SUMMARY
The ten-eleven translocation (Tet) family of methylcytosine dioxygenases catalyze oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylacytosine (5hmC) and promote DNA demethylation. Despite the abundance of 5hmC and Tet proteins in the brain, little is known about the functions of the neuronal Tet enzymes. Here, we analyzed Tet1 knockout mice (Tet1KO) and found downregulation of multiple neuronal activity-regulated genes, including Npas4, c-Fos, and Arc. Furthermore, Tet1KO animals exhibited abnormal hippocampal long-term depression and impaired memory extinction. Analysis of the key regulatory gene, Npas4, indicated that its promoter region, containing multiple CpG dinucleotides, is hypermethylated in both naive Tet1KO mice and following extinction training. Such hypermethylation may account for the diminished expression of Npas4 itself and its downstream targets, impairing transcriptional programs underlying cognitive processes. In summary, we show that neuronal Tet1 regulates normal DNA methylation levels, expression of activity-regulated genes, synaptic plasticity, and memory extinction.
INTRODUCTION
DNA methylation is a covalent modification that is critical for the regulation of gene expression in a wide variety of biological contexts (Jaenisch and Bird, 2003; Bergman and Cedar, 2013). While methylation of DNA at 5-cytosine residues, as well as the methyltransferase (DNMT) enzymes that are responsible for this process, have been relatively well characterized (Jaenisch and Bird, 2003; Feng et al., 2010), the complementary process of DNA demethylation remains poorly understood. The ten-eleven translocation (Tet) family of methylcytosine dioxygenases, which includes Tet1, Tet2, and Tet3 enzymes, has been recently implicated in DNA demethylation. Tet proteins possess 2-oxoglutarate and Fe(II)-dependent oxygenase activity and have been shown to convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) as well as to 5-formylcytosine and 5-carboxylcytosine (Tahiliani et al., 2009; Ito et al., 2010; Guo et al., 2011a). 5hmC has been proposed to act as an intermediate in either passive demethylation, via disrupting interactions with DNMT1, a DNA methylation maintenance enzyme (Smith and Meissner, 2013), or in active demethylation, involving activation-induced deaminase (AID)/apolipoprotein B mRNA-editing enzyme complex (APOBEC) and the base-excision repair machinery (Guo et al., 2011a).
Tet proteins and 5hmC are abundant in the zygote, embryonic stem cells and in the brain. Most of the studies on Tet proteins so far have concentrated on their roles in embryonic stem cells (ESCs) and early development. ESCs have relatively high 5hmC content and express Tet1 and Tet2 (Tahiliani et al., 2009; Ito et al., 2010; Williams et al., 2011; Xu et al., 2011). It has been demonstrated that 5hmC and as well as Tet1 are particularly enriched at the transcription start sites and gene bodies of a large number of genes with high CpG content (Williams et al., 2011). However, loss of Tet1 and Tet2 and depletion of 5hmC in ES cells does not affect ES cell maintenance and pluripotency, but leads to subtle differentiation defects (Koh et al., 2011; Dawlaty et al. 2013). Mice deficient in Tet1 or Tet2 are viable, while combined loss of these genes leads to epigenetic abnormalities and partially penetrant perinatal lethality (Dawlaty et al., 2011; Dawlaty et al., 2013).
The abundance of all three Tet proteins as well as 5hmC in mouse brain (Kriaucionis and Heintz, 2009; Szulwach et al., 2011) suggests potential roles of Tet enzymes in postmitotic neurons. Although the functional data regarding neuronal Tet proteins is scarce, recently it was suggested that hydroxylation of 5hmC by Tet1 promotes active DNA demethylation in the adult mouse brain (Guo et al., 2011a). CpG demethylation of the promoters of Bdnf IX and Fgf1B genes caused by synchronous activation of adult dentate gyrus granule cells (Ma et al., 2009), was shown to be abolished by knocking down endogenous Tet1 using short-hairpin RNA (Guo et al., 2011a). This study provided the first glimpse into the potential roles of Tet proteins in the nervous system. Recently, MeCP2 (Mellen et al., 2012) and Uhrf2 (Spruijt et al., 2013) were identified as readers of 5hmC in the brain, however the functional significance of these interactions remains unclear.
A potential connection between neuronal Tet protein function and cognitive processes can be hypothesized following the discovery that (de)methylation of DNA in the brain appears to play a role in learning and memory (Miller and Sweatt, 2007; Miller et al., 2008). Pharmacological inhibition of DNA methylation resulted in defects in synaptic plasticity and memory impairment (Miller et al., 2010), and double knock out of DNMT1 and DNMT3s in the forebrain of mice led to demethylation of a number of neuronal genes and also produced deficits in synaptic plasticity, learning, and memory (Feng et al., 2010). By demonstrating a regulatory role of DNA demethylation in cognitive function (Rudenko and Tsai, 2013), these studies provide the rationale to further study the role of the Tet proteins in the nervous system.
In the current work, we show that the expression of a number of genes is dysregulated in the cortex and hippocampus of Tet1 knockout (Tet1KO) mice. Interestingly, the most prominent category of down-regulated genes is comprised of multiple neuronal activity-regulated genes that include Npas4, c-Fos, Arc, Egr2, and Egr4 (Loebrich and Nedivi, 2009). We also found that while Tet1KO mice display normal memory formation, they showed specific impairments in extinction learning. Moreover, we show that while hippocampal long-term potentiation was intact in Tet1KO animals, they had abnormally enhanced long-term depression compared to controls. We performed methylation analysis of a key upstream neuronal activity-regulated gene, Npas4, and found hypermethylation of the promoter region in Tet1KO animals compared to controls, both in naive mice and after extinction training, which could lead to the reduced expression of Npas4 and its downstream targets. Our study identifies a novel and important role for Tet1 in regulating the neuronal activity-regulated genes, hippocampal synaptic plasticity and memory extinction.
RESULTS
Adult Tet1KO brains are morphologically normal, have a significant reduction in 5hmC and a minor increase in 5mC levels
Reports of high levels of 5hmC in the central nervous system genome (Kriaucionis and Heintz, 2009; Szulwach et al., 2011) prompted a search for potential functions for the Tet1 methylcytosine dioxygenase in the mouse brain. We utilized a previously characterized Tet1 knockout (Tet1KO) mouse strain in which exon 4 of Tet1 is deleted, leading to an out-of-frame fusion of exons 3 and 5 and creating a Tet1 null allele (Dawlaty et al., 2011). Loss of Tet1 mRNA was confirmed by real-time quantitative PCR (RT-qPCR) in cortex and hippocampus (Figure S1A). We also quantified all three Tet mRNA levels in hippocampal and cortical tissues from wild type mice and found that all three Tets are expressed in both hippocampus and cortex (Figure S1B). The presence of all Tet proteins in the central nervous system may lead to potential compensatory effects caused by the loss of a single Tet family member.
