Cotrimoxazole prophylaxis was associated with reduced malaria incidence among human immunodeficiency virus-exposed, uninfected infants. Cotrimoxazole's protective benefits were more pronounced on asymptomatic infections, potentially affecting the malaria reservoir responsible for transmission. Therefore, cotrimoxazole prophylaxis may have important individual and public health benefits.
Keywords: antifolate resistance, cotrimoxazole, HIV, infant, malaria
Abstract
Background. Cotrimoxazole preventive therapy (CPT) is recommended for all human immunodeficiency virus (HIV)–exposed infants to avoid opportunistic infections. Cotrimoxazole has antimalarial effects and appears to reduce clinical malaria infections, but the impact on asymptomatic malaria infections is unknown.
Methods. We conducted an observational cohort study using data and dried blood spots (DBSs) from the Breastfeeding, Antiretrovirals and Nutrition study to evaluate the impact of CPT on malaria infection during peak malaria season in Lilongwe, Malawi. We compared malaria incidence 1 year before and after CPT implementation (292 and 682 CPT-unexposed and CPT-exposed infants, respectively), including only infants who remained HIV negative by 36 weeks of age. Malaria was defined as clinical, asymptomatic (using DBSs at 12, 24, and 36 weeks), or a composite outcome of clinical or asymptomatic. Linear and binomial regression with generalized estimating equations were used to estimate the association between CPT and malaria. Differences in characteristics of parasitemias and drug resistance polymorphisms by CPT status were also assessed in the asymptomatic infections.
Results. CPT was associated with a 70% (95% confidence interval, 53%–81%) relative reduction in the risk of asymptomatic infection between 6 and 36 weeks of age. CPT appeared to provide temporary protection against clinical malaria and more sustained protection against asymptomatic infections, with no difference in parasitemia characteristics.
Conclusions. CPT appears to reduce overall malaria infections, with more prolonged impacts on asymptomatic infections. Asymptomatic infections are potentially important reservoirs for malaria transmission. Therefore, CPT prophylaxis may have important individual and public health benefits.
The World Health Organization (WHO) recommends that all human immunodeficiency virus (HIV)–exposed infants begin cotrimoxazole preventive therapy (CPT) between 4 and 6 weeks of age, and continue CPT until at least 6 weeks after cessation of breastfeeding and until HIV infection has been ruled out [1]. CPT is used to avoid often-fatal opportunistic infections among children born to HIV-infected women, and in turn reduces hospital admissions. CPT use among HIV-infected adults and children has been associated with reductions in malaria incidence, as cotrimoxazole has antimalarial activity [2–4]. Similarly, CPT has been associated with reduced incidence of clinical malaria among HIV-exposed but uninfected (HEU) infants, with some suggestion that protective benefits may wane over time [5–7]. As early infant HIV diagnosis services are becoming more widely available in Africa, and as more efficacious drug regimens for the prevention of mother-to-child HIV transmission are being adopted and extended throughout the breastfeeding period, the population of HEU infants is growing. A better understanding of the impact of CPT on malaria among HEU infants is needed.
To date, only clinical or symptomatic malaria has been examined in studies of CPT use and malaria incidence. However, clinical malaria represents only a portion of all malaria infections, as many malaria infections are asymptomatic. Although asymptomatic infections are more common in older children, they do occur in infants. We assessed the association between CPT and a composite outcome of clinical or asymptomatic infection. Additionally, we evaluated the association between CPT and both clinical and asymptomatic infections separately. Including asymptomatic infection adds valuable information concerning the routine use of CPT among the growing population of HEU infants, as the role of asymptomatic parasitemia in malaria transmission has garnered increasing attention. Although density of parasitemia and gametocytemia affects transmission efficiency [8], transmission may occur from asymptomatic patients and patients with submicroscopic parasitemia [9].
In addition to assessing the impact of CPT on malaria infection, we also compared characteristics of the asymptomatic infections by CPT status. Specifically, we assessed (1) parasitemia levels; (2) complexity of individual infections, as in high-transmission areas such as Malawi infections are often polyclonal; and (3) frequency of single-nucleotide polymorphisms in dhfr and dhps, the genes associated with resistance to antifolate antimalarials. Because resistance to antifolate antimalarials is common in Africa, understanding how CPT affects parasite characteristics and works in the presence of high levels of antifolate resistance is important.
METHODS
Study Design
We used data and infant dried blood spot (DBS) specimens from the Breastfeeding, Antiretrovirals, and Nutrition (BAN) study, which has been described elsewhere [10, 11]. Beginning in June 2006, 240 mg of cotrimoxazole was provided once daily to all HIV-exposed infants 6 weeks after birth, or as soon as possible thereafter, and continued through 36 weeks of age due to compliance with Malawian national guidelines and WHO recommendations. Infants reaching 36 weeks of age prior to June 2006 did not routinely receive CPT. To compare malaria incidence 1 year before and after implementation of CPT, we included HEU infants born between 22 August 2004 and 21 August 2005 (CPT unexposed, n = 292), and those born between 22 August 2006 and 21 August 2007 (CPT exposed, n = 682). Dates were chosen to ensure that all infants were at least 6 weeks of age (and therefore eligible for CPT in the later time period) by the start of peak malaria season (October), and to mitigate any confounding effects of calendar time. Infant HIV-1 status was determined by Roche Amplicor 1.5 DNA polymerase chain reaction (PCR) (Roche Molecular Systems, Pleasanton, California) at 2, 12, 28, and 48 weeks. PCR-positive results were confirmed by testing an additional blood specimen, and the window of infection was narrowed with tests of infant DBS specimens taken at 4, 6, 8, 18, 24, 32, and 36 weeks. All mothers were advised to breastfeed exclusively for the first 24 weeks postpartum, and to wean between 24 and 28 weeks.
Only malaria events occurring during peak malaria season (October–April) were used to increase the likelihood of detecting clinical and asymptomatic parasitemias. Infants born between 22 August 2005 and 21 August 2006 were excluded to avoid exposure misclassification while the new CPT policy was being implemented. Infants who were diagnosed as HIV infected between birth and 36 weeks of age (n = 84) or had a documented episode of clinical malaria before 6 weeks of age (n = 8) were excluded. A total of 882 infants of the 2369 mother–infant pairs enrolled in the BAN study cohort met eligibility criteria.
Data Analyses
Malaria was defined 3 ways: (1) clinical, (2) asymptomatic, and (3) a composite outcome of clinical and asymptomatic. Clinical malaria was defined as having clinical symptoms of malaria with documented microscopy-positive parasitemia between 6 and 36 weeks of age (n = 148). In addition, infants with a documented serious adverse event due to malaria were considered as having clinical malaria even if documented microscopy-positive parasitemia was unavailable (n = 4). To assess for changes in the association between CPT and malaria by infant age, clinical malaria was also categorized as occurring at 6–12, 13–24, or 25–36 weeks of age. If an infant had multiple malaria events, only events occurring >1 week apart were counted as a recurrent event and used in analyses.
Asymptomatic infection was determined from available DBS specimens collected during peak malaria season. A total of 471, 517, and 564 infants were 12, 24, and 36 weeks of age, respectively, during peak malaria season. Among these, DBSs were available for 230 (49%) infants at 12 weeks of age, 235 (45%) at 24 weeks, and 215 (38%) at 36 weeks. Infants who were missing DBSs at 12, 24, or 36 weeks did not differ from infants who had an available DBS, with respect to characteristics outlined in Table 1. Missing asymptomatic infection information was therefore considered missing completely at random. Samples testing positive for malaria parasites by 2 previously described real-time PCR assays were considered positive [12]. Samples positive with only 1 assay were considered indeterminate and not used in analyses. Asymptomatic infection was treated as a dichotomous variable (detectable vs undetectable parasitemia).
Table 1.
Baseline Characteristics of Mother–Infant Pairs
| Characteristic | Total (N = 882) | No Malariaa (n = 701) | Malariaa (n = 181) |
|---|---|---|---|
| Antiretroviral randomization | |||
| Maternal antiretroviral | 294 (33) | 235 (34) | 59 (33) |
| Infant nevirapine | 297 (34) | 239 (34) | 58 (32) |
| Enhanced control | 291 (33) | 227 (32) | 64 (35) |
| Nutritional randomization | |||
| No supplement | 449 (51) | 357 (51) | 92 (51) |
| Received supplement | 433 (49) | 344 (49) | 89 (49) |
| Mothersb | |||
| Age, y | |||
| 15–25 | 436 (50) | 355 (51) | 81 (45) |
| 26–35 | 404 (46) | 312 (45) | 92 (51) |
| 36–45 | 39 (4) | 33 (5) | 6 (3) |
| Parity | |||
| 0 | 133 (15) | 109 (16) | 24 (13) |
| ≥1 | 748 (85) | 591 (84) | 57 (87) |
| Education | |||
| Primary school only | 567 (64) | 441 (63) | 126 (70) |
| More than primary school | 314 (36) | 260 (37) | 54 (30) |
| Infantsb | |||
| Sex | |||
| Female | 443 (50) | 350 (50) | 93 (51) |
| Male | 439 (50) | 351 (50) | 88 (49) |
| Birth weight, kg | |||
| <2.5 | 66 (8) | 56 (8) | 10 (6) |
| ≥2.5 | 814 (93) | 643 (92) | 171 (94) |
| Hemoglobin, g/dL | |||
| <13.4 | 54 (6) | 44 (6) | 10 (6) |
| ≥13.4 | 828 (94) | 657 (94) | 171 (94) |
| Neutropenia, ×103 cells/µL | |||
| <1 | 23 (3) | 18 (3) | 5 (3) |
| ≥1 | 859 (97) | 683 (97) | 176 (97) |
Data are presented as No. (%).
