC primer probe sets individually. The limit of detection (LOD) and the ΔRN value for each primer and probe concentration was used to select the optimal primer and probe concentration. The third primer and probe set, designed to detect the GFP transcript internal control, was optimized with lower final concentrations of the primer and probe in order to facilitate multiplexing and lower background fluorescence.

qRT-PCR limit of detection in multiple rabies virus variants.

Rabies virus variants associated with multiple host species and distinct geographical areas were assessed by using the triplex assay to evaluate the ability to detect rabies virus variants. Reaction mixtures (20 μl) were assembled with final primer concentrations for both the RABVD1 and RABVD2-RC assays at 700 nM and final probe concentrations of 250 nM. The GFP assay concentrations were 400 nM for primers and 200 nM for probe. Reaction conditions were as follows: (i) 50°C for 5 min; (ii) 95°C for 30 s; (iii) 40 cycles, with 1 cycle consisting of 95°C for 15 s and 50°C for 1 min. Standard ABI 7500 cycling and ramping conditions on an ABI 7500 Fast instrument (Applied Biosystems) were used for the isolates shown in Table 1.

In order to accurately determine the LOD for the rabies qRT-PCR assay, a plasmid and transcript were constructed from an Afghanistan canine rabies virus variant. The cDNA synthesis was performed on rabies virus RNA using the Quanta qScript cDNA synthesis kit (Quanta Biosciences, Gaithersburg, MD) per the manufacturer's instructions. This kit employs random primers for cDNA synthesis, while the subsequent conventional PCR was performed using the RABVD1 forward primer and the RABVD2 reverse primer, both from the two real-time primer and probe sets. The conventional PCR was performed using Hot Star Taq DNA polymerase (Qiagen, Hilden, Germany) and deoxynucleoside triphosphates (dNTPs) (Sigma) (final concentration, 10 μM) with cycling conditions of 95°C for 15 min, followed by 45 cycles, with 1 cycle consisting of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min. A final extension step of 10 min at 72°C was performed, and then the temperature was held at 4°C. The pRV1-1 plasmid was produced from the above PCR product using the TA cloning kit with pCR 2.1 (Invitrogen, Carlsbad, CA) per the manufacturer's instructions. The plasmid was sequenced, linearized using BamHI, and then used as a template for synthesis of an RNA transcript. Transcript production was performed with the T7 RiboMax large-scale RNA production system (Promega, Madison, WI). The transcript RNA was treated twice with the Ambion Turbo DNA-free kit (Applied Biosystems Life Technologies, Grand Island, NY) to digest template plasmid DNA. Real-time PCR was performed to confirm that all plasmid was removed from the transcript. The resulting purified RNA transcript was quantified using the NanoDrop 2000 UV-visible (UV-Vis) spectrophotometer (Thermo Scientific). A linear range of 1 × 102 gene copies/reaction (GC/RXN) to 1 × 1011 GC/RXN was determined for the RABVD1 primer and probe set. All variants with LOD data supplied had six 10-fold serial dilutions performed and qRT-PCR run in duplicate or triplicate, allowing efficiency values to be derived based on standard curve data assigned to dilutions, calculated by the slope of the standard curve.

Specificity panel.

A panel of 44 viral, bacterial, and parasitic agents was included to ensure assay specificity (see Table S1 in the supplemental material). Agents were selected based on similar disease manifestations and common host species to those for rabies.

Internal exogenous extraction and amplification control.

The internal control, a RNA transcript of green fluorescent protein was synthesized by the Laboratory of Viral Diseases, NYSDOH, using the same protocol previously described for the rabies transcript production and found in a prior publication (21).

Automated qRT-PCR.

A Qiagen QIAsymphony SP/AS robotic system (Qiagen, Hilden, Germany) and reagents necessary to evaluate the SP/AS (sample prep and assay setup) system and qRT-PCR assay was employed. For this project only, modifications were made to the qRT-PCR assay (validation described above) as well as the real-time instrumentation. The QuantiTect probe multiplex RT-PCR NR kit (Qiagen) was employed as for qRT-PCR reagents, along with detection on the Rotor-Gene Q real-time system.