Since Tet proteins are responsible for the conversion of 5mC to 5hmC, we wanted to determine how Tet1 ablation affects 5mC and 5hmC levels in the brain. Global genomic 5mC and 5hmC contents in the hippocampi and cortices of 4-month-old Tet1KO and control Tet1+/+ mice were assessed by immunohistochemistry (Figure 1A) and quantified by liquid chromatography combined with tandem mass spectrometry using multiple reaction monitoring (LC/MS/MS-MRM). We found that deletion of Tet1 led to a relatively minor but significant decrease in global 5hmC levels in the cortex and hippocampus (P<0.05; P<0.05), as well as a subtle and not statistically significant increase in the global levels of 5mC (P>0.05) (Figure 1A). These relatively small overall changes in the global genomic levels of 5hmC and 5mC in the Tet1KO brains are likely to reflect compensatory functions from Tet2 and Tet3, which are also expressed in the brain (Figure S1B).
Anatomical and morphological characterization of the Tet1KO brains did not reveal any significant abnormalities. The number of neurons in different brain areas including the cingulate cortex and hippocampus (Figures 1C, 1D and data not shown) and the average brain weight (Figure 1E) were unaffected by Tet1 ablation, suggesting that Tet1 is dispensable for normal brain development, and/or that Tet2 and 3 compensate for the loss of Tet1.
In order to examine more specifically synaptic connectivity in Tet1KO brains, we performed morphological analysis of various brain areas in control and Tet1KO littermate mice (3 + 3 animals, 3-month-old) using Synapsin I as a marker of synaptic abundance. As no significant differences in amount or distribution of Synapsin I were found in the cortex and hippocampus of Tet1KO and Tet1+/+ mice (P>0.05; P>0.05; Figure S1C), we conclude that synaptic development remains largely unperturbed by the loss of Tet1.
Tet1 ablation does not affect overall health, locomotion, anxiety, and depression-related behaviors
To evaluate potential effects of Tet1 ablation upon behavior of adult mice, we performed a general battery of behavioral tests using 4-months-old Tet1KO and Tet1+/+ male littermate mice (8 to 12 animals per group). None of the animals used in these tests had any overt anatomical or developmental abnormalities (data not shown). We observed normal locomotor behavior in the Tet1KO mice in the open field across all parameters measured (P>0.05; Figure S2A). In addition, parameters characterizing anxiety did not differ significantly between the mutant and control groups (P>0.05; Figure S2B). Tet1KO mice were also indistinguishable from their Tet1+/+ littermates in another common test for anxiety-like behavior in rodents, the elevated-plus maze (Dawson and Tricklebank, 1995) (Figure S2C). Using the Porsolt forced swim test (Petit-Demouliere et al., 2005), a measure of depressive-like behavior in the rodents, we also observed no significant differences between the Tet1KO and Tet1+/+ animals (P>0.05; Figure S2D).
Tet1KO mice exhibit normal acquisition of fear memory
As DNA (de)methylation in the brain appears to be important for cognition (Miller et al., 2008; Miller et al., 2010), we wanted to examine hippocampus-dependent learning and memory in Tet1+/+ and Tet1KO animals. To do this, we performed a classical Pavlovian fear conditioning (Philips and LeDoux, 1992). We observed no difference between the groups in contextual learning (P>0.05; Figure 2A) as well as cued fear memory acquisition (P>0.05; Figure 2B). Hot plate tests showed that there were no differences in nociception between the Tet1KO and Tet1+/+ animals (P>0.05; Figure 2C).
Tet1KO mice exhibit impairment in memory extinction
The initial behavioral experiments indicate that associative memory acquisition appears to be unaffected by the loss of Tet1. To examine cognitive functions in more detail, we extended our cognitive evaluation by assessing memory extinction. Memory extinction is a form of inhibitory learning that provides a basis for an adaptive control of cognition and represents one of the key aspects of mental flexibility (Radulovic and Tronson, 2010; Floresco and Jentsch, 2011). While it has been demonstrated that various stages of memory extinction require the recruitment of widespread brain domains, the molecular mechanisms regulating this process remain unclear (Lattal et al., 2003; Radulovic and Tronson, 2010).
In order to test the effects of Tet1 ablation on memory extinction, we performed extinction training using two groups of male littermate Tet1+/+ and Tet1KO mice following contextual fear conditioning as described earlier. Twenty-four hours after fear conditioning, both Tet1+/+ and Tet1KO groups exhibited similar freezing levels (65-75%) (P>0.05; Figure 2D). Following contextual fear memory test, Tet1+/+ and Tet1KO animals were placed into the same conditioning cages for a “massed” extinction trial (Cain et al., 2003; Polak et al., 2012). Twenty-four hours later, memory extinction was assessed by scoring freezing events. Interestingly, we found that while control Tet1+/+ mice exhibited robust memory extinction (~20% freezing following extinction training), Tet1KO mutants failed to display any memory extinction and retained an average freezing level of about 60% (P<0.01 control versus Tet1KO; Figure 2D).
To extend cognitive evaluation of the Tet1KO mice, we assessed their hippocampus-dependent spatial reference memory using the Morris water maze test (MWM) (Vorhees and Williams, 2006). Two groups of male littermate Tet1+/+ and Tet1KO mice were subjected to two training trials per day for six days, and the escape latency was scored for each trial. Probe trial was conducted twenty-four hours after the last day of training. We observed no significant differences between the groups during either the training or the probe trials (P>0.05; P>0.05 Figures 2E, F). To test spatial memory extinction, control and Tet1KO mice used for spatial learning tests were then exposed to extinction training in the MWM with the same spatial cues, but with the platform removed (Zhang et al., 2011). We discovered that while Tet1+/+ mice demonstrated considerable memory extinction as evidenced by their progressively decreasing target quadrant occupancy (from about 35% on the probe trial to about 15% on the last day of extinction training), the Tet1KO animals persevered searching for the platform in the former target quadrant, and did not show any decrease in quadrant preference (P>0.05 for Tet1KO; P<0.05 for control versus Tet1KO on day 3; Figure 2G). Additionally, while the Tet1+/+ mice decreased their number of platform crossings from on average 2.8 to an average 0.5, Tet1KO actually increased their number of crossings – from an average of 3 to 3.7 (P>0.05 for Tet1KO and P<0.05 for control versus Tet1KO on day 3; Figure 2H). Control experiments showed a similar swim speed in Tet1+/+ and Tet1KO animals (P>0.05; Figure 2I).
Tet1KO mice display normal basal synaptic transmission and long-term potentiation but have abnormally increased hippocampal long-term depression
As long-term potentiation (LTP) and long-term depression (LTD) are the critical components of synaptic plasticity, we decided to investigate LTP and LTD in acute hippocampal slices from four pairs of behaviorally naive 6-week-old Tet1+/+ and Tet1KO littermate mice. First, we evaluated basal synaptic transmission in hippocampal slices. The input-output curve was obtained by plotting the slopes of field excitatory postsynaptic potentials (fEPSP) against fiber volley amplitudes. Presynaptic release probability was assessed by paired-pulse facilitation (PPF) ratio. Our analysis did not show a significant difference in the input-output curve and in PPF between Tet1+/+ and Tet1KO mice (P>0.05; P>0.05; Figures 3A and 3B), indicating normal basal synaptic transmission in Tet1KO mice. In order to evaluate intrinsic neuronal properties, we measured intact presynaptic excitability of hippocampal neurons in control and Tet1KO mice (3 + 3 animals; 5 and 6 slices respectively), and found no significant difference (P=0.2848; Figure 3C).
