Abstract
Premise of the study:
Microsatellite markers were developed for the critically endangered carnivorous species Philcoxia minensis (Plantaginaceae) for further population genetic studies aiming at its conservation.
Methods and Results:
We identified 29 clones containing 40 microsatellites from a genomic enriched library. A total of 27 primer pairs were developed and evaluated in 30 individuals of a natural P. minensis population. Seventeen markers successfully presented amplification products within the expected size range, of which 12 were polymorphic. The expected and observed heterozygosities ranged from 0.03 to 0.65 and from 0.00 to 0.77, respectively. Positive transferability with the related species P. bahiensis was observed for the same 17 markers.
Conclusions:
The 12 polymorphic microsatellite markers are suitable for studies in genetic diversity and structure, mating system, and gene flow in P. minensis and also may be useful for similar issues regarding the related species P. bahiensis.
Keywords: conservation genetics, Espinhaço Range, Gratioleae, Philcoxia minensis, Plantaginaceae, simple sequence repeat (SSR)
Philcoxia P. Taylor & V. C. Souza is a carnivorous plant genus, endemic to the Brazilian cerrado and caatinga biomes (Pereira et al., 2012; Carvalho and Queiroz, 2014). The genus is characterized by terrestrial herbs with underground stems and leaves under or on the soil surface. It comprises five species: P. bahiensis V. C. Souza & Harley and P. tuberosa M. L. S. Carvalho & L. P. Queiroz, from Bahia; P. goiasensis P. Taylor, from Goiás; P. minensis V. C. Souza & Giul., from Minas Gerais (Taylor et al., 2000); and a newly described species (Scatigna et al., unpublished), also from Minas Gerais. Only a small population of P. minensis is known from a sand patch at the Serra do Cabral State Park, in Minas Gerais State (Souza and Giulietti, 2009). Due to its rarity and the vulnerability of the formation where it occurs, this species could be treated as critically endangered. In addition, very little is known about the general biology of P. minensis. One important step for studies supporting its conservation is the characterization of its genetic diversity and structure, gene flow, breeding ratio of populations, and mating system. The use of microsatellite markers for population genetics and biodiversity conservation has increased in the past decade (Ouborg et al., 2010) and is now a well-established technique. Therefore, the purpose of this study was to develop microsatellite markers or simple sequence repeats (SSR), aiming to elucidate questions concerning aspects of P. minensis biology, such as its genetic structure, variability, and mating system.
METHODS AND RESULTS
A silica gel–dried inflorescence of a single individual of P. minensis was used in the initial DNA extraction, using the NucleoSpin Plant II Kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s protocol. A voucher specimen of that individual (Scatigna, A. V. 42) was deposited at the UEC herbarium at the Universidade Estadual de Campinas, Brazil. The inflorescence of Philcoxia individuals is used for DNA extraction to (1) avoid killing the plant, as the leaves are situated on or below the soil surface; and (2) prevent contamination of the template DNA by the abundant nematodes stuck on the leaf surfaces.
A microsatellite-enriched genomic library was constructed following the protocol proposed by Billotte et al. (1999), with slight modifications. Genomic DNA was digested with AfaI enzyme (Invitrogen, Carlsbad, California, USA) for 3 h incubation at 37°C and ligated to the double-stranded adapters 5′-CTCTTGCTTACGCGTGGACTA-3′ and 5′-TAGTCCACGCGTAAGCAAGAGCACA-3′ for 2 h incubation at 20°C. Enrichment was performed using a hybridization-based capture with (CT)8 and (GT)8 biotin-linked probes and streptavidin-coated magnetic beads (MagneSphere Magnetic Separation Products; Promega Corporation, Madison, Wisconsin, USA). The enriched fragments were amplified by PCR, and the amplification products were cloned into pGEM-T Easy Vector (Promega Corporation). Competent XL1-Blue Escherichia coli (Stratagene, Agilent Technologies, Santa Clara, California, USA) were transformed with the recombinant plasmids and cultivated on agar medium containing ampicillin and 100 μg/mL of X-galactosidase. Eighty recombinant colonies were selected using blue/white screening and sequenced in an automated ABI 3500xL Genetic Analyzer (Perkin Elmer–Applied Biosystems, Foster City, California, USA) using T7 and SP6 primers and the BigDye Terminator version 3.1 Cycle Sequencing Kit (Perkin Elmer–Applied Biosystems). Sequences containing microsatellites were identified using the SSR Identification Tool (SSRIT; Temnykh et al., 2001). As a criterion for the SSR selection, sequences that showed at least five dinucleotide repeats; four trinucleotide repeats; and three tetra-, penta-, and hexanucleotide repeats were selected. A total of 40 SSRs were identified in 29 clones, representing a 36.25% rate of enrichment success. The most abundant motifs in the sequences of microsatellites were dinucleotide (70%), followed by tetranucleotide (17.5%), trinucleotide and pentanucleotide (5% each), and hexanucleotide (2.5%). Most of the SSRs found were classified as perfect (67.5%). Twenty-seven primer pairs, complementary to the genomic sequences flanking the microsatellite region, were designed using Primer3Plus (Untergasser et al., 2007). PCR was conducted with a final volume of 15 μL containing 2.5 ng of template DNA, 1× PCR buffer (20 mM Tris HCl [pH 8.4] and 50 mM KCl), 1.5 mM MgCl2, 0.2 mM of each dNTP, 10 mg/mL bovine serum albumin (BSA), 0.5 mM of each primer, and 1 unit of Taq DNA polymerase (Invitrogen). The PCR program for all loci amplification consisted of an initial denaturation at 94°C for 2 min 30 s, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at specific temperature for 1 min (Table 1), extension at 72°C for 1 min, and a final extension at 72°C for 8 min. Amplification products were checked through 3% agarose gels prior to vertical electrophoresis using 6% denaturing polyacrylamide gels for genotyping through silver-staining (Creste et al., 2001). The product sizes were determined using a 10-bp DNA ladder (Invitrogen).
Table 1.
Characteristics of 17 microsatellite loci that successfully amplified in Philcoxia minensis samples.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size (bp) | Ta (°C) | GenBank accession no. |
| Pm01* | F: CCAACAGAAAAGCCCTAACG | (GA)17 | 234 | 60 | KR019066 |
| R: GCCCACAGTCCCTTGAGTAT | |||||
| Pm02 | F: AAGACGTTTGCCAGCCTTA | (TAG)4(TGTA)3 | 173 | 60 | KR019067 |
| R: TGCATTTATCCCCACAGACA | |||||
| Pm03 | F: CCCAGCTTCACCTCACTCTC | (TCC)5 | 161 | 60 | KR019068 |
| R: CGTTAGGGCTTTTCTGTTGG | |||||
| Pm04 | F: AGTTGCCTTCCATCATCGTT | (GT)5(CT)8 | 156 | 60 | KR019069 |
| R: TGGCTGAGAATCACTGACAAA | |||||
| Pm08* | F: TGAAAACCCCAATCCCATAA | (GT)8 | 232 | 60 | KR019070 |
| R: CACAGGCGTATCAAGGAAGA | |||||
| Pm09 | F: TTGCTTTCCTCTCGGTGTTT | (CT)19 | 214 | 60 | KR019071 |
| R: CATTACTGCACCAAGCCTGA | |||||
| Pm10 | F: TGGCCCTTCTCAGATCTTTC | (AC)9 | 239 | 60 | KR019072 |
| R: ACATAGACCATTCGGGGAGA | |||||
| Pm11 | F: CATTTTTCGTTGTTCCCACA | (CA)11(TC)7 | 183 | 55 | KR019073 |
| R: TACATGCGTTCCAAGCCTAA | |||||
| Pm13 | F: GCGTTCCTTTTTCGATCTGT | (CA)10 | 213 | 60 | KR019074 |
| R: AGCCATGGATATGTTCTCACC | |||||
| Pm15 | F: TCCTAATTGCTTCACGAGCAT | (AC)5(GA)5 | 216 | 60 | KR019075 |
| R: AGCTTTGTCAGGCAGCTCA | |||||
| Pm16 | F: CCAAAGCTACACACCCAACA | (AC)5(ACAAA)3 | 244 | 60 | KR019076 |
| R: TCATATGCTGGGCATACCTG | |||||
| Pm18* | F: AGTCACTGCTTTCAGCCTGTC | (AG)26 | 161 | 60 | KR019077 |
| R: ATGAGATTGCTGAGCCTCGT | |||||
| Pm20 | F: ACTCATAGAGGACACACACAC | (AG)10(AC)10 | 199 | 60 | KR019078 |
| R: TTATTTAGGGGACGGAGAG | |||||
| Pm21 | F: ATCGCTTCCTCCTCCTCTTC | (CA)10 | 181 | 60 | KR019079 |
| R: AACAAAGCTCGCTCGTTCTC | |||||
| Pm22* | F: TGATCGACTTCATGGACACC | (TC)10(CA)9 | 181 | 60 | KR019080 |
| R: CGGGATTCTCTTGCTTAACG | |||||
| Pm26* | F: CTGGCGCTATCCTTCTCAAT | (AC)10 | 246 | 60 | KR019081 |
| R: TGGAGGATGTCTGTTTGTCG | |||||
| Pm27 | F: TTTTTCCAAGAGTCTCTGCAC | (CAAGC)4 | 225 | 60 | KR019082 |
| R: GAGTGAAAGGGTGGTTTGTGA |
Note: Ta = specific annealing temperature.
*Monomorphic loci.
For polymorphism evaluation in P. minensis, we sampled a total of 30 specimens from the only known population, in Serra do Cabral (voucher: Scatigna, A. V. 43 [UEC]), Municipality of Joaquim Felicio, Minas Gerais State, Brazil (17°42′23″S, 44°11′39″W). Furthermore, four specimens of P. bahiensis from a population in Chapada Diamantina (voucher: Scatigna, A. V. 107 [UEC]), near the municipality of Piatã, Bahia State, Brazil (13°02′S, 41°57′W), were used to evaluate the transferability of the markers. Individuals were collected at a distance of at least 1 m to avoid sampling of clones. We ran the identity analysis test in CERVUS v. 3.0.7 (Kalinowski et al., 2007), allowing one mismatch to check if there were clones sampled. Statistical analyses were performed using Microsatellite Toolkit v.3.1.1 (Park, 2001) to calculate the number of alleles per locus (A), expected heterozygosity (He), observed heterozygosity (Ho), and polymorphism information content (PIC). FreeNA (Chapuis and Estoup, 2007) was used to identify the possible occurrence of null alleles (FNULL). Linkage disequilibrium (LD) testing was performed between all loci pairs using a G-test. For Hardy–Weinberg equilibrium (HWE), we followed the probability test approach (Guo and Thompson, 1992) using GENEPOP v. 4.2 (Raymond and Rousset, 1995). The unbiased estimator of Wright’s inbreeding coefficient (FIS) was calculated according to Weir and Cockerham (1984) using GENEPOP v. 4.2. Of 27 markers tested, 17 were successfully amplified, of which 12 loci were polymorphic, five were monomorphic, and 10 did not amplify after PCR optimization (Table 1). The same 17 primer pairs successfully amplified with P. bahiensis samples.
No matching genotypes (clones) were found within the samples. A ranged from two to five, with an average of 3.5; Ho and He ranged from 0.00 to 0.77 and from 0.03 to 0.65, respectively (Table 2). The PIC values ranged from 0.032 to 0.577, showing medium levels of polymorphism (Table 2). Five loci showed significant deviation from HWE (Table 2). No significant LD between loci was detected when applying Bonferroni correction (P value for 5% = 0.000758), but null alleles were observed for two loci (null allele frequency estimate ≥0.2; Table 2). The significant and negative FIS values for Pm21 are due to an excess of observed heterozygote genotypes. It is likely that the significant and positive FIS estimates for the loci Pm10, Pm13, Pm15, and Pm16 (Table 2) can be explained by its proportions of null allele frequencies. These results were consistent with our expectations, because the population is apparently small and isolated, and the individuals propagate vegetatively.
Table 2.
Results of initial polymorphic microsatellite marker screening in the population of Philcoxia minensis (N = 30).
| Locus | A | Allele size range (bp) | Ho | He | PIC | FISa | FNULL |
| Pm02 | 3 | 163–181 | 0.3 | 0.264 | 0.233 | −0.14 | −0.08 |
| Pm03 | 2 | 163–165 | 0.033 | 0.033 | 0.032 | 0 | 0 |
| Pm04 | 4 | 146–166 | 0.5 | 0.417 | 0.379 | −0.2 | −0.13 |
| Pm09 | 4 | 192–220 | 0.64 | 0.634 | 0.552 | −0.01 | −0.02 |
| Pm10 | 4 | 239–269 | 0.067 | 0.098 | 0.095 | 0.33* | 0.30b |
| Pm11 | 3 | 177–185 | 0.448 | 0.402 | 0.361 | −0.12 | −0.06 |
| Pm13 | 4 | 109–215 | 0.367 | 0.434 | 0.389 | 0.16** | 0.15 |
| Pm15 | 4 | 214–220 | 0.364 | 0.518 | 0.418 | 0.30** | 0.17 |
| Pm16 | 2 | 242–244 | 0 | 0.089 | 0.083 | 1.00* | 0.71b |
| Pm20 | 4 | 189–201 | 0.552 | 0.591 | 0.527 | 0.07 | 0.01 |
| Pm21 | 5 | 155–185 | 0.773 | 0.655 | 0.577 | −0.18* | −0.12 |
| Pm27 | 3 | 221–227 | 0.455 | 0.502 | 0.391 | 0.1 | 0.05 |
Note: A = number of alleles sampled; FIS = inbreeding coefficient index; FNULL = occurrence of null alleles; He = expected heterozygosity; Ho = observed heterozygosity; PIC = polymorphism information content.
Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05 and **P < 0.01.
Markers with the probability of occurrence of null alleles.
CONCLUSIONS
The SSR markers herein described are the first developed for P. minensis. These microsatellites are important tools for genetic studies in P. minensis and may be used to evaluate the genetic variability of the related species P. bahiensis, aiming to elucidate questions regarding genetic diversity, spatial genetic structure, mating system, and gene flow. Data from such studies may contribute to conservation and management plans for Philcoxia species.
LITERATURE CITED
- Billotte N., Lagoda P. J. L., Risterucci A. M., Baurens F. C. 1999. Microsatellite-enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277–288. [Google Scholar]
- Carvalho M. L. S., Queiroz L. P. 2014. Philcoxia tuberosa (Plantaginaceae), a new species from Bahia, Brazil. Neodiversity 7: 14–20. [Google Scholar]
- Chapuis M. P., Estoup A. 2007. Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24: 621–631. [DOI] [PubMed] [Google Scholar]
- Creste S., Neto A. T., Figueira A. 2001. Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Molecular Biology Reporter 19: 299–306. [Google Scholar]
- Guo S. W., Thompson E. A. 1992. Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48: 361–372. [PubMed] [Google Scholar]
- Kalinowski S. T., Taper M. L., Marshall T. C. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16: 1099–1106. [DOI] [PubMed] [Google Scholar]
- Ouborg N. J., Pertoldi C., Loeschcke V., Bijlsma R., Hedrick P. W. 2010. Conservation genetics in transition to conservation genomics. Trends in Genetics 26: 177–187. [DOI] [PubMed] [Google Scholar]
- Park S. D. E.2001. Trypanotolerance in West African cattle and the population genetic effects of selection. PhD. Thesis, University of Dublin, Dublin, Ireland.
- Pereira C. G., Almenara D. P., Winter C. E., Fritsch P. W., Lambers H., Oliveira R. S. 2012. Underground leaves of Philcoxia trap and digest nematodes. Proceedings of the National Academy of Sciences, USA 109: 1154–1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raymond M., Rousset F. 1995. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. [Google Scholar]
- Souza V. C., Giulietti A. M. 2009. Levantamento das espécies de Scrophulariaceae sensu lato nativas do Brasil. Pesquisa Botânica 60: 7–288. [Google Scholar]
- Taylor P., Souza V. C., Giulietti A. M., Harley R. M. 2000. Philcoxia: A new genus of Scrophulariaceae with three new species from eastern Brazil. Kew Bulletin 55: 155–163. [Google Scholar]
- Temnykh S., Clerck G., Lukashova A., Lipovich L., Cartinhour S., McCouch S. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency length variation transposon associations and genetic marker potential. Genome Research 11: 1441–1452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Untergasser A., Nuveen H., Ao X. R., Bisseling T., Geurts R., Leunissen J. A. M. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35: W71–W74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weir B. S., Cockerham C. C. 1984. Estimating F-statistics for the analysis of population structure. Evolution 38: 1358–1370. [DOI] [PubMed] [Google Scholar]