A total of 1,001 brain tissue samples were collected from routine rabies laboratory submissions throughout the fall of 2011 and winter of 2012. The DFA was performed following the standard DFA protocol (22). To further test the robustness of the procedure, previously diagnosed rabies virus-positive samples were included in the assessment. These samples included less frequently submitted bat species and samples showing various degrees of decomposition. Tissue from all samples collected for the project was frozen at −80°C until further processed. Tissue samples were thawed, and a sample for the molecular assay was collected by rolling a sterile ultrathin urethral flocked swab (catalog no. 525CS01; Copan Flock Technologies) in brain tissue slurry. The slurry was prepared for DFA testing and was composed of cross sections of the brain stem and all three lobes of the cerebellum. Approximately 0.10 g of brain tissue on the swab was placed into a homogenization tube from a ceramic bead kit with 1.4-mm beads (catalog no. 19-627; Omni International, Kennesaw, GA) containing silica beads and 1.0 ml of Eagle's minimum essential medium supplemented with 10% fetal bovine serum (10% suspension) and frozen at −80°C until homogenization and lysis could be performed. Homogenization, performed in a biological safety cabinet, utilized the Bertin Precellys 24 instrument with a protocol of two cycles of 5,000 rpm for 20 s. Homogenate (200 μl) was added to freshly made lysis buffer and processed per the manufacturer's instructions. Off board lysis, and subsequent nucleic acid extraction, was performed using the Complex200_OBL_V4_DSP protocol and the QIAsymphony DSP virus/pathogen minikit as per the manufacturer's instructions. The internal control, RNA transcript GFP at a quantity of 2.2 × 106 gene copies/reaction, was spiked into lysis buffer immediately prior to the processing of samples. Nucleic acid was extracted on the QIAsymphony SP (sample prep) and eluted in 110 μl. The samples were bar coded for ease of extraction and assay setup and to improve accuracy (23). Eluted nucleic acid was kept at 4°C, while template addition was performed by the QIAsymphony AS. The qRT-PCR was accomplished using the Rotor-Disc 72 with duplicate reactions for the following: 32 samples, rabies positive control, no-template control, and GFP control. qRT-PCR was carried out on the Rotor-Gene Q 5plex platform with the following cycling conditions: (i) 50°C for 30 min; (ii) 95°C for 15 min; (iii) 45 cycles, with 1 cycle consisting of 94°C for 15 s and 50°C for 1 min. Real-time results were analyzed using the Rotor-Gene Q 5plex software. A cutoff value for determining a positive real-time result was set at a CT value of 37. All molecular testing was performed in a blind manner.

RESULTS

Specificity and sensitivity of qRT-PCR.

Examination of a lyssavirus library (Table 1) by qRT-PCR demonstrated that the primer/probes selected were capable of detecting all classical rabies virus tested but failed to detect non-rabies virus lyssaviruses EBLV-1 and EBLV-2. The LODs of the two primer/probes ranged from a maximum of 100 gene copies per reaction (GC/RXN) to 33,000 GC/RXN. The RABVD1 primer/probe was more successful in detection of the 27 variants, with an average LOD of 560 GC/RXN (range, 100 to 4,000 GC/RXN). The RABVD2 primer/probe presented an average LOD of 7,525 GC/RXN (range, 100 to 33,000 GC/RXN) when tested against the 27 variants. All lyssaviruses (Table 1) found to be detected by RT-PCR had at least one primer probe set with an efficiency above 83%. All but eight isolates had at least one primer probe set with an efficiency of more than 90%. This was done to ensure that the triplex real-time assay would detect viral variants at lower concentrations of target. The RABVD2-RC primer and probe set showed a reduced sensitivity, with an initial LOD of approximately 1,000 GC/RXN. Using the RNA transcript, an approximate LOD could be determined for all isolates in the library (Table 1). All LOD values listed in Table 1 assume equivalent assay efficiency to the synthesized transcript variant. Due to the degenerate nature of the primers and probes along with the heterogeneous nature of the rabies virus genome sequence between variants, differences in assay efficiency are seen.