Next, we examined LTP in the Schaffer collateral – CA1 pathway. CA1 fEPSPs were evoked by Schaffer collateral (SC) stimulation and LTP was induced by two episodes of theta-burst stimulation (TBS) with 10 s intervals. This stimulus induced LTP in both control and mutant mice with a slight trend towards a decreased LTP in Tet1KO mice (control: 141.47 +/− 18.18%, Tet1KO: 123.82 +/− 15.96%, P=0.48; Figure 3D).
LTD was induced in the Shaffer collateral-CA1 synapses by single-pulse low frequency stimulation (900 stimuli, 1 Hz). Interestingly, we discovered that while such stimulation was able to weakly induce LTD (91.71 +/− 3.51%; Figure 3E) in slices from control Tet1+/+ mice, which is expected considering advanced age of the animals, LTD induction in Tet1KO slices was stronger (72.38 +/− 3.74%; Figure 3E) than one would expect from adult mice (Feng et al., 2010). In order to test for potential alterations in metabotropic glutamate receptor (mGluR)-dependent form of LTD in Tet1KO mice we induced and recorded mGluR-dependent LTD in the slices from three pairs of 3-week-old mice control and Tet1KO littermate mice. Data analysis demonstrated that there was no difference in mGluR-dependent LTD between Tet1KO (73.64 +/− 6.34%) and controls (72.49 +/− 11.15%) (Figure S3A). As it appears that LTD abnormalities in Tet1KO are confined to NMDAR-dependent LTD, we conducted analysis of expression of various NMDAR subunits in Tet1KO and control brains. We found no differences in expression of any subunits between Tet1KO and Tet1+/+ behaviorally naïve mice as well as between the groups of animals that underwent fear conditioning and fear memory extinction training (Figure S3B). This is not surprising as previous studies have demonstrated abnormal NMDA-dependent LTD in the absence of any changes in NMDAR subunits levels (D'Amelio et al., 2011).
Loss of Tet1 leads to a significant downregulation of multiple neuronal activity-regulated genes
To systematically examine whether loss of Tet1 resulted in global alterations in gene expression, we performed microarray analysis using mRNA from the hippocampus and cortex from behaviorally naive littermate Tet1KO and Tet1+/+ mice. These analyses showed that expression of a number of genes was dysregulated in both hippocampus and cortex: 52 genes were upregulated in the hippocampus and 118 in the cortex, while 204 genes were downregulated in the hippocampus and 120 in the cortex (Figure 4A; Table S1; Table S2). Interestingly, while the number of genes up- and downregulated in the cortex was similar, about four times more genes were downregulated in the hippocampus of Tet1KO mice compared to control littermates. Analysis of the differentially expressed genes common to both cortex and hippocampus, revealed a group of prominent neuronal activity-regulated genes, including Npas4 and c-Fos, while Egr2, Egr4, and Arc were also downregulated in the hippocampus (Figure 4A). Neuronal activity-regulated genes are known to play important roles in a variety of cellular processes including neurotransmission, neuronal plasticity, and learning and memory (Loebrich and Nedivi, 2009). Interestingly, the transcript that displayed one of the strongest levels of downregulation in both cortex and hippocampus of Tet1KO mice was Npas4 (neuronal PAS domain protein 4) (Figure 4A). This protein was recently shown to regulate a transcriptional program involving neural activity-regulated genes and is critical for cognitive regulation (Ramamoorthi et al., 2011; Coutellier et al., 2012). To confirm the results of our microarray analysis, we performed RT-qPCR using cortical and hippocampal mRNA samples from Tet1+/+ and Tet1KO mice. Based on data from our microarrays, we tested expression levels of Npas4, Arc, c-Fos, Egr2, and Egr4 genes. Results of RT-qPCR experiments confirmed our microarray findings demonstrating a significant decrease in the amount of Npas4 and c-Fos mRNA in the cortex and Npas4, Arc, c-Fos, Egr2, and Egr4 mRNA in hippocampus (Figure 4B).
Next, we examined the protein levels of a representative immediate early gene, c-Fos, in the cortex and hippocampus of Tet1+/+ and Tet1KO mice. c-Fos, unlike Npas4, can be readily identified in neurons at baseline levels using immunohistochemistry, which would allow us to examine the spatial distribution of its expression in the brain. The examination of three Tet1KO and three Tet1+/+ brains revealed that levels of c-Fos protein are significantly lower in both the cortex and hippocampus of Tet1KO mice compared to controls (Figure 4C), which is in agreement with the microarray and RT-qPCR findings, while no spatial differences in c-Fos expression were observed (data not shown).
As Tet proteins are responsible for the conversion of 5mC to 5hmC and regulation of the DNA methylation status in various tissues, which may have an effect on chromatin structure and gene expression (Guo et al., 2011b; Branco et al., 2012), we hypothesized that downregulation in expression of learning- and memory-related genes in Tet1KO brains may be due to a direct role of Tet1 in the regulation of methylation of these genetic loci. As Npas4 has been shown to function as a critical upstream regulator of a genetic program that includes other activity-regulated neuronal plasticity genes, such as c-Fos, we decided to concentrate upon the analysis of the methylation status of the Npas4 in the brain of the Tet1+/+ and Tet1KO mice. We therefore performed sodium bisulfite sequencing of the Npas4 promoter-exon1 junction area, which contains 14 CpGs in the promoter region and 26 CpGs in exon 1. Sodium bisulfite sequencing of DNA from the control brains showed that the Npas4 promoter-exon1 junction is methylated in both cortex (~3.5% of CpGs methylated) and hippocampus (~8% of CpGs methylated). We found that the same DNA region was hypermethylated in the Tet1KO mouse cortex (~20%), compared to controls, and it was even more highly methylated in Tet1KO hippocampus (~45%) (Figure 4D). Thus, the loss of Tet1 appears to increase CpG methylation in the promoter-exon1 region of Npas4 in the Tet1KO mouse hippocampus and cortex, which may result in its decreased expression. Consistently, applying Gluc-MSqPCR method, we found reduced 5hmC coupled with increased 5mC levels at the promoter region of Npas4 (Figure S4A) in Tet1KO mice.
Tet1 loss causes downregulation of neuronal activity-regulated genes and hypermethylation of Npas4 promoter region following memory extinction
There is little data on the molecular mechanisms specifically regulating memory extinction (Lattal et al., 2003; Myers and Davis, 2007; Radulovic and Tronson, 2010). One of the genes that have been demonstrated to be important for extinction is c-Fos (Herry and Mons, 2004; Tronson et al., 2009). As expression of a set of neuronal activity-regulated genes was strongly altered in the brains of Tet1KO mice, we hypothesized that such dysregulation may be responsible for memory extinction and synaptic plasticity impairment in Tet1KO animals. Since c-Fos and its critical upstream regulator Npas4 were amongst a few genes consistently downregulated in both cortex and hippocampus in naive Tet1KO mice, we decided to test their expression following memory extinction training. Six pairs of 4-month-old male Tet1+/+ and Tet1KO littermate mice were subjected to Pavlovian contextual fear conditioning followed by massed memory extinction training as described earlier. The groups of three control and Tet1KO mice were sacrificed 20 min following the training and mRNA was extracted from hippocampal and cortical tissues to perform gene expression analysis. Another three animals from each group were sacrificed 1 hr after extinction training for protein evaluation.
RT-qPCR analysis of the samples from post-extinction Tet1+/+ and Tet1KO mice showed a significant reduction in the levels of Npas4 and c-Fos transcripts in both hippocampus and cortex. There was roughly two-fold difference in Npas4 mRNA levels in both hippocampus and cortex and similar difference in c-Fos mRNA (P<0.05; P<0.05; Figure 5A).
In order to evaluate expression and localization of c-Fos and Npas4 proteins in Tet1KO brains following memory extinction, we again used immunohistochemistry. The protein levels were estimated in the hippocampus and cingulate cortex area of Tet1+/+ and Tet1KO mice (3 + 3 animals). These brain regions were chosen as both cingulate cortex and hippocampus have been implicated in contextual memory extinction and cognitive flexibility (Myers and Davis, 2007; Floresco and Jentsch, 2011; Etkin et al., 2011). Examination of three Tet1KO and three control brains revealed that Npas4 and c-Fos protein levels appear to be significantly reduced in Tet1KO mice (Figures 5B and 5C). We failed to detect any differences in the spatial distribution of Npas4 or c-Fos expression between Tet1KO and Tet1+/+ brains following extinction training (Figure 5B and data not shown), suggesting that loss of neuronal Tet1 leads to mostly quantitative rather than spatial brain-region-specific alterations in expression of these genes.
As we observed downregulation of Npas4 and its target, c-Fos, not only in naive mice but also following memory extinction, we wanted to examine the underlying mechanisms. The methylation status of a key upstream neuronal plasticity gene Npas4 was assessed by sodium bisulfite sequencing following extinction training on the same promoter-exon1 regionstudied earlier. Interestingly, methylation analysis showed that post-extinction Npas4 promoter-exon1 junction remains hypomethylated in both cortex (~8% of CpGs methylated) and hippocampus (~8% of CpGs methylated) in control animals. We found that similarly to naïve animals, the promoter region of Npas4 was hypermethylated in Tet1KO cortex (~25% of CpGs methylated) and hippocampus (~30% of CpGs methylated) following extinction training (Figure 5D). Similarly to naïve mice, Gluc-MSqPCR analysis revealed reduced 5hmC levels coupled with increased 5mC levels at the promoter region of Npas4 (Figure S4A). Such hypermethylation of the promoter area of Npas4 gene in the Tet1KO brain may explain its decreased expression as well as down-regulated expression of its target c-Fos during memory extinction.
In order to perform direct comparison of Npas4 and c-Fos expression in control and Tet1KO mice under various experimental conditions, we selected three groups of littermate animals: a behaviorally naïve group, a group trained using Pavlovian fear conditioning, and a group which underwent fear memory extinction as described earlier. RT-qPCR analysis of hippocampal mRNA prepared 20 min after the trainings yielded the following results: consistent with previous data, Npas4 and c-Fos were significantly donwregulated in naïve Tet1KO animals compared to controls. Interestingly, Pavlovian fear conditioning increased expression of both genes to similar levels in control and Tet1KO mice. However, extinction training resulted in significant induction of Npas4 and c-Fos expression in Tet1+/+ but not in Tet1KO mice (Figure 5E). To assess if any of three Tet genes are induced upon fear condition or extinction training, we measured Tet1/2/3 mRNA levels in hippocampi of the same groups of animals and found that none of the Tets showed obvious induction (Figure S4B).
DISCUSSION
This study focuses on characterization of adult Tet1KO mice, and details the consequences of Tet1 loss in the brain. We found that Tet1 ablation leads to downregulation of a group of neuronal activity-regulated genes in cortex and hippocampus, alterations in synaptic plasticity, and specific cognitive impairment in memory extinction. We also show that the promoter region of a critical upstream factor regulating multiple neuronal activity-regulated genes, Npas4, is hypermethylated in Tet1KO mice. The proper control of the methylation status of Npas4 appears to be important for its expression and for the regulation of its downstream targets, such as c-Fos, that are instrumental in mediating synaptic plasticity and cognition. Below, we will discuss the potential consequences of our findings and the questions that remain to be answered.
We should first reiterate that we did not observe any abnormalities in the overall health of Tet1KO mice. This finding is in line with our previous work (Dawlaty et al., 2011), that Tet1 is largely dispensable for embryonic and postnatal development. Our extensive examination of postnatal Tet1KO brains did not reveal any obvious abnormalities (Figure 1, Figure S1C and data not shown) confirming that the loss of Tet1 does not affect embryonic neurogenesis, neuronal differentiation, and brain development. The absence of severe phenotypic abnormalities following total Tet1 ablation is likely due to the fact that this genetic manipulation did not result in a significant overall increase in 5mC content in the brain (Figure 1B). One obvious explanation for this is that Tet1/2/3 proteins play somewhat redundant roles in the maintenance of appropriate DNA methylation levels and conversion of 5mC to 5hmC in the brain, and/or that their roles in normal cellular homeostasis are relatively subtle and cannot be discerned from the examinations performed here.
A thorough examination of various behavioral parameters in Tet1KO mice demonstrated normal exploratory behavior, anxiety and depression-related behaviors. Moreover, Tet1KO mice also demonstrated normal memory acquisition in Pavlovian fear conditioning and Morris water maze tests, indicating that molecular mechanisms and circuits responsible for contextual fear and spatial reference memory acquisition are not significantly affected. Cognitive tests performed to investigate memory extinction in Tet1KO mice demonstrated impairments in both contextual fear memory extinction and spatial reference memory extinction in these animals.
Examination of the potential neurophysiological basis for memory extinction deficit in Tet1KO by hippocampal slice recordings, demonstrated that while having normal basal synaptic transmission, presynaptic excitability, and Schaffer collateral–CA1 LTP, Tet1KO mice exhibited an abnormally enhanced LTD. Although we are unsure about the molecular mechanisms underlying LTD abnormalities in Tet1KO mice, it is feasible that consistent downregulation of some of the plasticity-related neuronal genes observed in Tet1KO brain may underlie such impairment. As Npas4, c-Fos and other genes can mediate neuronal plasticity at multiple levels (Loebrich and Nedivi, 2009; Alberini, 2009), their downregulation may affect proper function of various components of LTD machinery. For example, it has been shown that LTD is regulated by the AMPA receptor trafficking (Liu and Cull-Candy, 2000; Clem and Huganir, 2010). As we observed misexpression of Arc in Tet1KO mice, it is tempting to speculate that LTD abnormality in Tet1KO animals may be at least partially a result of an impairment in Arc-dependent AMPA receptor trafficking (Loebrich and Nedivi, 2009). Interestingly, it has been shown that disruption of AMPA receptor endocytosis also impairs extinction, but not acquisition, of learned fear (Dalton et al., 2007). A number of previous studies demonstrated a connection between LTD and memory extinction (Ryu et al., 2008; Dalton et al., 2008; Tsetsenis et al., 2011; Kim et al., 2011). It was even proposed that LTD may represent a synaptic mechanism facilitating selective manipulation of an established memory, while leaving intact the capacity to form new memory (Dalton et al., 2008). Tet1KO mice provide a valuable genetic model for further investigation of the precise mechanistic connection between LTD and memory extinction. .
In this study, our genome-wide transcriptional profiling of the cortex and hippocampus of naive control and Tet1KO littermate animals showed that, while approximately the same number of genes was up- and downregulated in the cortex of Tet1KO mice, the majority of altered genes in the Tet1KO hippocampus were down- regulated (Figure 4A; Table S1; Table S2). An analysis of the dysregulated genes showed that a group of neuronal activity-regulated genes, including Npas4, c-Fos, Arc, Egr2, and Egr4, were downregulated in the hippocampus, and that Npas4, c-Fos and Arc also showed downregulation in the cortex. We should note that the key upstream regulatory gene Npas4 demonstrated the highest levels of dysregulation amongst all the genes analyzed in Tet1KO mice (Figure 4A). Sodium bisulfite sequencing revealed hypermethylation of the promoter-exon 1 junction of Npas4 in both cortex and hippocampus of Tet1KO mice compared to control animals. Such hypermethylation provides a likely mechanism for the suppression of Npas4 the Tet1KO mouse brain, as well as for the downregulation of Npas4 target genes including c-Fos.
We also found that both mRNA and protein levels of Npas4 and c-Fos were downregulated in the cortex and hippocampus of Tet1KO mice compared to controls following memory extinction training. Post-extinction methylation analysis of Npas4 promoter region indicated that its methylation remained low in the cortex and hippocampus in wild type mice, but stayed at much higher levels in Tet1KO animals, strongly correlating with Npas4 expression. We should note that locus-specific methylation and hydroxymethylation analysis in this study was performed using promoter areas of specific genes. However, we realize that methylation and hydroxymethylation of gene body as well as various distant regulatory elements may also contribute to gene expression (Bergman and Cedar, 2013). Future studies aimed at genome-wide methylation and hydroxymethylation analysis of the brains of Tet-deficient mice may provide a more comprehensive coverage of multiple methylation domains regulating expressions of specific genes.
One plausible explanation for extinction impairment observed in Tet1KO mice would be that the memory extinction paradigm does not provide a sufficiently strong stimulus to overcome Tet1 deficiency. However, a stronger stimulation, such as Pavlovian fear conditioning employed during memory acquisition, may recruit additional transcriptional machinery, including other Tet proteins, thus compensating for the lack of Tet1 (Figure S5). In favor of such hypothesis is the result of our direct comparison of Npas4 and c-Fos expression in control and Tet1KO mice under various experimental conditions (Figure 5E). Further studies using double and triple Tet knockouts should help us better understand the relative contribution and potential co-operation of different Tet proteins in various aspects of activity-driven chromatin regulation, cognitive behavior, and plasticity.
It has recently been shown that Tet1 promotes 5mC hydroxylation and active DNA demethylation in the adult mouse brain. Tet1 is both necessary and sufficient for neuronal activity-induced DNA demethylation of the Bdnf IX and Fgf1B promoters in the dentate gyrus (Guo et al., 2011). It remains to be seen whether such region- and gene-specific activity-dependent DNA demethylation occurs in a more general fashion in the mammalian brain, and whether Tet1 activity is critical. Our findings do not contradict the hypothesis of a key role of Tet1 in activity-induced DNA demethylation, but they also suggest a maintenance-type role for neuronal Tet1, perhaps protecting locus-specific DNA regions from excessive methylation (Williams et al., 2012). We propose that Tet1 plays an important role in maintaining consistent hypomethylation of specific DNA regions including promoter areas of at least some of the neuronal activity-regulated genes. Such hypomethylation may be important in keeping specific promoters poised for rapid transcriptional activation. This in turn will allow an increased flexibility in transcriptional regulation that may serve as a basis for various cognitive flexibility aspects including memory extinction. Interestingly, we also discovered that all three Tet proteins in the mouse brain did not show induction following Pavlovian fear conditioning and fear memory extinction training. This may suggest that expression of Tet genes is not activity-regulated. However, it is also feasible that our behavioral paradigms are not sufficient to facilitate Tet induction, or that Tet induction kinetics may follow a relatively slow course.
Based on our findings, we propose that neuronal Tet1 is critical for memory extinction, regulating expression of key neuronal activity-regulated genes and neuronal plasticity. Future examination of other aspects of cognitive flexibility, such as extinction of cued fear memory and reversal learning, as well as further evaluation of different cognitive manifestations may provide additional insights into on the nature of cognitive abnormalities in Tet1KO mice.
Our data demonstrating a role of neuronal Tet1 in memory extinction may have important clinical implications. Posttraumatic stress disorder (PTSD) is a common disorder caused by traumatic psychological events and characterized by an individual re-experiencing the original trauma and experiencing clinically significant distress or impairments in functioning (DSM-IV-TR, 2000; Merck Manual of Diagnosis and Therapy, 2011). Based on our findings, Tet1 may represent a potentially exciting molecular target for PTSD therapy. Future research on Tet1, as well as of the other members of the Tet family, may contribute significantly to our understanding of the fundamental mechanisms of memory extinction as well as provide potential treatment for disorders such as PTSD.
EXPERIMENTAL PROCEDURES
Animals
All experiments were performed according to the Guide for the Care and Use of Laboratory Animals and were approved by the National Institutes of Health and the Committee on Animal Care at the Massachusetts Institute of Technology (Cambridge, MA, USA). Tet1KO and Tet1+/+ used in the study were generated as reported previousy (Dawlaty et al. 2011).
Behavior
Open field, Fear conditioning, and Morris water maze were performed as previously described (Carlen et al., 2011; Gräff et al., 2012) with minor modifications. Elevated plus-maze was performed as previously described (David et al., 2009) with minor modifications. Memory extinction: following contextual fear memory test, Tet1+/+ and Tet1KO groups of mice were placed into the same conditioning chambers for a “massed” fear memory extinction trial (Cain et al., 2003; Polak et al., 2012). Spatial memory extinction was performed following learning in the Morris water maze (MWM) as in (Zhang et al., 2011).
Slice electrophysiology
Transverse hippocampal slices were prepared from 6-week-old and 3-4-month-old male littermate mice. CA1 field excitatory postsynaptic potentials evoked by Schaffer collateral pathway stimulation and measured as described in (Deng et al., 2011). LTP was induced by four episodes of theta burst stimulation (TBS) with 10 sec intervals, and TBS consisted of ten brief bursts of stimuli delivered at 5 Hz; each burst contains four pulses at 100 Hz. mGluR-dependent LTD was induced by treatment of mGluRI agonist DHPG for 10 min, then recorded for additional hr.
Quantification of 5mC and 5hmC
Quantification of global 5hmC and 5mC was performed as previously described in Dawlaty et al. (2013). Liquid-chromatography combined with tandem mass spectrometry using multiple reaction monitoring (LC-MS/MS-MRM) was used to quantify 5hmC and 5mC levels in the DNA extracted from the cortex and hippocampus of 4-month-old littermate male Tet1+/+ (control) and Tet1KO (mutant) mice (3 + 3 animals).
Microarrays and RT-qPCR
Total RNA was isolated from the cortex and hippocampus of naive Tet1+/+ and Tet1KO male littermate mice (2 + 2 animals; independent samples). Microarray experiments and their analysis was performed as in Dawlaty et al., (2011) and detailed in supplemtnal methods. For RT-qPCR,hippocampal and cortical tissues were dissected from the male littermate Tet1+/+ and Tet1KO mice and RT-qPCR was performed essentially as in (Gräff et al., 2012). Primers used are outlined in supplemental experimental procedures.
Sodium bisulfite sequencing
A total of 2μg of DNA extracted from cortex or hippocampus of Tet1+/+ and Tet1KO mice (2 + 2 animals) was treated with sodium bisulfite using EpiTect kit (QIAGEN). Npas4 promoter - exon 1 junction was amplified using the following nested primers:
External For: GTAAATTGGTAGAGGATTAAGTTTTTTTTTATTTTTTG
External Rev: TATCTCACACAAATCCAATACTAAAACTATC
Internal For: TTTTGTTAAGGGTTTTAGATTATTTTAATTTATGTATTG
Internal Rev: AACCCAAACTACTCACCTCCAAC
PCR product (700bp) was cloned into pcr2.1 vector TA-cloning vector and sequenced with M13rev primers. A total of 10-20 clones were analyzed per sample. Methylation status of Npas4 promoter-exon1 junction was displayed in the form of a grid with columns representing each of the 40 CpG dinucleotides present in this region and each row representing individual clones sequenced.
Statistics
Paired Student’ t-tests, one-way ANOVA, and two-way ANOVA followed by Bonferroni post-hoc test were used where appropriate. The graphs represent mean values with error bars sem or stdev. The statistical analysis was performed using GraphPad Prism software (GraphPad Software Inc. CA).
Supplementary Material
Highlights.
Tet1KO mice display memory extinction impairment
Tet1KO mice exhibit abnormally enhanced hippocampal LTD
Npas4, c-Fos, Arc are down-regulated in Tet1KO cortex and hippocampus
Npas4 promoter is hypermethylated in Tet1KO cortex and hippocampus
ACKNOWLEDGEMENTS
The authors would like to thank Dr. Tracy Petryshen and Dr. Mike Lewis for the valuable advice on behavioral essays; Dr. Alison Mungenast and Dr. Alexi Nott for helpful comments on the manuscript; Dr. Susan Su for the help with histological preparations; all members of Tsai and Jaenisch labs for advice and discussion. We would like to thank Mali Taylor, Ruth Flannery, and Kibibi Ganz for help with animal care, J. Kwon and J. Love from the Whitehead Genome Technology Core for help with microarrays and A. Yoon for help with mass spectrometry. A.R is supported by NARSAD Young Investigator Award; M.M.D is a Damon Runyon Postdoctoral Fellow; A.W.C is supported by a Croucher scholarship; T.L. is supported by a UCLA Molecular, Cellular and Neurobiology Training Grant, a UCLA Mental Retardation Training Grant, and a Eugene V. Cota-Robles Fellowship. Work in R.J. lab is supported by grants from National Institutes of Health (HD 045022 and R37CA084198) and the Simmons Foundation. L.-H.T. is an investigator of the Howard Hughes Medical Institute. This work is partially supported by an NIH RO1 grant (NS078839) to L.H.-T.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCESSION NUMBERS
The gene array data sets reported in this paper have been deposited in the Gene Expression Omnibus (GEO) database, http://www.ncbi.nlm.nih.gov/geo (accession number GSE48789)
Detailed description of the experimental procedures and reagents is available in the Supplemental Experimental Procedures.
REFERENCES
- Agis-Balboa RC, Arcos-Diaz D, Wittnam J, Govindarajan N, Blom K, Burkhardt S, et al. A hippocampal insulin-growth factor 2 pathway regulates the extinction of fear memories. EMBO J. 2011;30:4071–4083. doi: 10.1038/emboj.2011.293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alberini CM. Transcription factors in long-term memory and synaptic plasticity. Physiol Rev. 2009;89:121–145. doi: 10.1152/physrev.00017.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bahari-Javan S, Maddalena A, Kerimoglu C, Wittnam J, Held T, Bahr M, Burkhardt S, Delalle I, Kugler S, Fischer A, et al. HDAC1 regulates fear extinction in mice. J Neurosci. 2012;32:5062–5073. doi: 10.1523/JNEUROSCI.0079-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bergman Y, Cedar H. DNA methylation dynamics in health and disease. Nat Struct Mol Biol. 2013;20:274–281. doi: 10.1038/nsmb.2518. [DOI] [PubMed] [Google Scholar]
- Branco MR, Ficz G, Reik W. Uncovering the role of 5-hydroxymethylcytosine in the epigenome. Nat Rev Genet. 2012;13:7–13. doi: 10.1038/nrg3080. [DOI] [PubMed] [Google Scholar]
- Cain CK, Blouin AM, Barad M. Temporally massed CS presentations generate more fear extinction than spaced presentations. J Exp Psychol Anim Behav Process. 2003;29:323–333. doi: 10.1037/0097-7403.29.4.323. [DOI] [PubMed] [Google Scholar]
- Cardin JA, Carlen M, Meletis K, Knoblich U, Zhang F, Deisseroth K, et al. Driving fast-spiking cells induces gamma rhythm and controls sensory responses. Nature. 2009;459:663–667. doi: 10.1038/nature08002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carlen M, Meletis K, Siegle JH, Cardin JA, Futai K, Vierling-Claassen D, et al. A critical role for NMDA receptors in parvalbumin interneurons for gamma rhythm induction and behavior. Mol. Psychiatry. 2011;17:1–12. doi: 10.1038/mp.2011.31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clem RL, Huganir RL. Calcium-permeable AMPA receptor dynamics mediate fear memory erasure. Science. 2010;330:1108–1112. doi: 10.1126/science.1195298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coutellier L, Beraki S, Ardestani PM, Saw NL, Shamloo M. Npas4: a neuronal transcription factor with a key role in social and cognitive functions relevant to developmental disorders. PLoS One. 2012;7:e46604. doi: 10.1371/journal.pone.0046604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dalton GL, Wang YT, Floresco SB, Phillips AG. Disruption of AMPA receptor endocytosis impairs the extinction, but not acquisition of learned fear. Neuropsychopharmacology. 2008;33:2416–2426. doi: 10.1038/sj.npp.1301642. [DOI] [PubMed] [Google Scholar]
- David DJ, Samuels BA, Rainer Q, Wang JW, Marsteller D, Mendez I, et al. Neurogenesis-dependent and -independent effects of fluoxetine in an animal model of anxiety/depression. Neuron. 2009;62:479–493. doi: 10.1016/j.neuron.2009.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- D'Amelio M, Cavallucci V, Middei S, Marchetti C, Pacioni S, Ferri A, et al. Caspase-3 triggers early synaptic dysfunction in a mouse model of Alzheimer's disease. Nat Neurosci. 2011;14:69–76. doi: 10.1038/nn.2709. [DOI] [PubMed] [Google Scholar]
- Dawlaty MM, Breiling A, Le T, Raddatz G, Barrasa MI, Cheng AW, et al. Combined deficiency of Tet1 and Tet2 causes epigenetic abnormalities but is compatible with postnatal development. Dev Cell. 2013;24:310–323. doi: 10.1016/j.devcel.2012.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dawlaty MM, Ganz K, Powell BE, Hu YC, Markoulaki S, Cheng AW, et al. Tet1 is dispensable for maintaining pluripotency and its loss is compatible with embryonic and postnatal development. Cell Stem Cell. 2011;9:166–175. doi: 10.1016/j.stem.2011.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dawson GR, Tricklebank MD. Use of the elevated plus-maze in the search for novel anxiolytic agents. Trends Pharmacol Sci. 1995;16:33–36. doi: 10.1016/s0165-6147(00)88973-7. [DOI] [PubMed] [Google Scholar]
- Deng L, Kaeser PS, Xu W, Südhof TC. RIM proteins activate vesicle priming by reversing autoinhibitory homodimerization of Munc13. Neuron. 2011;69:317–331. doi: 10.1016/j.neuron.2011.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- DSM-IV-TR. American Psychiatric Publishing; Arlington, USA: 2000. [Google Scholar]
- Etkin A, Egner T, Kalisch R. Emotional processing in anterior cingulate and medial prefrontal cortex. Trends Cogn Sci. 2011;15:85–93. doi: 10.1016/j.tics.2010.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng J, Zhou Y, Campbell SL, Le T, Li E, Sweatt JD, Silva AJ, Fan G. Dnmt1 and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nat Neurosci. 2010;13:423–430. doi: 10.1038/nn.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fischer A, Radulovic M, Schrick C, Sananbenesi F, Godovac-Zimmermann J, Radulovic J. Hippocampal Mek/Erk signaling mediates extinction of contextual freezing behavior. Neurobiol Learn Mem. 2007;87:149–158. doi: 10.1016/j.nlm.2006.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fischer A, Sananbenesi F, Schrick C, Spiess J, Radulovic J. Distinct roles of hippocampal de novo protein synthesis and actin rearrangement in extinction of contextual fear. J Neurosci. 2004;24:1962–1966. doi: 10.1523/JNEUROSCI.5112-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Floresco SB, Jentsch JD. Pharmacological enhancement of memory and executive functioning in laboratory animals. Neuropsychopharmacology. 2011;36:227–250. doi: 10.1038/npp.2010.158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gräff J, Rei D, Guan JS, Wang WY, Seo J, Hennig KM, et al. An epigenetic blockade of cognitive functions in the neurodegenerating brain. Nature. 2012;483:222–226. doi: 10.1038/nature10849. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo JU, Su Y, Zhong C, Ming GL, Song H. Hydroxylation of 5-methylcytosine by TET1 promotes active DNA demethylation in the adult brain. Cell. 2011a;145:423–434. doi: 10.1016/j.cell.2011.03.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo JU, Su Y, Zhong C, Ming GL, Song H. Emerging roles of TET proteins and 5-hydroxymethylcytosines in active DNA demethylation and beyond. Cell Cycle. 2011b;10:2662–2668. doi: 10.4161/cc.10.16.17093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He YF, Li BZ, Li Z, Liu P, Wang Y, Tang Q, et al. Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science. 2011;333:1303–1307. doi: 10.1126/science.1210944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Herry C, Ferraguti F, Singewald N, Letzkus JJ, Ehrlich I, Luthi A. Neuronal circuits of fear extinction. Eur J Neurosci. 2010;31:599–612. doi: 10.1111/j.1460-9568.2010.07101.x. [DOI] [PubMed] [Google Scholar]
- Herry C, Mons N. Resistance to extinction is associated with impaired immediate early gene induction in medial prefrontal cortex and amygdala. Eur J Neurosci. 2004;20:781–790. doi: 10.1111/j.1460-9568.2004.03542.x. [DOI] [PubMed] [Google Scholar]
- Ito S, D'Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature. 2010;466:1129–1133. doi: 10.1038/nature09303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet. 2003;33(Suppl):245–254. doi: 10.1038/ng1089. [DOI] [PubMed] [Google Scholar]
- Jin SG, Kadam S, Pfeifer GP. Examination of the specificity of DNA methylationprofiling techniques towards 5-methylcytosine and 5-hydroxymethylcytosine. Nucleic Acids Res. 2010;38:e125. doi: 10.1093/nar/gkq223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Keifer J, Zheng Z, Mokin M. Synaptic localization of GluR4-containing AMPARs and Arc during acquisition, extinction, and reacquisition of in vitro classical conditioning. Neurobiol Learn Mem. 2008;90:301–308. doi: 10.1016/j.nlm.2008.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim JI, Lee HR, Sim SE, Baek J, Yu NK, Choi JH, Ko HG, Lee YS, Park SW, Kwak C, et al. PI3Kγ is required for NMDA receptor-dependent long-term depression and behavioral flexibility. Nat Neurosci. 2011;14:1447–1454. doi: 10.1038/nn.2937. [DOI] [PubMed] [Google Scholar]
- Koh KP, Yabuuchi A, Rao S, Huang Y, Cunniff K, Nardone J, et al. Tet1 and Tet2 regulate 5-hydroxymethylcytosine production and cell lineage specification in mouse embryonic stem cells. Cell Stem Cell. 2011;8:200–213. doi: 10.1016/j.stem.2011.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kriaucionis S, Heintz N. The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science. 2009;324:929–930. doi: 10.1126/science.1169786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lattal KM, Abel T. Different requirements for protein synthesis in acquisition and extinction of spatial preferences and context-evoked fear. J Neurosci. 2001;21:5773–5780. doi: 10.1523/JNEUROSCI.21-15-05773.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lattal KM, Mullen MT, Abel T. Extinction, renewal, and spontaneous recovery of a spatial preference in the water maze. Behav Neurosci. 2003;117:1017–1028. doi: 10.1037/0735-7044.117.5.1017. [DOI] [PubMed] [Google Scholar]
- Liu SQ, Cull-Candy SG. Synaptic activity at calcium-permeable AMPA receptors induces a switch in receptor subtype. Nature. 2000;405:454–458. doi: 10.1038/35013064. [DOI] [PubMed] [Google Scholar]
- Ma DK, Jang MH, Guo JU, Kitabatake Y, Chang ML, Pow-Anpongkul N, et al. Neuronal activity-induced Gadd45b promotes epigenetic DNA demethylation and adult neurogenesis. Science. 2009;323:1074–1077. doi: 10.1126/science.1166859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mamiya N, Fukushima H, Suzuki A, Matsuyama Z, Homma S, Frankland PW, et al. Brain region-specific gene expression activation required for reconsolidation and extinction of contextual fear memory. J Neurosci. 2009;29:402–413. doi: 10.1523/JNEUROSCI.4639-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Merck Manual of Diagnosis and Therapy. Nineteenth Edition Merck Publishing Group; Rahway, NJ, USA: 2011. [Google Scholar]
- Miller CA, Campbell SL, Sweatt JD. DNA methylation and histone acetylation work in concert to regulate memory formation and synaptic plasticity. Neurobiol Learn Mem. 2008;89:599–603. doi: 10.1016/j.nlm.2007.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miller CA, Gavin CF, White JA, Parrish RR, Honasoge A, Yancey CR, Rivera IM, Rubio MD, Rumbaugh G, Sweatt JD. Cortical DNA methylation maintains remote memory. Nat Neurosci. 2010;13:664–666. doi: 10.1038/nn.2560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Myers KM, Davis M. Mechanisms of fear extinction. Mol Psychiatry. 2007;12:120–150. doi: 10.1038/sj.mp.4001939. [DOI] [PubMed] [Google Scholar]
- Petit-Demouliere B, Chenu F, Bourin M. Forced swimming test in mice: a review of antidepressant activity. Psychopharmacology (Berl) 2005;177:245–255. doi: 10.1007/s00213-004-2048-7. [DOI] [PubMed] [Google Scholar]
- Phillips RG, LeDoux JE. Differential contribution of amygdala and hippocampus to cued and contextual fear conditioning. Behav Neurosci. 1992;106:274–285. doi: 10.1037//0735-7044.106.2.274. [DOI] [PubMed] [Google Scholar]
- Piccolo FM, Bagci H, Brown KE, Landeira D, Soza-Ried J, Feytout A, et al. Different Roles for Tet1 and Tet2 Proteins in Reprogramming-Mediated Erasure of Imprints Induced by EGC Fusion. Mol Cell. 2013;49:1023–1033. doi: 10.1016/j.molcel.2013.01.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Polack CW, Laborda MA, Miller RR. Extinction context as a conditioned inhibitor. Learn Behav. 2012;40:24–33. doi: 10.3758/s13420-011-0039-1. [DOI] [PubMed] [Google Scholar]
- Radulovic J, Tronson NC. Molecular specificity of multiple hippocampal processes governing fear extinction. Rev Neurosci. 2010;21:1–17. doi: 10.1515/revneuro.2010.21.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramamoorthi K, Fropf R, Belfort GM, Fitzmaurice HL, McKinney RM, Neve RL, et al. Npas4 regulates a transcriptional program in CA3 required for contextual memory formation. Science. 2011;334:1669–1675. doi: 10.1126/science.1208049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rudenko A, Tsai L-H. Epigenetic regulation in memory and cognitive disorders. Neuroscience. 2013 doi: 10.1016/j.neuroscience.2012.12.034. doi: 10.1016. [DOI] [PubMed] [Google Scholar]
- Ryu J, Futai K, Feliu M, Weinberg R, Sheng M. Constitutively active Rap2 transgenic mice display fewer dendritic spines, reduced extracellular signal-regulated kinase signaling, enhanced long-term depression, and impaired spatial learning and fear extinction. J Neurosci. 2008;28:8178–8188. doi: 10.1523/JNEUROSCI.1944-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sananbenesi F, Fischer A, Wang X, Schrick C, Neve R, Radulovic J, Tsai LH. A hippocampal Cdk5 pathway regulates extinction of contextual fear. Nat Neurosci. 2007;10:1012–1019. doi: 10.1038/nn1943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smith ZD, Meissner A. The simplest explanation: passive DNA demethylation in PGCs. EMBO J. 2013;32:318–321. doi: 10.1038/emboj.2012.349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song CX, Szulwach KE, Fu Y, Dai Q, Yi C, Li X, Li Y, Chen CH, Zhang W, Jian X, et al. Selective chemical labeling reveals the genome-wide distribution of 5-hydroxymethylcytosine. Nat Biotechnol. 2011;29:68–72. doi: 10.1038/nbt.1732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Szulwach KE, Li X, Li Y, Song CX, Wu H, Dai Q, et al. 5-hmC-mediated epigenetic dynamics during postnatal neurodevelopment and aging. Nat Neurosci. 2011;14:1607–1616. doi: 10.1038/nn.2959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, et al. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science. 2009;324:930–935. doi: 10.1126/science.1170116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tronson NC, Corcoran KA, Jovasevic V, Radulovic J. Trends Neurosci. 2012;Fear conditioning and extinction: emotional states encoded by distinct signaling pathways.35:145–155. [Google Scholar]
- Tronson NC, Schrick C, Guzman YF, Huh KH, Srivastava DP, Penzes P, et al. Segregated populations of hippocampal principal CA1 neurons mediating conditioning and extinction of contextual fear. J Neurosci. 2009;29:3387–3394. doi: 10.1523/JNEUROSCI.5619-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tsetsenis T, Younts TJ, Chiu CQ, Kaeser PS, Castillo PE, Sudhof TC. Rab3B protein is required for long-term depression of hippocampal inhibitory synapses and for normal reversal learning. Proc Natl Acad Sci U S A. 2011;108:14300–14305. doi: 10.1073/pnas.1112237108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vorhees CV, Williams MT. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Prot. 2006;1:848–858. doi: 10.1038/nprot.2006.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams K, Christensen J, Helin K. DNA methylation: TET proteins-guardians of CpG islands? EMBO Rep. 2012;13:28–35. doi: 10.1038/embor.2011.233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams K, Christensen J, Pedersen MT, Johansen JV, Cloos PA, Rappsilber J, Helin K. TET1 and hydroxymethylcytosine in transcription and DNA methylation fidelity. Nature. 2011;473:343–348. doi: 10.1038/nature10066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu Y, Wu F, Tan L, Kong L, Xiong L, Deng J, et al. Genom-wide regulation of 5hmC, 5mC, and gene expression by Tet1 hydroxylase in mouse embryonic stem cells. Mol Cell. 42:451–464. doi: 10.1016/j.molcel.2011.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang M, Storm DR, Wang H. Bidirectional synaptic plasticity and spatial memory flexibility require Ca2+-stimulated adenylyl cyclases. J Neurosci. 2011;31:10174–10183. doi: 10.1523/JNEUROSCI.0009-11.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang L, Szulwach KE, Hon GC, Song CX, Park B, Yu M, et al. Tet-mediated covalent labelling of 5- methylcytosine for its genome-wide detection and sequencing. Nat Commun. 2013;4:1517. doi: 10.1038/ncomms2527. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.