a Malaria defined as clinical or polymerase chain reaction–positive malaria.
b Maternal age missing for 3 mother–infant pairs, parity and maternal education missing for 1 mother–infant pair, infant birthweight missing for 2 infants. Percentages may not add to 100 due to rounding.
We compared maternal malaria prevalence by time period to assess for any confounding effects of malaria transmission differences across calendar time. Malaria exposure can vary greatly across small geographic distances [13, 14]. Maternal malaria prevalence was therefore thought to provide a more valid proxy of transmission differences over time, compared to malaria prevalence data for the community at large. Maternal malaria prevalence was calculated using clinical malaria data among mothers with a CD4 count >500 cells/µL and therefore not receiving routine maternal CPT.
Frequencies, means, and medians were calculated, as appropriate, to compare characteristics of mother–infant pairs by exposure (CPT status) and outcome (malaria) category. Binomial regression models using generalized estimating equation (GEE) with an autoregressive correlation structure were used to estimate risk ratios (RRs) for malaria by CPT status when malaria was treated as a dichotomous variable. Linear regression with GEE was used when asymptomatic infection was treated as a continuous variable. Mann–Whitney test was used to assess differences in median parasitemia level and median multiplicity of infection (MOI) by CPT status, Fisher exact test was used to assess differences in maternal malaria prevalence by time period, and unpaired t test was used to assess differences in presence of resistance polymorphisms.
The following parameters were assessed for potential confounding or effect measure modification: BAN study antiretroviral and nutritional randomization assignment, maternal characteristics, infant health status information, and maternal malaria prevalence. Parameters were decided based on expert knowledge and use of a causal diagram to identify a minimally sufficient adjustment set [15]. Effect measure modification was assessed by comparing unadjusted and adjusted estimates and 95% confidence intervals (CIs) using an interaction term between CPT and the variable of interest. Covariates that produced adjusted estimates that were different enough to be clinically or programmatically relevant were considered effect measure modifiers. Among variables identified in the minimally sufficient adjustment set, confounding was assessed using a change-in-estimate approach. If the change-in-estimate of the odds ratio was >10% (|ln(ORreduced/ORfull)| > 0.10), and the covariate was not an effect measure modifier, the covariate was treated as a confounder. All data analyses were conducted using SAS version 9.3 (SAS Institute, Cary, North Carolina).
Molecular Analysis of Asymptomatic Parasitemias
Molecular analysis was performed on all DBSs to determine asymptomatic parasitemias. We determined the parasitemia of each infection using real-time PCR to detect the single-copy gene Plasmodium falciparum lactate dehydrogenase (pfldh) as previously described [16]. Parasitemia data by microscopy for clinical events was not recorded and no biologic specimens were available to perform molecular analysis. Complexity of infection was assessed by nested PCR amplification of merozoite surface protein 2 (msp2) as previously described [17]. The amplified fragments were sized by capillary electrophoresis using the High Sensitivity DNA1000 kit on an Agilent Tape Station 2200 (Agilent Technologies, Santa Clara, California). Bands representing >10% of the height of the largest peak in the sample were counted. Drug resistance polymorphism frequency was determined using a modified version of a previously described pooled deep sequencing approach [18, 19]. This approach uses pools created by mixing equal volumes of extracted DNA from each sample and has been shown to create accurate allele frequency measurements compared to Sanger sequencing of individual samples [18]. Pools for participants exposed and unexposed to CPT were created and amplified in duplicate for the dhfr and dhps regions containing key sulfadoxine-pyrimethamine resistance polymorphisms. The dhfr region was amplified using sequence-specific primers as previously reported [18]. The dhps region was amplified using 800 nM primer 437-F (TGAAATGATAAATAAGGTGCTAGTGT), 800 nM primer 613-R (GTTGTGTATTTATATTTTGATCATTC), KAPA HiFi Fidelity Buffer (KAPA Biosystems, Boston, Massachusetts), 400 µM KAPA dNTP Mix, 1 U of KAPA HiFi HotStart DNA Polymerase, and 5 µL of sample DNA with the following cycling parameters: 95°C for 3 minutes; 40 cycles of 98°C for 20 seconds, 63°C for 20 seconds, and 72°C for 60 seconds; and extension at 72°C for 2 minutes with a 4°C hold. The PCR products were then sheared as previously described [19], size selected by E-gel (Life Technologies, Grand Island, New York) and library prepped by the Ion Plus Fragment Library Kit (Life Technologies). The indexed libraries were sequenced on a 314 chip using an Ion Torrent PGM (Life Technologies). Read alignment and scoring of allele frequency were done as previously described [18]. The following polymorphic sites were evaluated: N51I, C59R, S108N, and I164L in dhfr and S436A, S436Y, S463F, A437G, K540E, A581G, A613S, and A613T in dhps.
RESULTS
CPT and Malaria
Characteristics of study participants are shown in Table 1. In addition, prevalence of clinical malaria among mothers with a CD4 count >500 cells/µL did not significantly differ by time period (23% in CPT-unexposed group, 19% in CPT-exposed group; P = .4).
The primary outcome was episodes of malaria, defined as a combination of clinical and/or asymptomatic infections. A total of 181 (21%) infants experienced at least 1 episode of clinical (n = 137) and/or asymptomatic (n = 61) infection, 11 infants had 2 episodes of clinical malaria, and 2 infants had 3 episodes of clinical malaria between 6 and 36 weeks of age during peak malaria season. Twelve infants experienced an episode of both asymptomatic infection and clinical malaria, with 5 infants experiencing both a clinical and asymptomatic infection event within a time interval (4 at 13–24 weeks and 1 at 25–36 weeks). In all cases, the asymptomatic event occurred >4 weeks after the clinical event and, therefore, both events were included in analyses. In total, 67 CPT-unexposed infants (26%) and 114 CPT-exposed infants (18%) experienced at least 1 episode of clinical malaria or asymptomatic infection.
Overall, daily infant CPT was associated with 0.65 (95% CI, .49–.86) times the risk of having clinical or asymptomatic infection between 6 and 36 weeks of age during peak malaria season, corresponding to a 35% (95% CI, 14%–51%) relative reduction in malaria (Table 2). When combining all time intervals and evaluating clinical malaria separately, daily CPT use was not associated with a statistically significant decrease in the relative risk of clinical malaria (RR, 0.81 [95% CI, .58–1.15]). However, CPT was associated with a large decrease in the relative risk of asymptomatic infection from 12 to 36 weeks (RR, 0.30 [95% CI, .19–.47]). Adjustment for infant birth weight and antiretroviral randomization had little to no impact.
Table 2.
Association Between Cotrimoxazole Preventive Therapy and Both Clinical Malaria and Asymptomatic Infection, by Infant Age
| Type of Infection | No. of Events | RR (95% CI) |
|---|---|---|
| Clinical or asymptomatic infection | ||
| Daily infant CPT vs no infant CPT | ||
| 6–12 wk | 30 | 0.38 (.19–.77) |
| 13–24 wk | 80 | 0.53 (.34–.80) |
| 25–36 wk | 98 | 0.96 (.63–1.48) |
| Overall: 6–36 wk | 208 | 0.65 (.49–.86) |
| Clinical malaria only | ||
| Daily infant CPT vs no infant CPT | ||
| 6–12 wk | 18 | 0.33 (.13–.82) |
| 13–24 wk | 40 | 0.85 (.44–1.63) |
| 25–36 wk | 94 | 0.96 (.62–1.49) |
| Overall: 6–36 wk | 152 | 0.81 (.58–1.15) |
| Asymptomatic infection only | ||
| Daily infant CPT vs no infant CPT | ||
| 12 wk | 12 | 0.26 (.09–.78) |
| 24 wk | 44 | 0.32 (.19–.55) |
| 36 wk | 5 | 0.14 (.02–1.27) |
| Overall: 12–36 wk | 61 | 0.30 (.19–.47) |
Abbreviations: CI, confidence interval; CPT, cotrimoxazole preventive therapy; RR, risk ratio.
The relative reduction in malaria risk differed by infant's age, with CPT having a stronger effect on malaria risk during the first few months of life and decreasing thereafter (Table 2). Comparing malaria type (clinical vs asymptomatic), daily CPT was associated with a 67% (95% CI, 18%–87%) relative reduction in the risk of clinical malaria between 6 and 12 weeks of infant age, but no statistically significant relative reduction thereafter. Daily CPT was associated with a 68%–86% relative reduction in the risk of asymptomatic infection during peak malaria season, compared with not receiving daily CPT. However, the relative reduction was not statistically significant at 36 weeks of age, likely due to the small number of asymptomatic infection events at 36 weeks (n = 5).
Impact of CPT on the Characteristics of Asymptomatic Infection
All infections detected by molecular methods in this study were P. falciparum infections. We were able to determine a parasitemia from all 61 available samples (CPT unexposed: 35 samples, CPT exposed: 26 samples; geometric mean: 2.75 genome equivalents/µL). When parasitemia occurred, the parasitemia levels were similar by CPT status (mean difference, −0.20 [95% CI, −.67 to .27]). Complexity of infection was determined for 58 of 61 (95%) samples. The use of CPT was not associated with a decrease in the MOI, with a mean MOI of 1.7 in the treated infants and 1.9 in the untreated infants (P = .5).
In total, 224 659 sequences spanning dhfr and dhps passed the sequencing quality and mapping filters, with a mean number of sequences per PCR of 28 082 (range, 17 885–36 213). All sites evaluated for known drug polymorphisms (listed in last sentence of “Methods” section) were covered by >1000 sequencing reads. Mutant alleles were seen only at 4 loci: dhfr N51I, C59R, and S108N, as well as dhps A437G. All other sites were pure wild type. Allele frequency for mutant alleles is shown in Table 3. Of note, sulfadoxine-pyrimethamine (Fansidar) was used as first-line treatment for uncomplicated malaria from 1993 to 2007, replacing chloroquine. Artemether-lumefantrine was officially adopted as first-line treatment in 2007 [20].
Table 3.
Frequency of Antifolate Resistance Mutations in Infants Unexposed or Exposed to Cotrimoxazole Preventive Therapy
| Resistance Mutation | Replicate 1 | Replicate 2 | Mean | SD | P Valuea |
|---|---|---|---|---|---|
| dhfr N51I | |||||
| CPT unexposed | 98.6 | 97.4 | 98.0 | 0.8 | .1 |
| CPT exposed | 99.5 | 99.4 | 99.5 | 0.1 | |
| dhfr C59R | |||||
| CPT unexposed | 96.6 | 96.5 | 96.6 | 0.1 | .6 |
| CPT exposed | 96.0 | 96.7 | 96.4 | 0.5 | |
| dhfr S108N | |||||
| CPT unexposed | 99.7 | 99.6 | 99.7 | 0.1 | .04 |
| CPT exposed | 99.9 | 99.9 | 99.9 | 0.0 | |
| No. of reads | |||||
| dhfr | 35 211 | 22 573 | 28 892 | 8936 | |
| dhps | 17 885 | 20 400 | 19 143 | 1778 | |
Abbreviations: CPT, cotrimoxazole preventive therapy; dhfr, dihydrofolate reductase; dhps, dihydropteroate synthetase; SD, standard deviation.
a P value based on an unpaired t test.
DISCUSSION
During peak malaria season, daily CPT given to HEU infants was associated with an overall reduction in the risk of malaria infection between 6 and 36 weeks of life. This adds to our previous findings that CPT is associated with reduced risk of severe clinical malaria year round, and reduced nonsevere clinical malaria in the first 10 weeks of life [5, 21]. However, we now provide the first evaluation of the impact of CPT on incidence and characteristics of asymptomatic infections among HEU infants. CPT remained effective at preventing asymptomatic infection even in the setting of very high sulfadoxine-pyrimethamine resistance. Reduction in malaria incidence occurred without significant changes in parasitemia levels, the complexity of infections, or the prevalence of drug resistance mutations.
Protection from asymptomatic parasitemia is important for several reasons. First, asymptomatic infections frequently become symptomatic [22, 23]. Second, it is likely that asymptomatic infections are not truly asymptomatic. There is concern that even asymptomatic infections may have measurable adverse clinical effects, in particular, hematologic abnormalities among children and pregnant women [24–27]. Last, concerns remain regarding the impact of asymptomatic infection on transmission. Transmission may occur from asymptomatic patients and patients with submicroscopic parasitemia [28, 29]. In feeding studies aimed at demonstrating the contribution of asymptomatic infections to transmission, 1.2% of mosquitoes feeding on asymptomatic persons vs 22% of mosquitoes feeding on symptomatic persons developed oocysts in their guts [30]. Therefore, reduction in asymptomatic infection is likely to have both individual clinical and public health benefits.
We previously evaluated the impact of CPT on malaria incidence in BAN without restricting the year or season of the clinical event, and found an overall protective effect of CPT on time to incident clinical malaria [5]. However, the protective benefits waned with infant age, similar to our current findings using peak season clinical malaria events. Additionally, CPT was found to be protective against severe clinical malaria (category 3 or 4 serious adverse event) and other severe infant morbidity and mortality outcomes in this study population, with no diminished effect as infants aged [21].
Exposure status was based on time period, with a random review of patient pharmacy records showing good adherence to CPT guidelines [5]. However, as in all studies some exposure misclassification is likely. In addition, we did not account for loss to follow-up and instead used methods that allowed for recurrent malaria events. However, we found a similar association between CPT and clinical malaria as previous BAN analyses that accounted for potentially different follow-up times by CPT exposure status.
Changes in national antimalarial policy increased the use of more effective artemisinin combination therapies for treatment of uncomplicated malaria during the study period. Increase in effective therapy in the community could potentially affect the risk of infection in the later time period (CPT exposed). However, our proxy for transmission (maternal malaria prevalence) did not indicate a significant or meaningful change in malaria prevalence between the 2 time periods. Last, the limited number of available blood specimens may have biased our sample if infants with and without an available specimen differed by unmeasured variables, such as use of insecticide-treated bed nets. However, infants with and without an available specimen did not differ by any measured baseline covariates in BAN, suggesting that these unmeasured variables are unlikely to have had a significant impact.
Our findings add to the literature detailing the malaria-related benefits of daily CPT use among HEU infants. As WHO guidelines now recommend administration of CPT to all HIV-exposed infants, it would be unethical to conduct a randomized controlled trial of CPT. Thus, retrospective observational studies such as this one are key to evaluating the impact of WHO CPT recommendations. Our findings support the claim that CPT reduces malaria in HEU infants. However, we add important new insights into the impacts of CPT on asymptomatic infection in a setting of high antifolate resistance. As millions of HEU infants are potentially given CPT amid high antifolate resistance, the reductions in asymptomatic parasitemias may reduce malaria transmission and be beneficial for malaria control.
Notes
Acknowledgments. The authors thank the Breastfeeding, Antiretrovirals, and Nutrition (BAN) study team (see Appendix), and all of the women and infants who participated in the study.
Disclaimer. The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the Centers for Disease Control and Prevention (CDC).
Financial support. This work was supported by the National Institute of Allergy and Infectious Diseases (NIAID) at the National Institutes of Health (NIH) (R03AI100694-A1). The BAN Study was supported by grants from the Prevention Research Centers Special Interest Project of the CDC (SIP 13-01 U48-CCU409660-09, SIP 26-04 U48-DP000059-01, and SIP 22-09 U48-DP001944-01); NIAID; the University of North Carolina Center for AIDS Research (P30-AI50410); the NIH Fogarty AIDS International Training and Research Program (DHHS/NIH/FIC 2-D43 TW01039-06, the Fogarty International Clinical Research Scholars Program R24 TW007988, the American Recovery and Reinvestment Act); and the Infectious Disease Epidemiology Training Grant (5T32AI070114). The antiretrovirals used in the BAN study were donated by Abbott Laboratories, GlaxoSmithKline, Boehringer Ingelheim, Roche Pharmaceuticals, and Bristol-Myers Squibb. The Call to Action PMTCT program was supported by the Elizabeth Glaser Pediatric AIDS Foundation, the United Nations Children's Fund, the World Food Program, the Malawi Ministry of Health and Population, Johnson & Johnson, and the US Agency for International Development.
Potential conflicts of interest. All authors: No reported conflicts.
All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.
APPENDIX
BAN Study Team at the University of North Carolina at Chapel Hill, Centers for Disease Control and Prevention in Atlanta, Georgia, and UNC Project team in Lilongwe, Malawi: Linda Adair, Yusuf Ahmed, Mounir Ait-Khaled, Sandra Albrecht, Shrikant Bangdiwala, Ronald Bayer, Margaret Bentley, Brian Bramson, Emily Bobrow, Nicola Boyle, Sal Butera, Charles Chasela, Charity Chavula, Joseph Chimerang'ambe, Maggie Chigwenembe, Maria Chikasema, Norah Chikhungu, David Chilongozi, Grace Chiudzu, Lenesi Chome, Anne Cole, Amanda Corbett, Amy Corneli, Anna Dow, Ann Duerr, Henry Eliya, Sascha Ellington, Joseph Eron, Sherry Farr, Yvonne Owens Ferguson, Susan Fiscus, Valerie Flax, Ali Fokar, Shannon Galvin, Laura Guay, Chad Heilig, Irving Hoffman, Elizabeth Hooten, Mina Hosseinipour, Michael Hudgens, Stacy Hurst, Lisa Hyde, Denise Jamieson, George Joaki (deceased), David Jones, Elizabeth Jordan-Bell, Zebrone Kacheche, Esmie Kamanga, Gift Kamanga, Coxcilly Kampani, Portia Kamthunzi, Deborah Kamwendo, Cecilia Kanyama, Angela Kashuba, Damson Kathyola, Dumbani Kayira, Peter Kazembe, Caroline C. King, Rodney Knight, Athena P. Kourtis, Robert Krysiak, Jacob Kumwenda, Hana Lee, Edde Loeliger, Dustin Long, Misheck Luhanga, Victor Madhlopa, Maganizo Majawa, Alice Maida, Cheryl Marcus, Francis Martinson, Navdeep Thoofer, Chrissie Matiki (deceased), Douglas Mayers, Isabel Mayuni, Marita McDonough, Joyce Meme, Ceppie Merry, Khama Mita, Chimwemwe Mkomawanthu, Gertrude Mndala, Ibrahim Mndala, Agnes Moses, Albans Msika, Wezi Msungama, Beatrice Mtimuni, Jane Muita, Noel Mumba, Bonface Musis, Charles Mwansambo, Gerald Mwapasa, Jacqueline Nkhoma, Megan Parker, Richard Pendame, Ellen Piwoz, Byron Raines, Zane Ramdas, John Rublein, Mairin Ryan, Ian Sanne, Christopher Sellers, Diane Shugars, Dorothy Sichali, Wendy Snowden, Alice Soko, Allison Spensley, Jean-Marc Steens, Gerald Tegha, Martin Tembo, Roshan Thomas, Hsiao-Chuan Tien, Beth Tohill, Charles van der Horst, Esther Waalberg, Elizabeth Widen, Jeffrey Wiener, Cathy Wilfert, Patricia Wiyo, Innocent Zgambo, Chifundo Zimba.
References
- 1.World Health Organization, United Nations Children's Fund. Co-trimoxazole prophylaxis for HIV-exposed and HIV-infected infants and children: practical approaches to implementation and scale up. Geneva, Switzerland: WHO/UNICEF, 2009. [Google Scholar]
- 2.Anglaret X, Chene G, Attia A, et al. Early chemoprophylaxis with trimethoprim-sulphamethoxazole for HIV-1-infected adults in Abidjan, Cote d'Ivoire: a randomised trial. Cotrimo-CI Study Group. Lancet 1999; 353:1463–8. [DOI] [PubMed] [Google Scholar]
- 3.Mermin J, Ekwaru JP, Liechty CA, et al. Effect of co-trimoxazole prophylaxis, antiretroviral therapy, and insecticide-treated bednets on the frequency of malaria in HIV-1-infected adults in Uganda: a prospective cohort study. Lancet 2006; 367:1256–61. [DOI] [PubMed] [Google Scholar]
- 4.Kamya MR, Gasasira AF, Achan J, et al. Effects of trimethoprim-sulfamethoxazole and insecticide-treated bednets on malaria among HIV-infected Ugandan children. AIDS 2007; 21:2059–66. [DOI] [PubMed] [Google Scholar]
- 5.Dow A, Kayira D, Hudgens M, et al. Effects of cotrimoxazole prophylactic treatment on adverse health outcomes among HIV-exposed, uninfected infants. Pediatr Infect Dis J 2012; 31:842–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kamya MR, Kapisi J, Bigira V, et al. Efficacy and safety of three regimens for the prevention of malaria in young HIV-exposed Ugandan children: a randomized controlled trial. AIDS 2014; 28:2701–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Mbeye NM, ter Kuile FO, Davies MA, et al. Cotrimoxazole prophylactic treatment prevents malaria in children in sub-Saharan Africa: systematic review and meta-analysis. Trop Med Int Health 2014; 19:1057–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lin JT, Saunders DL, Meshnick SR. The role of submicroscopic parasitemia in malaria transmission: what is the evidence? Trends Parasitol 2014; 30:183–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Beshir KB, Sutherland CJ, Sawa P, et al. Residual Plasmodium falciparum parasitemia in Kenyan children after artemisinin-combination therapy is associated with increased transmission to mosquitoes and parasite recurrence. J Infect Dis 2013; 208:2017–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chasela CS, Hudgens MG, Jamieson DJ, et al. Maternal or infant antiretroviral drugs to reduce HIV-1 transmission. N Engl J Med 2010; 362:2271–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.van der Horst C, Chasela C, Ahmed Y, et al. Modifications of a large HIV prevention clinical trial to fit changing realities: a case study of the Breastfeeding, Antiretroviral, and Nutrition (BAN) protocol in Lilongwe, Malawi. Contemp Clin Trials 2009; 30:24–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Taylor SM, Juliano JJ, Trottman PA, et al. High-throughput pooling and real-time PCR-based strategy for malaria detection. J Clin Microbiol 2010; 48:512–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bejon P, Williams TN, Nyundo C, et al. A micro-epidemiological analysis of febrile malaria in coastal Kenya showing hotspots within hotspots. Elife 2014; 3:e02130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sturrock HJ, Hsiang MS, Cohen JM, et al. Targeting asymptomatic malaria infections: active surveillance in control and elimination. PLoS Med 2013; 10:e1001467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Greenland S, Pearl J, Robins JM. Causal diagrams for epidemiologic research. Epidemiology 1999; 10:37–48. [PubMed] [Google Scholar]
- 16.Pickard AL, Wongsrichanalai C, Purfield A, et al. Resistance to antimalarials in Southeast Asia and genetic polymorphisms in pfmdr1. Antimicrob Agents Chemother 2003; 47:2418–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.World Health Organization. Recommended genotyping procedures (RGPs) to identify parasite populations. Available at: http://www.who.int/malaria/publications/atoz/rgptext_sti.pdf. Accessed 28 April 2015.
- 18.Taylor SM, Parobek CM, Aragam N, et al. Pooled deep sequencing of Plasmodium falciparum isolates: an efficient and scalable tool to quantify prevailing malaria drug-resistance genotypes. J Infect Dis 2013; 208:1998–2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Taylor SM, Parobek CM, DeConti DK, et al. Absence of putative Plasmodium falciparum artemisinin resistance mutations in sub-Saharan Africa: a molecular epidemiologic study. J Infect Dis 2015; 211:680–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.World Health Organization. World malaria report 2014. Geneva, Switzerland: WHO, 2014. [Google Scholar]
- 21.Kourtis AP, Wiener J, Kayira D, et al. Health outcomes of HIV-exposed uninfected African infants. AIDS 2013; 27:749–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Nsobya SL, Parikh S, Kironde F, et al. Molecular evaluation of the natural history of asymptomatic parasitemia in Ugandan children. J Infect Dis 2004; 189:2220–6. [DOI] [PubMed] [Google Scholar]
- 23.Magesa SM, Mdira KY, Babiker HA, et al. Diversity of Plasmodium falciparum clones infecting children living in a holoendemic area in north-eastern Tanzania. Acta Trop 2002; 84:83–92. [DOI] [PubMed] [Google Scholar]
- 24.Gudo ES, Prista A, Jani IV. Impact of asymptomatic Plasmodium falciparum parasitemia on the imunohematological indices among school children and adolescents in a rural area highly endemic for malaria in southern Mozambique. BMC Infect Dis 2013; 13:244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Matangila JR, Lufuluabo J, Ibalanky AL, Inocencio da Luz RA, Lutumba P, Van Geertruyden JP. Asymptomatic Plasmodium falciparum infection is associated with anaemia in pregnancy and can be more cost-effectively detected by rapid diagnostic test than by microscopy in Kinshasa, Democratic Republic of the Congo. Malar J 2014; 13:132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Nwali MI, Umeora OU, Ozumba BC, Onoh RC, Agwu UM, Agboeze J. Outcomes of asymptomatic malaria parasitaemia in neonates in a tertiary hospital, southeast Nigeria. Niger Med J 2014; 55:250–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Khan WA, Galagan SR, Prue CS, et al. Asymptomatic Plasmodium falciparum malaria in pregnant women in the Chittagong Hill Districts of Bangladesh. PLoS One 2014; 9:e98442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lindblade KA, Steinhardt L, Samuels A, Kachur SP, Slutsker L. The silent threat: asymptomatic parasitemia and malaria transmission. Expert Rev Anti Infect Ther 2013; 11:623–39. [DOI] [PubMed] [Google Scholar]
- 29.White NJ. The role of anti-malarial drugs in eliminating malaria. Malar J 2008; 7(suppl 1):S8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Alves FP, Gil LH, Marrelli MT, Ribolla PE, Camargo EP, Da Silva LH. Asymptomatic carriers of Plasmodium spp. as infection source for malaria vector mosquitoes in the Brazilian Amazon. J Med Entomol 2005; 42:777–9. [DOI] [PubMed] [Google Scholar]