Each isolate was compared against the linear portion of a standard curve on the ABI 7500 instrument. Each isolate was run alongside the spectrophotometrically quantitated and diluted transcript. The standard curve was a six-point dilution series to extinction. After ensuring that the standard curve performed as expected, the ABI software automatically calculated the GC/RXN from the CT value using a logarithmic formula.

An assessment of the real-time assay efficiency for each variant with each real-time primer and probe set was necessary to ensure that these LOD estimations were reasonable.

Reduced assay sensitivity was observed when fast cycling conditions and increased ramping speeds were employed with the two rabies virus TaqMan instruments employed in this study (data not shown). In our hands, maximum sensitivity employing the described primer/probe sets was obtained with the ABI 7500 instrument. As a result, we employed the ABI instrument when testing the lyssavirus library. These primers and probes were designed for maximum detection using degenerate bases with low melting temperatures. The primers/probes performed best under slower temperature ramping conditions with a reduction of assay sensitivity of more than 1 log unit observed when fast conditions were employed using multiple qRT-PCR kits (validation data not shown).

Additional testing was performed on 67 viral isolates that represent bat rabies virus variants found in other regions of North America or on terrestrial variants historically but not presently seen in New York State (Arctic fox variant) (see Table S2 in the supplemental material). Results demonstrate that both primer/probe sets were successful in detecting all isolates.

Virus isolation and qRT-PCR were performed for all isolates in Table 1. The average TCID50 obtained from these isolates was 1.52 × 106/ml. The average number of gene copies obtained from these same isolates was 7.1 × 1011/ml. Additional rabies virus isolates, including 12 bat species obtained from Colorado and Texas were tested using the triplex assay, and the results were tabulated (see Table S2 in the supplemental material). All isolates tested were recognized with the primer/probe sets employed.

No cross-reactivity was found with any of the agents used in the specificity panel (see Table S1 in the supplemental material).

Comparison of qRT-PCR with DFA testing.

Of the 1,001 routine rabies diagnostic animal specimens tested, 141 (14.1%) were positive for rabies virus by both the DFA and qRT-PCR procedures. Brain tissue samples that previously tested as positive by DFA (141 samples) were detected by both primer and probe sets in the triplex real-time assay (see Tables S3 and S4 in the supplemental material). One brain tissue sample taken from Eptesicus fuscus, negative by DFA, was positive for rabies virus RNA by qRT-PCR. Only the RABVD1 primer and probe set was able to detect this sample with an average CT value between replicates as 31.53 (standard deviation [SD], 0.12) and GFP average CT value between replicates was 28.16 (SD, 0.21). This one Eptesicus fuscus sample not detected by DFA had the highest CT value (indicating the lowest rabies virus load) of all positive samples. Our unpublished data have shown that brain tissue samples with CT values of 31 have sparse viral antigen loads that are potentially undetectable by the DFA. A second extraction of the original brain tissue homogenate and qRT-PCR results were repeated, resulting in RABVD1 qRT-PCR average replicate CT values of 31.17 (SD, 0.36) and GFP replicate average CT values of 28.25 (SD, 0.05).

The qRT-PCR results for the other 859 samples negative by DFA were universally negative. No cross contamination or false-positive results were observed, despite an average rabies CT value of 16.4 for positive specimens.

Five hundred additional Eptesicus fuscus specimens collected in 2013, found negative by DFA, were tested with the triplex qRT-PCR assay in an attempt to find additional samples positive for viral RNA below the sensitivity limits of the DFA test. No further positive results were identified.

Additional testing was performed on 67 viral isolates that represent bat rabies virus variants found in other regions of North America or on terrestrial isolates historically but not presently seen in New York State (Arctic fox variant) (see Table S2 in the supplemental material). Results demonstrate that both primer/probe sets were successful in detecting all isolates.

DISCUSSION

The aims of the current study were to develop a TaqMan one-step qRT-PCR assay capable of detecting lyssavirus variants found circulating in the United States and to assess its use for routine rabies virus detection. The scope of this study was limited to the United States, as it became evident that our test failed to detect the non-rabies virus lyssaviruses EBLV-1 and EBLV-2, found in Europe.

The criteria for the construct of the real-time assay(s) included the detection of two targets for classical genotype one rabies virus, along with the detection of an exogenous spiked control for extraction, reverse transcription, and inhibition detection. The decision to make the assay triplex was based on the requirement of developing an affordable, sensitive, and specific detection and confirmation method all within one replicate. This would allow for a streamlined method for routine detection of a high submission number of animal specimens. One qRT-PCR of the triplex assay as described, without need for replicate testing or multiple assays, would provide all necessary components for a definitive rabies virus RNA determination on the rabies variants tested (14). This double-check strategy has been utilized in rabies detection previously with a panlyssavirus detection goal with good success (10). Development included streamlining pre-nucleic acid processing; automating nucleic acid extraction, qRT-PCR template addition, and detection; assessing and assembling primer/probe sets for PCR, validating the assay, and directly comparing results with those for DFA. The results demonstrate that qRT-PCR may have potential for routine rabies diagnostics in the United States and in countries where classical rabies virus is endemic.

The QIAsymphony SP/AS instrumentation was able to process high viral load samples side by side with negative samples without cross contamination. This is especially critical in routine rabies diagnosis, as false-positive results would result in human postexposure prophylaxis, the unnecessary euthanasia of companion and farm animals, and the myriad of domestic and wild animal control issues resulting from the detection of rabies in an area previously free of terrestrial animal rabies. Nucleic acid extraction efficiency from brain tissue homogenates was determined by comparing the GFP CT values from all brain tissue samples negative for rabies virus RNA, with CT values from an equivalent dilution of the spiking GFP that was included on each real-time plate. The extraction efficiency, based on the 1.1 average CT difference between the two values, is 55%. In actuality, the extraction efficiency for the rabies virus nucleic acid is most likely higher than this value. Previously performed clinical nucleic acid extraction validation studies have indicated that the extraction efficiency of viral RNA tends to be more robust than that of the small RNA transcript used for an extraction control in this study (NYS Laboratory of Viral Diseases, data not shown). In order to verify the absence of PCR inhibition in samples, an acceptable GFP CT range for rabies virus RNA-negative samples was established. This range was based on 2 standard deviations from the average GFP CT value of 25.5 to 30. Only 3.7% of brain tissue samples showed inhibition over this limit. These data suggest that a move away from TRIzol, the extraction method most commonly used for rabies virus nucleic acid extraction, to an automated method is possible and adds to the feasibility of a molecule-based diagnostic technique.

CTs higher than 37 or 38 can be difficult to consistently reproduce and may be a result of nonspecific binding and/or probe degradation. Clinically, CTs of 37 to 45 are often called indeterminate due to the low (or nonexistent) and inconsistent viral load in the sample.

The robotic system employed fits the needs of a high-volume rabies laboratory in terms of extraction capability (1 to 96 samples) and a streamlined nucleic acid extraction, and template addition automated system. Extremely high viral gene copy samples are common in rabies diagnosis. A one-step process in a closed system, as employed in this study, reduces the risk of contamination.

Samples found positive for rabies virus RNA by qRT-PCR and negative for rabies virus antigen by DFA were fewer than expected. A previously published study (21) assessing DFA-negative, qPCR-positive raccoon brain stem tissue reported higher rates of real-time detection than we observed in this study, 10/721 samples as opposed to our 1/859 sample group. Our study included all routine submitted species during the fall of 2011 and was not limited to vector species, such as raccoons, skunks, and bats. Of the 859 samples negative by DFA, only 518 (60%) were vector species. The samples tested were collected over a 3-month period, which did not include the busier summer months. Perhaps additional positive results detected only by qRT-PCR and not DFA would be found from specimens collected in the summer months when bat submissions dominate the workload. High heat and accelerated decomposition have been shown to have a negative impact on sample integrity and DFA performance (24, 25). Previous work indicates that molecular methods for rabies virus detection are effective for a longer time period than DFA when employed on decomposing tissues (24). We are currently assessing the ability of our molecular assay to detect rabies virus RNA in samples identified as unsatisfactory for DFA testing. Such samples include decomposed or mutilated specimens and submissions that do not include the DFA requisite tissues. Previously published studies have utilized various endogenous controls to monitor for RNA integrity (7, 26). In order to determine truly rabies virus-negative results with confidence from decomposed samples, the establishment and validation of an acceptable value for a qPCR test designed to detect endogenous controls, such as a constitutive gene, would be required.

The discrepancy demonstrated between the number of gene copies and TCID50 results on all rabies virus isolates was notable (Table 1). This inconsistency may be the result of multiple factors, including the number of gene copies necessary for the production of an in vitro infectious unit, the presence of inactivated virus in necropsy specimens, and the increased sensitivity seen with the molecular detection technique.

The standard protocol for DFA testing (22) requires that two different fluorescein-labeled conjugates targeting differing rabies virus epitopes be employed for testing all diagnostic specimens in the United States as a method to reduce or eliminate any potential false-negative results due to antigenic drift. Similarly, we selected two different primer/probe combinations to ensure that isolates with viral sequence mutations are still detected. The two primer and probe sets included for rabies virus RNA detection were selected based on the extensive validation performed in the 2009 Nadin-Davis et al. study (13), along with the in-house evaluation of the detection efficiency for rabies virus variants. Due to the conserved nature of the N gene and the higher number of published sequences available for primer and probe design, most diagnostic assays have targeted this region (10, 12, 13, 22). Targeting the N gene with a one-step RT-PCR assay allows for the detection of viral RNA as well the subsequently transcribed mRNA, found in highest abundance from the N gene, located first on the rabies virus genome (27). This double-check strategy has previously been utilized successfully in a rabies detection method for broader rabies virus variant detection in human antemortem testing (10). Nevertheless, the possibility of nucleic acid sequence variations due to genetic drift is a concern for consistently reliable results (28). Although employing a different primer/probe selection as reported in the present study, false-negative results with rabies TaqMan PCRs have previously been reported (26). The variable LODs experienced on various rabies virus isolates seen in Table 1 is indication of the altered sensitivity due to nucleic acid sequence variation.

The decision to triplex the assay was based on the requirement of developing an affordable, sensitive, and specific detection and confirmation method all within one replicate. This would allow for a streamlined method for routine detection of high daily submission numbers of animal specimens. One qRT-PCR of the triplex assay as described, without need for replicate testing or multiple assays, would provide all necessary components for a definitive rabies virus RNA determination on the rabies variants tested (14).

If human antemortem testing is performed, the assay described will work well for rabies virus variants currently circulating in the United States. However, other lyssavirus species must be considered and additional assays employed if patient travel history is indicated. Due to the high viral load in the routine diagnostic samples, strict training and quality control measures such as unidirectional work flow, designated pipettes, gowns, and distinct laboratory areas for extraction and amplification would be essential. Swipe testing and other quality assurance practices common to human diagnostic laboratories would need to be implemented. This would include supportive training for rabies diagnostic laboratories with minimal molecular experience. In addition, reporting algorithms, with an understanding of assay limitations, would need to be developed. Due to the serious consequences of false-negative results, it would be prudent to perform DFA and virus isolation as well as qRT-PCR on samples that fall into a higher-risk category, such as human bite cases by vector species. This would also allow the opportunity for new lyssaviruses of novel sequence to be identified and ensure that the primer and probe design reflects current circulating variants. Periodic sequencing of a subset of submitted variants could also ensure that target primers and probes are still relevant. Remaining RNA from molecular testing would be available to screen for additional agents of interest and pathogen discovery. The less subjective nature of molecular testing and the more universal skills required to perform molecular detection methods may be of great value to smaller health departments in which laboratory staff perform multiple functions, including multiple molecular assays. Additionally, the requirement to develop a high level of expertise in microscopy as achieved in the larger state and reference rabies laboratories would be reduced.

The New York State Department of Health Rabies Laboratory is currently using the qRT-PCR assay described and virus isolation as backup procedures for DFA on select specimens. This includes high-suspect animal submissions that have bitten a human (wild mesocarnivores, all bat species, cats with neurological disorders). The assay is also utilized on decomposed specimens that have been reported as giving indeterminate results in the DFA. At this time, positive rabies results are reported only from the DFA or viral isolation tests.

The most arduous aspect of routine rabies diagnosis is the necropsy procedure. This procedure produces the highest potential for accidental exposure to a lyssavirus. As such, strict attention to safety is mandated through the use of personal protective equipment, engineering controls, immunization, and training. Obtaining fresh tissue from the diagnostically significant areas of the brain is paramount in obtaining the highest sensitivity as demanded in rabies diagnosis. The necropsy procedure is nonetheless required for molecular testing in rabies diagnosis. Given that molecular diagnosis may be considerably more sensitive than the DFA, it remains to be seen whether altered sample collection techniques may have an application in rabies diagnosis. Such techniques may be more efficient in time and effort but will become standard only after exhaustive parallel testing with the accepted sampling techniques. While a universal testing algorithm may not be applicable worldwide, given the highly divergent nature of lyssavirus genomes and the discrepancies in available technology and resources, regional laboratories may be capable of utilizing one protocol for rabies testing. Currently, routine use of qRT-PCR may not be practical for all laboratories; however, as molecular diagnostic methods continue to evolve, increasing pressure to streamline and consolidate diagnostic disciplines can be expected.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was supported in part by a contract with Qiagen to supply the QIAsymphony RGQ system, Rotor-Gene, consumables, and salary reimbursement for S.B.

We thank the Applied Genomic Technologies Core facility at the Wadsworth Center, New York State Health Department for nucleotide sequencing. We are grateful to the Wadsworth Center Laboratory for Viral Diseases for supplying the GFP transcript employed as an internal control on all samples and for providing invaluable assistance through consultation and discussions during the production of the purified RNA transcript utilized for the LOD determination. We thank P. Masters, J. Taylor, R. Limberger, and K. St. George for helpful discussions during this work. The Wadsworth Center's laboratories of virology, bacteriology, and parasitology shared sequences to build the specificity panel. We gratefully acknowledge the Colorado and Texas Health Departments for sharing numerous rabies virus variants. We thank the three anonymous reviewers whose comments added depth and clarity to this work.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JCM.01227-15.

REFERENCES

  • 1.Steele JH, Fernandez PJ. 1991. History of rabies and global aspects, p 1–24. In Baer GM. (ed), The natural history of rabies, 2nd ed CRC Press, Boca Raton, FL. [Google Scholar]
  • 2.International Committee on Taxonomy of Viruses. 2014. Virus taxonomy: 2014 release. Executive Committee 46, Montreal, Canada, July 2014 http://ictvonline.org/virusTaxonomy.asp?taxnode_id=20140713. [Google Scholar]
  • 3.Calisher CH, Hume JE, Field E, Holmes KV, Schountz T. 2006. Bats: important reservoir hosts of emerging viruses. Clin Microbiol Rev 19:531–545. doi: 10.1128/CMR.00017-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Dean DJ, Abelseth MK, Atanasiu P. 1996. The fluorescent antibody test, p 88–93. In Meslin F-X, Kaplan MM, Koprowski H (ed), Laboratory techniques in rabies, 4th ed World Health Organization monograph series, no. 23. World Health Organization, Geneva, Switzerland. [Google Scholar]
  • 5.Hayman DT, Banyard AC, Wakeley PR, Harkess G, Marston D, Wood JL, Cunningham AA, Fooks AR. 2011. A universal real-time assay for the detection of Lyssaviruses. J Virol Methods 177:87–93. doi: 10.1016/j.jviromet.2011.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fischer M, Wernike K, Freuling CM, Müller T, Aylan O, Brochier B, Cliquet F, Vázquez-Morón S, Hostnik P, Huovilainen A, Isaksson M, Kooi EA, Mooney J, Turcitu M, Rasmussen TB, Revilla-Fernández S, Smreczak M, Fooks AR, Marston DA, Beer M, Hoffmann B. 2013. A step forward in molecular diagnostics of lyssaviruses–results of a ring trial among European laboratories. PLoS One 8:e58372. doi: 10.1371/journal.pone.0058372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wakeley PR, Johnson N, McElhinney LM, Marston D, Sawyer J, Fooks AR. 2005. Development of a real-time, TaqMan reverse transcription-PCR assay for detection and differentiation of lyssavirus genotypes 1, 5, and 6. J Clin Microbiol 43:2786–2792. doi: 10.1128/JCM.43.6.2786-2792.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wacharapluesadee S, Phumesin P, Supavonwong P, Khawplod P, Intarut N, Hemachudha T. 2011. Comparative detection of rabies RNA by NASBA, real-time PCR and conventional PCR. J Virol Methods 175:278–282. doi: 10.1016/j.jviromet.2011.05.007. [DOI] [PubMed] [Google Scholar]
  • 9.Mani RS, Madhusudana SN. 2013. Laboratory diagnosis of human rabies: recent advances. ScientificWorldJournal 2013:569712. doi: 10.1155/2013/569712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hoffmann B, Freuling CM, Wakeley PR, Rasmussen TB, Leech S, Fooks AR, Beer M, Müller T. 2010. Improved safety for molecular diagnosis of classical rabies viruses by use of a TaqMan real-time reverse transcription-PCR “double check” strategy. J Clin Microbiol 48:3970–3978. doi: 10.1128/JCM.00612-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.De Benedictis P, De Battisti C, Dacheux L, Marciano S, Ormelli S, Salomoni A, Caenazzo ST, Lepelletier A, Bourhy H, Capua I, Cattoli G. 2011. Lyssavirus detection and typing using pyrosequencing. J Clin Microbiol 49:1932–1938. doi: 10.1128/JCM.02015-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, Marston DA, Dastjerdi A, Wright E, Weiss RA, Müller T. 2009. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis 3:e530. doi: 10.1371/journal.pntd.0000530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nadin-Davis SA, Sheen M, Wandeler AI. 2009. Development of real-time reverse transcriptase polymerase chain reaction methods for human rabies diagnosis. J Med Virol 81:1484–1497. doi: 10.1002/jmv.21547. [DOI] [PubMed] [Google Scholar]
  • 14.Burd EM. 2010. Validation of laboratory-developed molecular assays for infectious diseases. Clin Microbiol Rev 23:550–576. doi: 10.1128/CMR.00074-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Black EM, McElhinney LM, Lowings JP, Smith J, Johnstone P, Heaton PR. 2000. Molecular methods to distinguish between classical rabies and the rabies-related European bat lyssaviruses. J Virol Methods 87:123–131. doi: 10.1016/S0166-0934(00)00159-2. [DOI] [PubMed] [Google Scholar]
  • 16.Heaton PR, Johnstone P, McElhinney LM, Cowley R, O'Sullivan E, Whitby JE. 1997. Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses. J Clin Microbiol 35:2762–2766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rudd RJ, Trimarchi CV. 1989. Development and evaluation of an in vitro virus isolation procedure as a replacement for the mouse inoculation test in rabies diagnosis. J Clin Microbiol 27:2522–2528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Webster LT, Dawson JR. 1935. Early diagnosis of rabies by mouse inoculation; measurement of humoral immunity to rabies by mouse protection test. Proc Soc Exp Biol Med 32:570–573. doi: 10.3181/00379727-32-7767P. [DOI] [Google Scholar]
  • 19.Reed LJ, Muench H. 1938. A simple method of estimating fifty percent endpoints. Am J Hyg 27:493–497. [Google Scholar]
  • 20.Tavakoli NP, Nattanmai S, Hull R, Fusco H, Dzigua L, Wang H, Dupuis M. 2007. Detection and typing of human herpesvirus 6 by molecular methods in specimens from patients diagnosed with encephalitis or meningitis. J Clin Microbiol 45:3972–3978. doi: 10.1128/JCM.01692-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Szanto AG, Nadin-Davis SA, Rosatte RC, White BN. 2011. Re-assessment of direct fluorescent antibody negative brain tissues with a real-time PCR assay to detect the presence of raccoon rabies virus RNA. J Virol Methods 17:110–116. doi: 10.1016/j.jviromet.2011.04.009. [DOI] [PubMed] [Google Scholar]
  • 22.Centers for Disease Control and Prevention. 2011. Protocol for postmortem diagnosis of rabies in animals by direct fluorescent antibody testing: a minimum standard for rabies diagnosis in the United States. Centers for Disease Control and Prevention, Atlanta, GA: http://www.cdc.gov/rabies/pdf/rabiesdfaspv2.pdf. [Google Scholar]
  • 23.Snyder SR, Favoretto AM, Derzon JH, Christenson RH, Kahn SE, Shaw CS, Baetz RA, Mass D, Fantz CR, Raab SS, Tanasijevic MJ, Liebow EB. 2012. Effectiveness of barcoding for reducing patient specimen and laboratory testing identification errors: a Laboratory Medicine Best Practices systematic review and meta-analysis. Clin Biochem 45:988–998. doi: 10.1016/j.clinbiochem.2012.06.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.McElhinney LM, Marston DA, Brookes SM, Fooks AR. 2014. Effects of carcase decomposition on rabies virus infectivity and detection. J Virol Methods 207:110–113. doi: 10.1016/j.jviromet.2014.06.024. [DOI] [PubMed] [Google Scholar]
  • 25.Rojas Anaya E, Loza-Rubio E, Banda Ruiz VM, Hernández Baumgarten E. 2006. Use of reverse transcription-polymerase chain reaction to determine the stability of rabies virus genome in brains kept at room temperature. J Vet Diagn Invest 18:98–101. doi: 10.1177/104063870601800115. [DOI] [PubMed] [Google Scholar]
  • 26.Hughes GJ, Smith JS, Hanlon CA, Rupprecht CE. 2004. Evaluation of a TaqMan PCR assay to detect rabies virus RNA: influence of sequence variation and application to quantification of viral loads. J Clin Microbiol 42:299–306. doi: 10.1128/JCM.42.1.299-306.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Albertini AAV, Ruigrok RWH, Blondel D. 2011. Rabies virus transcription and replication. Adv Virus Res 79:1–22. doi: 10.1016/B978-0-12-387040-7.00001-9. [DOI] [PubMed] [Google Scholar]
  • 28.Whiley DM, Lambert SB, Bialasiewicz S, Goire N, Nissen MD, Sloots TP. 2008. False-negative results in nucleic acid amplification tests - do we need to routinely use two genetic targets in all assays to overcome problems caused by sequence variation? Crit Rev Microbiol 34:71–76. doi: 10.1080/10408410801960913. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES