Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2015 Aug 17;3(8):apps.1500048. doi: 10.3732/apps.1500048

Microsatellite markers for the Pilosella alpicola group (Hieraciinae, Asteraceae) and their cross-amplification in other Hieraciinae genera1

Petr Vít 2,3, Barbora Šingliarová 4, Judita Zozomová-Lihová 4, Karol Marhold 4,5, Karol Krak 2,3,6
PMCID: PMC4542946  PMID: 26312199

Abstract

Premise of the study:

Microsatellite markers were developed for the Pilosella alpicola group (Asteraceae), comprising four closely related species distributed in subalpine areas of Europe. These species are believed to have diverged recently, but display contrasting cytogeographic patterns and variation in breeding systems, representing a promising model system for studying plant speciation, adaptation, and recent polyploidization.

Methods and Results:

We developed 17 microsatellite markers for the P. alpicola group using 454 sequencing. Sixteen markers were polymorphic, with the number of alleles per locus ranging from seven to 16 and observed and expected heterozygosity ranging from 0.45 to 0.84 and 0.72 to 0.92, respectively. Ten and five loci amplified in the related species, P. echioides and P. officinarum, respectively, but only two in Andryala and one in Hieracium s. str.

Conclusions:

The developed microsatellite markers have high potential to become useful tools to study microevolutionary processes in the P. alpicola group and related Pilosella species.

Keywords: hybridization, Pilosella alpicola, polyploidy, population genetics, simple sequence repeat (SSR) markers


The Pilosella alpicola group (Asteraceae) comprises four vicariant species of perennial herbs distributed disjunctly in subalpine areas of Europe (the Alps, Carpathians, and Balkan mountains). In this study, we followed the generic circumscriptions outlined by Bräutigam and Greuter (2007) in our treatment of the P. alpicola group. Our recent studies (Šingliarová et al., 2011a, b) showed that although the taxa of this group are very closely related and diverged relatively recently, they are morphologically well defined and display contrasting cytogeographic patterns and variation in breeding systems. Two species (P. ullepitschii (Błocki) Szeląg from the Carpathians and P. serbica (F. W. Schultz & Sch. Bip.) Szeląg from Serbia) are exclusively diploid and outcrossing. The Balkan taxon P. rhodopea (Griseb.) Szeląg represents a unique diploid-polyploid complex with up to five cytotypes (diploids to hexaploids) occurring mostly in mixed-ploidy populations. All P. rhodopea cytotypes are outcrossing, although polyploids exhibit severely reduced fertility (Šingliarová et al., 2011b). The alpine P. alpicola F. W. Schultz & Sch. Bip. (s. str.) has two allopatric cytotypes (tetraploids and pentaploids) with presumably polytopic allopolyploid origins and agamospermic mode of reproduction (Šingliarová et al., 2011a, b). All species of the P. alpicola group are rather rare, and their populations are often small and endangered by human activities. Recently, the conservation status of all taxa of the group was evaluated and their inclusion in relevant national Red Lists was proposed (Šingliarová et al., 2013). Interesting distributional patterns and a variety of evolutionary mechanisms playing a role in the differentiation of the P. alpicola group suggest it as a promising model system for studying plant speciation, adaptation, and recent polyploidization.

Microsatellite markers have already been developed for the related P. officinarum F. W. Schultz & Sch. Bip. (Zini and Komjanc, 2007) and the closely related genus Hieracium L. (s. str.) (Jönsson et al., 2010). The cross-amplification of the P. officinarum markers in other Pilosella Hill species and Hieracium s. str. gave unsatisfactory results (P. Trávníček, personal communication; Jönsson et al., 2010). Low cross-amplification success reported so far for the developed markers in Hieracium s. str. and Pilosella led us to deduce their poor transferability also to the P. alpicola group; therefore, a new set of markers is developed here. In addition, other Pilosella, Hieracium s. str., and Andryala L. taxa were used here to evaluate the potential cross-amplification of the developed markers in other phylogenetic lineages within the subtribe Hieraciinae (Fehrer et al., 2007; Krak and Mráz, 2008).

METHODS AND RESULTS

Total genomic DNA was extracted from fresh or silica gel–dried leaf material using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. DNA from one diploid individual of P. rhodopea was used for 454 sequencing. Genomic library preparation and 1/4 run on the Roche GS FLX platform was performed at GATC Biotech (Konstanz, Germany). MSATCOMMANDER version 0.8.2 (Faircloth, 2008) was used to identify reads containing di-, tri-, tetra-, penta-, and hexanucleotide repeats and to design primers. Primers were successfully designed to 179 microsatellite-containing reads.

Sixty primer pairs were selected and tested for amplification in three diploid individuals, each representing a different species of the studied group. Each reaction contained 1× PCR buffer with KCl (Fermentas, St. Leon, Germany), 2.5 mM MgCl2, 0.2 mM of each dNTP, 0.2 μM of both primers, 0.5 units of Taq DNA polymerase (Fermentas), and 20 ng of DNA. The cycling conditions were: 3 min at 95°C; followed by 35 cycles of 95°C for 30 s, locus-specific annealing temperature (see Table 1) for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. PCR products were checked on 2.5% agarose gels. Twenty-three primer pairs that amplified in the three tested species of the P. alpicola group were further applied to the complete set of 31 diploid individuals, originating from five distinct and geographically well-separated natural populations (Appendix 1). In this step, the amplification protocol was modified as described in Schuelke (2000) to facilitate fluorescent labeling of the PCR products by 6-FAM (Applied Biosystems, Foster City, California, USA). One microliter of each PCR product was mixed with 0.1 μL of GeneScan 500 LIZ internal size standard (Applied Biosystems) and 12 μL of Hi-Di formamide (Applied Biosystems) and electrophoresed using ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). Allele calling was performed using GeneMarker version 2.4.0 (SoftGenetics, State College, Pennsylvania, USA). Six primer pairs amplified three or four alleles in the majority of samples, indicating possible duplications of these loci; these were therefore discarded. One locus, Palpi21, was invariable. Two other loci, Palpi25 and Palpi35, showed multiple peaks in four samples belonging to populations COZ, DOD, and MEN (see Appendix 1 for population localities). For these particular samples, the allele lengths were scored as missing data, and the markers were retained for genetic diversity estimates. For the summary information on the 16 polymorphic loci see Table 1.

Table 1.

Characteristics of 17 newly developed microsatellite markers for the Pilosella alpicola group. Locus Palpi21 is monomorphic; the 16 other loci are polymorphic.

Locus Primer sequences (5′–3′) Repeat motif Allele size range (bp) Ta (°C) Cross-species amplificationa GenBank accession no.
Palpi1 F: TGCATTCCTTCGGTCCCAC (AT)13 232–247 55 KJ415260
R: TGAAGAACATCGACATAATGCAC
Palpi5 F: TGCATTCCTTCGGTCCCAC (AC)14 216–230 55 Po, Pe KJ415261
R: TGAAGAACATCGACATAATGCAC
Palpi8 F: AGGCAATATACTATGTGTTGACCTG (AC)14 458–474 57 Po, Pe KJ415262
R: TCAGTGGCCCTCTATTTATACCC
Palpi18 F: GCACGCATCTTACCAGACG (ATT)23 182–257 53 KJ415263
R: TCGGTTAATCCTCTGGCGG
Palpi19 F: TGTAATTCCGCTGCAAATCG (AAT)19 253–292 55 KJ415264
R: TCACGAGTGGTTTCCTTACTC
Palpi20 F: TGTTTGATGGCGATTCACGAG (AAT)20 331–383 53 KJ415265
R: GCCCAGTTCCTTTGAACCC
Palpi21b F: GCCACAGCTTACGAGCATC (CT)12 220 55 NA KR862872
R: TTGCGGTGAAGACGGTG
Palpi25 F: TCCCGCTGGTTCGAAAGAC (GT)12 142–176 55 Po, Pe KJ415266
R: GCCCTCAAGGCCTCAACC
Palpi26 F: CCCATCTGGTTAAAGCGCC (AC)12 192–230 53 KJ415267
R: TCGAAGTTGTTACGAGTTGCAG
Palpi29 F: CTGCCATTGTTGGTGGCTC (AT)12 377–396 55 Po, Pe, Hu, Hs, Al, Ai KJ415268
R: AGGGATAGCACTTGCTGGG
Palpi32 F: CTGTGAGGTACATACGTGGC (ATT)13 377–413 55 Pe KJ415269
R: TTTGTGGTTTGAGTTCACCG
Palpi33 F: TCACTCATGAAATCTGTAACATCCG (AAT)11 224–273 56 Pe KJ415270
R: CCATAAAGGCAACTTTAGTCCC
Palpi34 F: TGGTTAACGGTGGGCAGTC (AAC)12 406–436 52 Pe KJ415271
R: CTAGCAGGTGGCCTTGACC
Palpi35 F: AAGTCGACACCTTTAGTCCC (ATT)17 243–274 54 KJ415272
R: GCTGCTAATCCGTGGTCAG
Palpi37 F: TCCTCTAAGTGGGTTCTTTGC (CTT)11 451–505 52 Po, Pe KJ415273
R: ATGCCTCACGAGACGTTCC
Palpi45 F: GGCAGAAGGCTAAGAACTGC (AC)11 277–319 55 Pe KJ415274
R: GGAAGAATTTGATGGGTTGAC
Palpi49 F: GGGCTGCCTATTCCCGTAG (AG)10 240–265 55 Pe, Ai KJ415275

Note: Ta = annealing temperature.

a

Loci that were successfully cross-amplified in other Hieraciinae species: Pilosella officinarum (Po), P. echioides (Pe), Hieracium umbellatum (Hu), H. stelligerum (Hs), Andryala laevitomentosa (Al), and A. integrifolia (Ai); NA = information not available.

b

Monomorphic locus.

The genetic diversity of these 16 loci was then estimated. Number of alleles per locus, expected and observed heterozygosity, and polymorphic information content were calculated based on allele frequencies for each population as well as for the complete data set using CERVUS version 3.0.3 (Field Genetics, London, United Kingdom). All markers showed a relatively high degree of polymorphism (Table 2). The number of detected alleles ranged from seven for Palpi1 to 16 for Palpi18, Palpi34, and Palpi37 (average 11.4). The observed heterozygosity ranged from 0.45 at Palpi32 to 0.84 at Palpi49 (average 0.64). The values of expected heterozygosity varied from 0.72 at Palpi1 to 0.92 at Palpi34 (average 0.85). The values of the polymorphic information content varied from 0.67 at Palpi1 to 0.89 at Palpi34 (average 0.81). The level of variability within the tested populations was comparable for the populations of P. rhodopea, P. serbica, and one population of P. ullepitschii (population MEN). The other population of P. ullepitschii (SMARE) showed lower values for all estimated parameters (see Table 2 for details).

Table 2.

Genetic diversity parameters estimated for 16 polymorphic microsatellite loci for each analyzed population and the complete data set of the Pilosella alpicola group.

P. rhodopea (population COZ; n = 6) P. rhodopea (population DOD; n = 5) P. ullepitschii (population MEN; n = 7) P. ullepitschii (population SMARE; n = 7) P. serbica (population KOP; n = 6) Overall (n = 31)
Locus A Ho He PIC A Ho He PIC A Ho He PIC A Ho He PIC A Ho He PIC A Ho He PIC
Palpi1 2 1 0.545 0.375 4 0.8 0.78 0.65 3 0.86 0.58 0.45 2 1 0.54 0.38 3 0.33 0.59 0.46 7 0.81 0.72 0.67
Palpi5 4 0.67 0.697 0.569 6 1 0.89 0.77 3 0.71 0.6 0.47 2 0 0.26 0.22 4 0.6 0.53 0.45 9 0.57 0.77 0.73
Palpi8 4 0.67 0.682 0.559 4 0.4 0.71 0.58 6 0.86 0.87 0.78 3 0.57 0.6 0.47 6 1 0.8 0.7 10 0.71 0.85 0.82
Palpi18 4 0.67 0.803 0.687 6 0.75 0.93 0.77 6 0.27 0.84 0.74 2 0 0.3 0.28 8 0.83 0.89 0.8 16 0.48 0.9 0.87
Palpi19 7 0.83 0.924 0.828 3 0 0.71 0.56 9 1 0.9 0.82 3 0.71 0.54 0.43 5 0.67 0.8 0.69 15 0.7 0.9 0.88
Palpi20 3 0.33 0.439 0.363 4 1 0.78 0.65 6 0.86 0.86 0.77 3 0.14 0.47 0.39 3 0.6 0.71 0.56 11 0.57 0.83 0.79
Palpi25 3 0.6 0.711 0.563 2 0.33 0.33 0.24 3 0.5 0.44 0.36 3 0.57 0.56 0.46 4 0.67 0.65 0.55 9 0.56 0.85 0.81
Palpi26 7 1 0.894 0.796 5 0.8 0.84 0.72 3 0.71 0.6 0.47 2 0 0.3 0.24 7 0.6 0.91 0.8 8 0.62 0.81 0.77
Palpi29 4 0.83 0.712 0.599 4 0.6 0.73 0.61 6 0.86 0.79 0.7 4 0.57 0.69 0.59 4 1 0.71 0.6 9 0.77 0.83 0.79
Palpi32 4 0.33 0.636 0.53 3 0.2 0.51 0.41 6 0.86 0.81 0.72 2 0.14 0.14 0.12 5 0.67 0.79 0.68 11 0.45 0.89 0.86
Palpi33 6 1 0.848 0.746 3 1 0.71 0.56 5 0.71 0.74 0.65 1 0 0 0 2 0.33 0.3 0.24 12 0.58 0.87 0.84
Palpi34 6 0.67 0.894 0.794 5 0.8 0.76 0.64 6 0.86 0.82 0.73 4 0.57 0.71 0.62 4 0.8 0.79 0.65 16 0.73 0.92 0.89
Palpi35 5 0.6 0.822 0.701 4 0.67 0.87 0.67 5 0.5 0.74 0.64 4 0.27 0.71 0.6 3 0.67 0.62 0.51 10 0.52 0.9 0.87
Palpi37 5 0.83 0.758 0.644 6 1 0.89 0.77 6 0.43 0.88 0.79 4 0.43 0.69 0.59 6 0.67 0.76 0.67 16 0.65 0.88 0.86
Palpi45 4 0.67 0.561 0.476 2 1 0.56 0.38 4 0.83 0.77 0.65 3 0.14 0.28 0.24 4 0.83 0.77 0.66 13 0.67 0.81 0.77
Palpi49 9 0.83 0.939 0.847 4 0.8 0.8 0.67 7 0.57 0.89 0.8 2 1 0.54 0.38 4 1 0.74 0.62 10 0.84 0.84 0.8
Average 4.18 0.72 0.74 0.63 4.06 0.7 0.74 0.6 5.3 0.71 0.76 0.67 2.8 0.38 0.46 0.38 4.5 0.7 0.71 0.6 11.4 0.64 0.85 0.81

Note: A = number of alleles per locus; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals; PIC = polymorphic information content.

To evaluate the potential utility of the newly developed markers in other phylogenetic lineages of the Asteraceae subtribe Hieraciinae (Fehrer et al., 2007; Krak and Mráz, 2008), cross-amplification experiments were performed in one individual of P. echioides F. W. Schultz & Sch. Bip., P. officinarum, Hieracium umbellatum L., H. stelligerum Froel., Andryala laevitomentosa (Nyár. ex Sennikov) Greuter, and A. integrifolia L. The results of cross-amplification tests are summarized in Table 1. Higher cross-amplification success was reached within the genus Pilosella, where 10 markers could be cross-amplified in P. echioides and five in P. officinarum. Only one marker (Palpi29) was cross-amplified in all tested taxa. No other marker gave a positive result in the three Hieracium s. str. species and A. laevitomentosa. In A. integrifolia, cross-amplification of Palpi49 was positive as well.

CONCLUSIONS

In this study, we have developed 17 novel microsatellite markers for the P. alpicola group. Although only a relatively small sample set was used to evaluate their variability, 16 markers showed high levels of polymorphism. The transferability of these markers to two additional Pilosella species and to the closely related genera Andryala and Hieracium s. str. is restricted. Five markers were cross-amplified in P. officinarum and 10 in P. echioides, suggesting high species specificity of these markers. The cross-amplification in the other Hieraciinae genera was even less successful. Only one marker amplified in all four species and an additional one in A. integrifolia.

Appendix 1.

Locality and voucher information of the Pilosella alpicola group and representatives of other lineages within the subtribe Hieraciinae used for the current study.

Species Population code Voucher specimen accession no. Collection localitya Geographic coordinates n
Pilosella rhodopea (Griseb.) Szeląg COZ BS_COZ_6, 10, 12, 13, 19, 20b RO; Cozia Mtns., Mt. Cozia, 1592 m a.s.l. 45°19′04″N, 24°20′17″E 6
DOD BS_DOD_1, 6–8, 10b BG; Rila Mtns., Mt. Dodov vrah, 2540 m a.s.l. 42°09′59″N, 23°20′23″E 5
P. serbica (F. W. Schultz & Sch. Bip.) Szeląg KOP BS_KOP_1, 2, 4–7b RS; Kopaonik Mtns., Mt. Suvo Rudište, 1917 m a.s.l. 43°16′28″N, 20°48′55″E 6
P. ullepitschii (Błocki) Szeląg MEN BS_MEN_12, 14, 18, 19, 27, 29, 30b SK; Vysoké Tatry Mtns., Mengusovská dolina valley, 1800–1875 m a.s.l. 49°09′57″N, 20°03′40″E 7
SMARE BS_SMARE_11–15, 17, 18b RO; Nemira Mtns., Mt. Sandru Mare, 1590–1640 m a.s.l. 46°11′57″N, 26°20′21″E 7
P. officinarum F. W. Schultz & Sch. Bip. 1484 PRA_PV_1484c CZ; Prague, Bohnice–Zámky, 205 m a.s.l. 50°08′26″N, 14°23′56″E 1d
P. echioides F. W. Schultz & Sch. Bip. TR608 PRA_PV_TR608c CZ; Beroun, Trubínský vrch hill, 325 m a.s.l. 49°56′37″N, 13°59′47″E 1d
Hieracium umbellatum L. 1021 PRA_PV_1021c PL; Województwo pomorskie, Baltic coast, 5 m a.s.l. 54°20′00″N, 19°02′27″E 1d
H. stelligerum Froel. 1233 PRA_KK_1233c FR; Vallon Pont d’Arc, along the road D 390, 500 m a.s.l. 44°24′25″N, 04°24′10″E 1d
H. intybaceum All. 2509a PRA_KK_2509ac AT; Tirol, Tuxer Alpen, 3.3 km NE of the village of Navis, 1878 m a.s.l. 47°09′22″N, 11°33′48″E 1d
Andryala integrifolia L. AZ3 PRA_JZ_AZ3c DZ; Alger, town district of Kouba, 90 m a.s.l. 36°43′00″N, 03°05′00″E 1d
A. laevitomentosa (Nyár. ex Sennikov) Greuter D5 PRA_JZ_D5c RO; Bukovina, Mt. Pietrosul Broştenilor, 1780 m a.s.l. 47°22′31″N, 25°32′29″E 1d

Note: n = number of individuals.

a

Abbreviations for countries: AT = Austria, BG = Bulgaria, CZ = Czech Republic, DZ = Algeria, FR = France, PL = Poland, RO = Romania, SK = Slovakia, RS = Serbia.

b

Voucher specimens deposited in the herbarium of the Institute of Botany, Slovak Academy of Sciences (SAV), Bratislava, Slovakia.

c

Voucher specimens deposited in the herbarium of the Institute of Botany, Czech Academy of Sciences (PRA), Prague, Czech Republic.

d

Samples used to evaluate the potential cross-amplification of the markers within Hieraciinae.

LITERATURE CITED

  1. Bräutigam S., Greuter W. 2007. A new treatment of Pilosella for the Euro-Mediterranean flora. Wildenowia 37: 123–137. [Google Scholar]
  2. Faircloth B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
  3. Fehrer J., Gemeinholzer B., Chrtek J., Jr, Bräutigam S. 2007. Incongruent plastid and nuclear DNA phylogenies reveal ancient intergeneric hybridization in Pilosella hawkweeds (Hieracium, Cichorieae, Asteraceae). Molecular Phylogenetics and Evolution 42: 347–361. [DOI] [PubMed] [Google Scholar]
  4. Jönsson J., Wellenreuther M., Tyler T. 2010. Ten polymorphic microsatellite markers for Hieracium s.str. (Asteraceae). Conservation Genetics Resources 2: 295–300. [Google Scholar]
  5. Krak K., Mráz P. 2008. Trichomes in the tribe Lactuceae (Asteraceae): Taxonomic implications. Biologia 63: 616–630. [Google Scholar]
  6. Schuelke M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234. [DOI] [PubMed] [Google Scholar]
  7. Šingliarová B., Chrtek J., Plačková I., Mráz P. 2011a. Allozyme variation in diploid, polyploid and mixed-ploidy populations of the Pilosella alpicola group (Asteraceae): Relation to morphology, origin of polyploids and breeding system. Folia Geobotanica 46: 387–410. [Google Scholar]
  8. Šingliarová B., Hodálová I., Mráz P. 2011b. Biosystematic study of the diploid-polyploid Pilosella alpicola group with variation in breeding system: Patterns and processes. Taxon 60: 450–470. [Google Scholar]
  9. Šingliarová B., Šuvada R., Mráz P. 2013. Allopatric distribution, ecology and conservation status of the Pilosella alpicola group (Asteraceae). Nordic Journal of Botany 31: 122–128. [Google Scholar]
  10. Zini E., Komjanc M. 2007. Identification of microsatellite markers in Hieracium pilosella L. Conservation Genetics 9: 487–489. [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES