Skip to main content
PLOS One logoLink to PLOS One
. 2015 Aug 26;10(8):e0136301. doi: 10.1371/journal.pone.0136301

Comparative Analysis and Distribution of Omega-3 lcPUFA Biosynthesis Genes in Marine Molluscs

Joachim M Surm 1,*, Peter J Prentis 2, Ana Pavasovic 1
Editor: Alexander Chong Shu-Chien3
PMCID: PMC4550275  PMID: 26308548

Abstract

Recent research has identified marine molluscs as an excellent source of omega-3 long-chain polyunsaturated fatty acids (lcPUFAs), based on their potential for endogenous synthesis of lcPUFAs. In this study we generated a representative list of fatty acyl desaturase (Fad) and elongation of very long-chain fatty acid (Elovl) genes from major orders of Phylum Mollusca, through the interrogation of transcriptome and genome sequences, and various publicly available databases. We have identified novel and uncharacterised Fad and Elovl sequences in the following species: Anadara trapezia, Nerita albicilla, Nerita melanotragus, Crassostrea gigas, Lottia gigantea, Aplysia californica, Loligo pealeii and Chlamys farreri. Based on alignments of translated protein sequences of Fad and Elovl genes, the haeme binding motif and histidine boxes of Fad proteins, and the histidine box and seventeen important amino acids in Elovl proteins, were highly conserved. Phylogenetic analysis of aligned reference sequences was used to reconstruct the evolutionary relationships for Fad and Elovl genes separately. Multiple, well resolved clades for both the Fad and Elovl sequences were observed, suggesting that repeated rounds of gene duplication best explain the distribution of Fad and Elovl proteins across the major orders of molluscs. For Elovl sequences, one clade contained the functionally characterised Elovl5 proteins, while another clade contained proteins hypothesised to have Elovl4 function. Additional well resolved clades consisted only of uncharacterised Elovl sequences. One clade from the Fad phylogeny contained only uncharacterised proteins, while the other clade contained functionally characterised delta-5 desaturase proteins. The discovery of an uncharacterised Fad clade is particularly interesting as these divergent proteins may have novel functions. Overall, this paper presents a number of novel Fad and Elovl genes suggesting that many mollusc groups possess most of the required enzymes for the synthesis of lcPUFAs.

Introduction

Most vertebrates are considered inefficient at producing long-chain polyunsaturated fatty acids (lcPUFAs), such as omega-3, which makes them essential dietary requirements. In particular, omega-3 lcPUFAs are widely recognised for their role in neurological development, immune response and cardiac and circulatory function [16]. Despite some debate about the specific role of lcPUFAs in disease progression [2, 79], omega-3s are increasingly being used to biofortify human and animal diets. To meet this growing demand, marine molluscs have emerged as an excellent source of omega-3 lcPUFAs, not only because of their relatively high content of omega-3, but for their ability to endogenously elongate and desaturate precursor fatty acids to produce lcPUFAs [10].

Generally, lcPUFAs are synthesised by conversion of dietary PUFAs (e.g. 18-C molecule) to lcPUFAs (e.g. >20-C molecule) [11]. Specifically, PUFAs converted to lcPUFAs include linoleic acid (LA, C18:2n-6) and α-linolenic acid (ALA, C18:3n-3), with end products including omega-3 lcPUFAs such as eicosapentaenoic acid (EPA; 20:5n-3) and docosahexaenoic acid (DHA; 22:6n-3). These lcPUFAs are largely derived through the action of two key classes of enzymes; desaturases and elongases. While biosynthesis of EPA and DHA is well studied, the distribution and evolution of the genes encoding enzymes responsible for extension of the carbon chain and desaturation of bonds remain less understood. The genes that encode for the main elongases are the elongation of very long-chain fatty acid 2, 4 and 5 (Elovl2, Elovl4 and Elovl5) [1214]. The fatty acyl desaturase (Fad) gene family encodes for desaturase enzymes, of which delta-5 and delta-6 are the most significant in desaturation of precursor PUFA molecules to lcPUFA, such as EPA and DHA. Based on the current literature, the distribution of these genes appears to be lineage specific, with different members of both classes being lost or duplicated in various taxa [1518]. This may be explained by the apparent redundancy in function observed within the Elovl gene family. For example, both Elovl2 and Elovl4 elongate molecules from C-22 to C-24, in DHA synthesis [19,20]. An additional example is the failure to identify Elovl2 in marine fish, including those with sequenced genomes [10,20], as well as the loss of delta-5 Fad gene in the majority of teleost species [1214]. While the distribution of key Elovl and Fad genes remains largely unresolved in vertebrate taxa, even less information currently exists describing the homologous genes and their distribution in invertebrate species [21].

Currently, marine invertebrates such as cephalopods, bivalves and gastropods are frequently used as a dietary source of omega-3 lcPUFAs [22]. While a number of studies have demonstrated that some mollusc species are able to modify their lcPUFA content, only a few studies have investigated the endogenous Fad and Elovl genes required for the synthesis of omega-3 lcPUFAs [10]. Specifically, these include sequences of Fad and Elovl genes isolated from Octopus vulgaris [10,16,23,24], Haliotis discus [25] and Chlamys nobilis [26,27]. A total of nine sequences are currently available for molluscs, seven of which have been functionally characterised. One characterised Elovl gene from O. vulgaris is hypothesised to have Elovl4 activity, while the other Elovls from the O. vulgaris and C. nobilis, have Elovl5 function [10,23,27]. All characterised Fad genes in molluscs have demonstrated delta-5 desaturase activity [16,25,26]. Given the lack of sequence data for molluscs, it is therefore not surprising that no studies, to date, have investigated the phylogenetic relationship and distribution of Fad and Elovl gene families across this phylum. Recently there has been a large increase in publically available genome and transcriptome data for non-model species [28]. This increase in data and associated improvements in bioinformatics and computation has allowed the prediction and identification of functional genes in diverse taxonomic groups. Using improved gene identification techniques, this study examined the distribution of Fad and Elovl genes found in all major orders of phylum Mollusca, through the interrogation of the available transcriptome and genome sequences, as well as key protein databases. Phylogenetic analysis of this data has also been performed to elucidate the evolution of the Fad and Elovl gene families in molluscs.

Methods

Identification of candidate genes

To obtain a representative list of Fad and Elovl genes from the following orders of phylum Mollusca; Bivalvia, Gastropoda and Cephalopoda, we have interrogated multiple transcriptome sequences, publicly available mollusc genomes, searched the sequence read archive (SRA) for non-assembled mollusc transcriptomes, as well as retrieved the available protein sequences from UNIPROT and NCBI Non-Redundant (NR) database.

Generating novel sequences from candidate species

The genes involved in the synthesis of omega-3 lcPUFAs were investigated in three candidate mollusc species with sequenced transcriptomes. These species include an intertidal bivalve Anadara trapezia (2.4 Gb of total sequence data; [29]) and two closely related, intertidal gastropod species, Nerita albicilla and Nerita melanotragus (~7 Gb of total sequence for each species; NCBI SRA accession numbers SRP056343 (N. albicilla) and SRP056344 (N. melanotragus). The two neritid species of marine snails are common to the intertidal zone in Australia [30], and are ecologically similar to other intertidal marine snails currently used as commercial sources of omega-3 in Asian countries [31]. Anadara trapezia is a bivalve commonly found in Australia and is closely related to Anadara granosa, a key aquaculture species in Malaysia and a number of other Asian countries [32]. Currently, A. trapezia is being developed for aquaculture production in Australia [33]. Briefly, the transcriptomes were sequenced on a HiSeq 2000 (Illumina, San Diego, USA) using 91-bp paired-end chemistry. High quality paired-end reads (Q > 30, ambiguous bases < 1%) were de novo assembled into contigs using multiple software including CLC genomics workbench v6.0.4 (CLC Inc, Aarhus, Denmark) and Trinity short read de novo assembler [34]. Redundant contigs and chimeric sequences were removed using CD-hit [35]. Contigs of ≥ 200bp were selected and annotated against the NCBI NR database as BLASTx queries using BLAST+ 2.2.29 software with stringency E-value of 1E-6 (this E-value was used for all BLAST searches). Functional gene ontology (GO) annotations were performed using Blast2GO software [36]. Genes of interest were identified in the transcriptomes with relevant BLASTx, GO or enzyme code annotations associated with known lcPUFA synthesis. Candidate genes were also identified using a custom generated BLAST database (CB database) created from known omega-3 lcPUFA synthesis genes in molluscs extracted from the UNIPROT database.

Bioinformatic analysis of available genomes and genomic resources

To identify candidate Fad and Elovl genes from other mollusc taxa, the NCBI NR protein database and the UNIPROT database were interrogated using taxonomically restricted BLAST searches (molluscs (taxid: 6447)). Furthermore, the genomic and proteomic data from the largely complete draft genomes of Crassostrea gigas (oysterDB), Lottia gigantea (JGI) and Aplysia californica (Broad Institute) were interrogated for full-length proteins, Pfam domains [37] and GO terms corresponding to Fad and Elovl proteins. The transcriptome sequences of Loligo pealeii, Chlamys farreri, Argopecten irradians and Chiton olivaceus were also interrogated for Fad and Elovl genes. The transcriptomes of C. farreri, A. irradians and C. olivaceus, however, were only available as raw sequence reads and required bioinformatic assembly for candidate gene identification. Raw paired-end reads for these three species were downloaded from the SRA database at NCBI (C. farreri SRR653436 [38], A. irradians SRX470082 [39], C. olivaceus SRX205322 [40]). The SRA files were converted to left and right fastq files using NCBI SRA toolkit version 2.3.5, fastq dump, and assembled using Trinity de novo assembler software. Contigs from L. pealeii, C. farreri, A. irradians and C. olivaceus of ≥ 200bp were used as BLASTx queries against our custom BLAST database generated from known omega-3 lcPUFA synthesis genes from molluscs using the BLAST+ 2.2.29 software.

Identified candidate genes were considered full-length proteins after their open reading frames (ORFs) were determined using ORF Finder [41], all conserved domains found in these proteins were predicted using SMART database [42] searches and when BLASTp searches returned full-length alignments against known full-length proteins from other species. We further refined our sequence list to include only functional proteins, which were characterised by the presence of essential structural characteristics. These included a N-terminal cytochrome b5-like binding domain (cyt-b5; PF00173), three histidine boxes (HXXXH, HXXHH and QXXHH) located in a fatty acid desaturase domain (FA_desaturase; PF00487), and a haeme binding motif (HPGG) in Fads. The structural characteristics of Elovls included a diagnostic histidine box motif (HXXHH), a Pfam ELO domain (PF01151), the predicted trans-membrane domains and the presence of 17 highly conserved amino acid residues distributed throughout the protein (125K, 128E, 131DT, 137L, 151HH, 178N, 182H, 185MY, 188YY, 208T, 250LF, 254F) annotated from O. vulgaris Elovl5 protein (AFM93779) [43]. These structural characteristics are essential for desaturation and elongation, and therefore transcripts not containing these domains were not considered. The position and number of transmembrane domains was determined for full-length proteins using TMHMM Server v. 2.0 [44]. All full-length sequences that did not possess the specified features were considered putative pseudogenes.

To better understand the distribution of the Fad and Elovl gene families, we investigated the homology of gene sequences and exon-intron structure of these genes across multiple taxa. Local BLAST analysis, using custom Perl scripts, was performed to identify homologous protein sequences for both Fad and Elovl genes. These candidate protein sequences were used as BLASTx queries against CB database. Exon-intron structure was investigated for all candidate genes based on C. gigas and L. gigantea genome sequences in ENSEMBL Metazoa database [45].

Phylogenetic analyses

The refined list of full-length ORFs and their translated protein sequences from mollusc species were used for phylogenetic analyses to determine the distribution of Fads and Elovls across this phylum. Initially, protein sequences were aligned in Geneious version 7.1.5 [46] using a global alignment with a Blosum62 cost matrix [47]. Aligned sequences were then manually edited in BioEdit v7.2.5 [48] to identify conserved residues and motifs using an annotated protein sequence from C. nobilis for Fad proteins (AIC34709) and from O. vulgaris for Elovl proteins (Elovl4 AIA58679, Elovl5 AFM93779).

Protein sequences for both Fad (XP_001640617) and Elovl (XP_001640727) genes, from the Nematostella vectensis, were used as an outgroup for both phylogenetic trees. No vertebrate sequences were included for either gene family, as previous research has shown that genes from molluscs fall outside of all vertebrate lineages [2527]. For the Elovl phylogeny, Elovl 1, 3, 6 and 7 were excluded from this analysis as they play no role in the synthesis of the lcPUFAs EPA and DHA [27].

To infer the evolutionary history of Fad and Elovl genes, Maximum Likelihood method was performed on both nucleotide and protein sequence datasets. The full-length ORFs were aligned using M-coffee [49] and the optimal model of nucleotide evolution was determined using MEGA6 [50]. Finally, Maximum Likelihood trees were constructed with a Tamura 3-parameter substitution model with Gamma distribution and invariant sites selected for the Fad phylogeny, and a Kimura 2-parameter substitution model with Gamma distribution and invariant sites selected for the Elovl phylogeny, both undergoing 1000 bootstrap iterations. Protein sequences were aligned using M-coffee [49] and the optimal model of amino acid substitution was determined using MEGA6 [50]. Maximum Likelihood trees were then constructed using LG amino acid substitution model with Gamma distribution and invariant sites selected for both the Fad and Elovl trees and undergoing 1000 bootstrap iterations

cDNA amplification of candidate transcripts

To confirm the reliability of our de novo assemblies, three candidate transcripts were validated using cDNA synthesis, cloning and sequencing from newly collected A. trapezia and N. melanotragus samples. Anadara trapezia were collected from seagrass beds at Wynnum, Queensland, Australia (GPS Position: 27°26&rsquo;08.7"S 153°10&rsquo;25.0"E) and N. melanotragus were collected from King’s Beach, Caloundra, Queensland, Australia (GPS Position: 153°8&rsquo;14"E, 26°48&rsquo;17"S). Sample collection has been authorised under the Fisheries Act 1994 (General Fisheries Permit), permit number: 166312. Whole organisms were snap frozen using liquid N2 and stored at—80°C. Tissue samples were ground in liquid N2, with total RNA isolated using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and cleaned up using a RNeasy Mini Kit (Qiagen, Victoria, Australia). Genomic DNA still present following RNA extraction was digested using Turbo DNA-free kit (Life Technologies, Carlsbad, CA, USA).

Primers were designed using Primer3 software with the settings from [51] to amplify the entire ORF of the candidate genes, as per Table 1. RNA samples were converted to cDNA and PCR amplified using the MyTaq One-Step RT-PCR Kit (Bioline, London, UK). All PCR conditions followed the manufacturer’s protocol except annealing temperatures, which were optimised for individual primer pairs (Table 1). PCR products were run on a 1.5% agarose gel and stained using gel red (Bioline, London, UK). Amplification of a PCR product of the correct size was considered to be the correct transcript. PCR products were purified using an Isolate II PCR and Gel Kit (Bioline, London, UK) and cloned into a plasmid using the Promega pGEM-T Easy Vector kit (Promega, Madison, WI, USA). A minimum of two clones were selected and purified using an Isolate II Plasmid minikit (Bioline, London, UK) and sequenced using the primers M13–47 and RV-M (Promega, Madison, WI, USA). Cycle sequencing was performed in duplicate and in both forward and reverse direction using the BIGDYE Terminator Cycle Sequencing kit version 3.1 (Life Technologies, Carlsbad, CA, USA). Sequencing products were cleaned up with an ethanol-EDTA precipitation and run on a 3500 Genetic Analyzer (Life Technologies, Carlsbad, CA, USA). Geneious version 7.1.5 [46] software package was used to visualise, edit and concatenate sequences for all loci. Sequences for all successfully amplified loci were compared to the de novo assembled contig from which the primers were designed using a global nucleotide alignment with free-end gaps, and 93% similarity cost matrix.

Table 1. List of primers, including annealing temperature, designed to validate Fad and Elovl genes, identified from A. trapezia and N. melanotragus.

Species Contig name Primer Primer sequence Annealing temperature (°C)
A. trapezia AtFad ATDF CTGATGGCACTTCCATTGTG 54
ATDR TAACGACGCGCGTGTATTAG
N. melanotragus NmElovla NMEF1 TGGTCGCACTATCCTGTACG 52
NMER1 TCACAGGCCTCAGTTTGATCT
NmElovlb NMEF2 GTCTACAGCGTGGGTGGTG 52
NMER2 GCCATTTAATGCCAATGTGT

Results

Identification of candidate genes

Multiple Fad and Elovl transcripts were identified in the transcriptomes of the three candidate species (Table 2). In A. trapezia, a transcript relating to a single Fad (AtFad; accession number KR154727) was identified after two separate contigs, which received the same top BLAST hit (from C. gigas; accession number EKC30965), were manually merged at a 15 bp overlapping region. The AtFad transcript (1293 bp) encoded a 432 amino acid (aa) protein, with cyt-b5 (PF00173) and FA_desaturase (PF00487) domains. No full-length Elovl proteins were found in A. trapezia. While a number of incomplete transcripts were observed, for the purposes of this manuscript, they were not considered as they did not contain an ELO domain (PF01151) or the correct number of transmembrane domains (5–7).

Table 2. List of candidate genes that encode putative Fad and Elovl proteins identified from A. trapezia, N. albicilla and N. melanotragus transcriptome assemblies.

Species Gene Contig number Contig name Transcript length (bp) Full length Protein length (aa) Pfam domain
A. trapezia Fad CL5362.Contig1 1068 No
CL2092.Contig1 234 No
CL5362/CL2092 merged AtFad 1293 Yes 432 Cyt-b5; FA_desaturase
N. albicilla Fad comp92028_c0_seq5 NaFada 1580 Yes 442 Cyt-b5; FA_desaturase
comp92028_c0_seq9 NaFada 1541 Yes 442 Cyt-b5; FA_desaturase
comp92028_c0_seq6 NaFadb 1608 Yes 432 Cyt-b5; FA_desaturase
Elovl comp87569_c0_seq1 NaElovla 1289 Yes 304 ELO
comp69709_c1_seq1 NaElovlb 967 Yes 278 ELO
comp84775_c1_seq1 NaElovlc 1107 Yes 292 ELO
N. melanotragus Fad comp87301_c0_seq1 NmFada 1557 Yes 432 Cyt-b5; FA_desaturase
contig_24618 NmFada 1626 Yes 432 Cyt-b5; FA_desaturase
comp88083_c1_seq1 NmFadb 1607 Yes 444 Cyt-b5; FA_desaturase
contig_5699 NmFadc 1765 Yes 443 Cyt-b5; FA_desaturase
Elovl comp59448_c0_seq1 NmElovla 1372 Yes 266 ELO
comp78993_c0_seq1 NmElovlb 1216 Yes 293 ELO
comp84505_c0_seq1 NmElovlc 3349 Yes 306 ELO
contig_548 NmElovld 819 Yes 261 ELO

In N. albicilla, three full-length Fad and three Elovl transcripts were identified. Both NaFada transcripts (comp92028_c0_seq5 and comp92028_c0_seq9) had identical ORFs at the nucleotide level and were considered allelic or splice variants of the same gene. The two different Fad proteins, NaFada and NaFadb, had ORFs that translated into predicted proteins of 442 and 432 aa, respectively. The three Elovl proteins were different in ORF nucleotide sequence and translated into proteins of 304 (NaElovla), 278 (NaElovlb) and 292 (NaElovlc) aa in length. All of the full-length putative proteins contained the required conserved domains (i.e. cyt-b5 and FA_desaturase for Fad, and ELO domain in Elovl transcripts) and the correct number of transmembrane domains (i.e. 3–4 for Fads and 5–7 for Elovls) for proper protein function.

The N. melanotragus transcriptome also contained multiple full-length Fad and Elovl transcripts. These included four full-length Fads (comp87301_c0_seq1, contig_24618, comp88083_c1_seq1 and contig_5699) and four Elovl transcripts (comp59448_c0_seq1, comp78993_c0_seq1, comp84505_c0_seq1 and contig_548). Of the four full-length Fads, only three were unique. The unique Fads translated into proteins of 432 (NmFada), 444 (NmFadb) and 443 (NmFadc) aa in length. The Elovl transcripts translated into 266 (NmElovla; accession number KR154728), 293 (NmElovlb; accession number KR154729), 306 (NmElovlc) and 261 (NmElovld) aa in length.

Searches of the NCBI NR protein database and the UNIPROT database using taxonomically restricted BLAST searches identified only a limited number of sequences for Fad and Elovl genes, and their corresponding proteins, in these databases. In total, five Fad and four Elovl proteins were identified from mollusc species (Table 3). Four Fad proteins were identified in C. nobilis (1 protein; AIC34709), H. discus (2 proteins; ADK38580 and ADK12703) and O. vulgaris (1 protein; AEK20864) were all functionally characterised with delta-5 desaturase activity. An additional Fad protein was also found in Sepia officinalis (AKE92955) that is yet to be functionally characterised. The three Elovl proteins were identified in C. nobilis (1 protein; AGW22128) and O. vulgaris (2 proteins; AFM93779 and AIA58679). Two Elovl proteins had been previously functionally characterised in O. vulgaris (AFM93779) and C. nobilis (AGW22128) protein having Elovl5 activity. An additional Elovl protein has been found in O. vulgaris (AIA58679) with preliminary data suggesting that this protein may have Elovl4 activity. An Elovl (Elovl4 function) and a Fad (delta-8 function) protein have been characterised in the bivalve C. nobilis [52], however, these sequences are currently not publicly available.

Table 3. List of mollusc Fad and Elovl genes, currently available in NCBI NR protein and UNIPROT databases.

Species Gene Definition Protein length (aa) Protein accession Reference Function
C. nobilis Fad delta-5 fatty acyl desaturase 428 AIC34709 [26] Delta-5
Fads2 delta-8 fatty acyl desaturase 436 NA [52] Delta-8
Elovl elongase of very long-chain fatty acids-like protein 307 AGW22128 [27] Elovl5
Elovl4 elongase of very long-chain fatty acids-like protein 308 NA [52] Elovl4
H. discus Fad1 delta-5 fatty acid desaturase 1 438 ADK38580 [25] Delta-5
Fad1 delta-5 fatty acid desaturase 2 439 ADK12703 [25] Delta-5
O. vulgaris Fad delta-5 fatty acyl desaturase 445 AEK20864 [16] Delta-5
Elovl elongase of very long-chain fatty acids-like protein 294 AFM93779 [23] Elovl5
Elovl4 elongation of very long-chain fatty acids protein 4 309 AIA58679 [10] Elovl4-like
S. officinalis Fad delta-5 fatty acyl desaturase 445 AKE92955 Unpublished NA
Elovl elongase of very long-chain fatty acids-like protein 295 AKE92956 Unpublished NA

Searches of the three currently available mollusc genomes, C. gigas, L. gigantea and A. californica, identified multiple full-length Fad and Elovl genes in each species (Table 4). We identified four Fads (EKC30965, EKC33620, XP_011414050 and EKC42380) and seven Elovls (EKC19804, EKC25061, EKC39214, EKC41251, XP_011450775, XP_011450777 and CGI_10028198) in the C. gigas genome sequence, however, one Elovl protein (CGI_10028198) was only identified following local BLAST searches against our CB database (Table 4). The unannotated transcript (CGI_10028198) was 930bp in length, and encoded a putative protein of 309 aa. Another identified Elovl gene (EKC19804) encoded a 524 aa protein but was cropped to 267 aa, as the first 267 aa had a significant BLAST hit to a known O. vulgaris Elovl protein, and no other supporting RNA-Seq or protein evidence for a longer protein was found. Analysis of the L. gigantea genome revealed the presence of three Fad (XP_009049968, XP_009045077, XP_009051231) and two Elovl proteins (XP_009051096, XP_009045720) (Table 4). Four full-length Fad genes (XP_005090573, XP_005090577, XP_005093182, XP_005097048) and three full-length Elovl genes (XP_005098302, XP_005106660, XP_005095683) were identified in the A. californica genome sequence (Table 4). These searches also revealed the presence of a number of partial or interrupted genes from both protein classes in the genome sequences of all species. These gene fragments would not produce functional proteins and were excluded from further analysis as they lacked relevant Pfam domains, transmembrane domains and conserved aa residues required for correct protein function.

Table 4. Fad and Elovl genes extracted from the currently available complete mollusc genomes of C. gigas, A. californica and L. gigantea.

Species Gene Protein Sequence ID Protein length (aa) Accession
C. gigas Fad Fatty acid desaturase 2 C. gigas 2 433 EKC30965
Fatty acid desaturase 2 C. gigas 1 436 EKC33620
Fatty acid desaturase 2 C. gigas 3 433 XP_011414050
Elovl Elongation of very long-chain fatty acids protein 4 C. gigas 5 267 EKC19804
Elongation of very long-chain fatty acids protein 4 C. gigas 3 291 EKC25061
Elongation of very long-chain fatty acids protein 4 C. gigas 4 262 EKC39214
Elongation of very long-chain fatty acids protein 4 C. gigas 2 269 EKC41251
Elongation of very long-chain fatty acids protein 4-like isoform X1 C. gigas 6 298 XP_011450775
Elongation of very long-chain fatty acids protein 4-like isoform X2 C. gigas 7 295 XP_011450777
unannotated C. gigas 1 309 CGI_10028198
A. californica Fad fatty acid desaturase 1-like A. californica 3 433 XP_005090573
fatty acid desaturase 1-like isoform X5 A. californica 4 433 XP_005090577
fatty acid desaturase 2-like A. californica 2 434 XP_005093182
fatty acid desaturase 2-like A. californica 1 432 XP_005097048
Elovl elongation of very long-chain fatty acids protein 5-like A. californica 1 305 XP_005098302
elongation of very long-chain fatty acids protein 4-like A. californica 2 324 XP_005095683
elongation of very long-chain fatty acids protein 4-like A. californica 3 307 XP_005106660
L. gigantea Fad hypothetical protein LOTGIDRAFT_113523 L. gigantea 2 434 XP_009049968
hypothetical protein LOTGIDRAFT_198790 L. gigantea 3 431 XP_009045077
hypothetical protein LOTGIDRAFT_170234 L. gigantea 1 435 XP_009051231
Elovl hypothetical protein LOTGIDRAFT_214031 L. gigantea 2 288 XP_009051096
hypothetical protein LOTGIDRAFT_199086 L. gigantea 1 283 XP_009045720

Analysis of the four other mollusc transcriptomes identified full-length transcripts only in the L. pealeii and C. farreri assemblies (Table 5). Partial transcripts were identified in both the A. irradians and C. olivaceus transcriptomes for both protein classes but no full-length genes were identified. A single Fad and two Elovl transcripts were identified in the L. pealeii assembly (Table 5). The ORF for L. pealeii Fad translated into a 445 aa protein, while the two Elovl transcripts had ORFs that translated into proteins of 296 and 322 aa. Two Fad transcripts were identified in the C. farreri transcriptome (Table 5), and their ORFs translated into 428 and 436 aa proteins. Assembly statistics for the C. farreri, A. irradians and C. olivaceus transcriptomes are presented in Table 6. The mean contig length was 615, 629 and 427bp, and N50 was 834, 900 and 506bp for C. farreri, A. irradians and C. olivaceus, respectively. The assembly metrics are within the reported range for other mollusc species [29].

Table 5. List of candidate genes that encode putative Fad and Elovl proteins identified from L. pealeii and C. farreri transcriptome assemblies.

Species Gene Contig number Contig name Transcript length (bp) Full length Protein length (aa) Pfam domains
L. pealeii Fad VL.id87430.tr217207 L. pealeii 1 2093 Yes 445 Cyt-b5; FA_desaturase
Elovl SG.id94038.tr94065 L. pealeii 1 1221 Yes 296 ELO
Elovl VL.id104916.tr79693 L. pealeii 1246 Yes 322 ELO
C. farreri Fad comp45465_c0_seq1 C. farreri 2 1524 Yes 428 Cyt-b5; FA_desaturase
Fad comp76054_c0_seq1 C. farreri 1 1535 Yes 436 Cyt-b5; FA_desaturase

Table 6. Assembly summary statistics, for C. farreri, A. irradians and C. olivaceus transcriptomes using Trinity de novo assembler.

Species Number of contigs N50 Mean contig length (bp) Longest contig (bp) Accession SRA Reference
C. farreri 132 529 834 615 14797 SRR653436 [38]
A. irradians 82 345 900 629 34005 SRX470082 [39]
C. olivaceus 218350 506 427 12430 SRX205322 [40]

Phylogenetic analyses

Fads alignment and phylogenetic analysis

The alignment of 24 mollusc Fad proteins, with the out group protein from N. vectensis, resulted in an alignment of 483 aa and 57 conserved aa residues being identified (Fig 1). When the N. vectensis protein sequence was removed, the alignment was considerably shorter (457 aa residues) and 100 conserved aa residues were identified across the 23 protein sequences. Based on the alignment of all identified Fad genes (Fig 1), the haeme binding motif, HPGG and the three histidine boxes, HXXXH, HXXHH and QXXHH were highly conserved across the mollusc species investigated. The first histidine box sequence was highly conserved in aa sequence and consisted of HDF/YGH, where the only difference being the replacement of phenylanine (F) in some species with the structurally similar aa Tyrosine (Y). The second histidine box HXXHH, was also highly conserved and consisted of HY/FQ/LHH. The first difference was the replacement of phenylanine (F) with tyrosine (Y), and the second difference was the replacement of the hydrophilic aa glutamine (Q) with the hydrophobic aa leucine (L). The final histidine box QXXHH box was highly conserved with a sequence of QI/VEHH. Only a single replacement of an isoleucine (I) with the structurally similar aa valine (V) occurred in a C. farreri protein. All Fad genes had between three to four transmembrane domains.

Fig 1. Alignment of Fad protein sequences showing conserved and variable regions.

Fig 1

The haeme binding domain (HPGG) and the three histidine boxes (HXXXH, HXXHH and QXXHH) are indicated with a black rectangular outline.

Phylogenetic analysis of the full-length ORF sequences identified two well supported clades for the mollusc Fad sequences (Fig 2A). Clade A (coloured in blue) contained all functionally characterised delta-5 desaturases and had sequences from all mollusc groups represented in this study. This clade contained the AtFad, NaFada, NmFadb and NmFadc. The NaFada sequence was sister to the highly similar NmFadb and NmFadc. These three sequences were sister to a group of other gastropod genes that was made up of recently duplicated genes from A. californica and H. discus. The AtFad sequence was sister to a pair of recently duplicated C. gigas genes and this group was sister to all cephalopod Fad sequences from L. pealeii, S. officinalis and O. vulgaris, and a single Fad gene from L. gigantea. The second distinct clade (clade B, coloured in orange) contained fewer sequences and no functionally characterised Fads. This clade contained the NaFadb and NmFada sequences as well as two bivalve sequences and four other gastropod sequences. The NaFadb and NmFada sequences were sister to each other and occurred in a well resolved clade with A. californica. These sequences were sister to recently duplicated genes from L. gigantea. An additional clade could also be observed in clade B containing sequences from A. californica and the bivalve species, C. gigas and C. farreri. The protein tree showed broadly similar topology to the nucleotide tree, containing the same sequences within the two distinct clades (Fig 2B). Within clade A, protein sequences clustered according to taxonomic affinity with the exception of L. gigantea which was sister to all sequences within clade A. Clade B exhibited largely similar topology to the nucleotide tree with the exception of L. gigantea 1 no longer clustering with its recently duplicated copy, instead clustered with the two bivalve sequences and A. californica 2.

Fig 2. Phylogenetic trees depicting relationships among nucleotide and protein sequences from Fad genes.

Fig 2

(a) Maximum Likelihood tree of Fad nucleotide sequences. Bootstrap values are shown next to nodes, values under 75% not reported. Accession numbers: AtFad KR154727, C. gigas 1 CGI_10016476, C. gigas 2 CGI_10019765, C. gigas 3 XM_011415748, A. californica 1 XM_005096991, A. californica 2 XM_005093125, A. californica 3 XM_005090516, A. californica 4 XM_005090520, L. gigantea 1 XM_009052983, L. gigantea 2 XM_009051720, L. gigantea 3 XM_009046829, C. nobilis (delta-5) KJ598786, H. discus (delta-5) 1 GQ470626, H. discus (delta-5) 2 GQ466197, O. vulgaris (delta-5) JN120258, S. officinalis KP260645. Exon-intron structure for L. gigantea and C. gigas are presented as gene models with exons (red boxes) and introns (red lines) adjacent to the corresponding species. (b) Maximum Likelihood tree of Fad protein sequences. Bootstrap values are shown next to nodes, and values under 75% not reported. Accession numbers: C. gigas 1 EKC33620, C. gigas 2 EKC30965, C. gigas 3 XP_011414050, A. californica 1 XP_005097048, A. californica 2 XP_005093182, A. californica 3 XP_005090573, A. californica 4 XP_005090577, L. gigantea 1 XP_009051231, L. gigantea 2 XP_009049968, L. gigantea 3 XP_009045077, C. nobilis (delta-5) AIC34709, H. discus (delta-5) 1 ADK38580, H. discus (delta-5) 2 ADK12703, O. vulgaris (delta-5) AEK20864, S. officinalis AKE92955.

Exon-intron structure could only be determined for two C. gigas (C. gigas 1 and C. gigas 2) and all three L. gigantea Fad genes as they have nearly completed genome sequences (Fig 2A). The A. californica exon-intron structure could not be determined because this genome is too fragmented to reliably confirm the exon-intron structure of gene models. The exon-intron structure of the Fad genes was different between the two clades. Specifically, the two genes found in the clade A that contained functionally characterised delta-5 Fads had 12 exons (C. gigas 2 and L. gigantea 2), while the three genes in clade B had 10 (C. gigas 1 and L. gigantea 1) and 11 exons (L. gigantea 3). The two genes from clade B with 10 exons were more closely related than the Fad with 11 exons.

Elovls alignment and phylogenetic analysis

The alignment of the Elovl protein sequences was 349 aa in length and had 47 conserved aa residues when the N. vectensis protein sequence was included in the alignment, as well as when removed (Fig 3). The diagnostic histidine box (HXXHH) was highly conserved and consisted of HVF/YHH, where the only difference was the replacement a phenylalanine (F) residue with a tyrosine (Y). Another highly conserved region of 15 aa was identified in the alignment between residues 233–247. Within this region 10 of the 15 aa were identical across all mollusc species. All Elovl genes had between five to seven transmembrane domains. The conserved 17 aa distributed throughout were also conserved, but a few sequences had a single aa substitution. These substitutions occurred in C. gigas 1 from threonine (T) (position 163 in the Elovl alignment) to a serine (S), C. gigas 4 leucine (L) (position 168 in the Elovl alignment) to valine (V) and A. californica 1 leucine (L) (position 168 in the Elovl alignment) to alanine (A).

Fig 3. Alignment of Elovl protein sequences showing conserved and variable regions.

Fig 3

The histidine box (HXXHH) is indicated with a black rectangular outline. Highly conserved aa residues (K, E, DT, L, HH, N, H, MY, YY, T, LF, F) are designated with the symbol ★.

A phylogenetic tree constructed from mollusc Elovl full-length ORF sequences is presented in Fig 4A. Clade A (coloured in red) contained functionally characterised Elovl2/5 sequences from O. vulgaris and C. nobilis. Within this clade sequences clustered largely according to taxonomic affinity for bivalves, cephalopods and gastropods, with the exception of L. gigantea, which clustered with cephalopods. Within clade A, a group composed of bivalve sequences was sister to all cephalopod and gastropod sequences. An additional well resolved clade (clade C) was identified containing the hypothesised Elovl4 gene from O. vulgaris. Elovl sequences from all major orders could be found within this clade and again largely clustered according to taxonomic affinity, with the exception of L. gigantea which clustered weakly with cephalopod sequences. The cephalopod sequences within this clade were sister to bivalve and gastropod sequences. Two additional clades (clades B and D) could be observed and contained no functionally charactersied Elovl sequences. These two clades contained only bivalve and gastropod sequences. The NmElovla sequence (clade B) was closely related to two sequences from C. gigas, while the NaElovlb and NmElovlb sequences (clade D) were sister to each other and closely related to sequences from C. gigas and A. californica. An additional sequence from C. gigas was also found to be sister to all Elovl sequences. The protein tree in Fig 4B showed similar topology to the nucleotide tree, with the exception of the C. gigas sequence in clade E now clustering within clade D. The protein tree produced a topology where the sequences in clades A and C clustered according to taxonomic affinity.

Fig 4. Maximum Likelihood trees of Elovl nucleotide and protein sequences.

Fig 4

(a) Phylogenetic tree of Elovl nucleotide sequences. Bootstrap values are shown next to nodes, and values under 75% not reported. Accession numbers: NmElovla KR154728, NmElovlb KR154729, C. gigas 1 CGI_10028198, C. gigas 2 CGI_10008431, C. gigas 3 CGI_10020977, C. gigas 4 CGI_10012627 C. gigas 5 CGI_10007566, C. gigas 6 XM_011452473, C. gigas 7 XM_011452475, A. californica 1 XM_005098245, A. californica 2 XM_005095626, A. californica 3 XM_005106603, L. gigantea 1 XM_009047472, L. gigantea 2 XM_009052848, C. nobilis (Elovl2/5) KF245423, O. vulgaris (Elovl4) KJ590963, O. vulgaris (Elovl2/5) JX020803, S. officinalis KP260646. Exon-intron structure for L. gigantea and C. gigas are presented as gene models with exons (red boxes) and introns (red lines) adjacent to the corresponding species. (b) Phylogenetic tree of Elovl protein sequences. Bootstrap values shown next to nodes, and values under 75% not reported. Accession numbers: C. gigas 1 CGI_10028198, C. gigas 2 EKC41251, C. gigas 3 EKC25061, C. gigas 4 EKC39214, C. gigas 5 EKC19804, C. gigas 6 XP_011450775, C. gigas 7 XP_011450777, A. californica 1 XP_005098302, A. californica 2 XP_005095683, A. californica 3 XP_005106660, L. gigantea 1 XP_009045720, L. gigantea 2 XP_009051096, C. nobilis (Elovl2/5) AGW22128, O. vulgaris (Elovl4) AIA58679, O. vulgaris (Elovl2/5) AFM93779, S. officinalis AKE92956.

The exon-intron structure could only be resolved for four C. gigas and all L. gigantea Elovl genes (Fig 4A). The transcripts for C. gigas 1, 6 and 7 had no exon-intron structure in the current version of the C. gigas genome. There was no consistent association between exon-intron structure and phylogenetic relatedness for Elovl genes. The single gene (L. gigantea 1) from clade A, that contained functionally characterised Elovl5s, had seven exons as did the two genes (C. gigas 2 and 3) from clade E and D respectively with no functionally characterised Elovls. The single gene (L. gigantea 2) from clade C had two exons. The two genes (C. gigas 4 and 5) in clade B had seven and 10 exons, respectively.

PCR Validation

All three primer pairs amplified the expected fragments that were used for PCR validation. The transcripts used for validation were AtFad, NmElovla and NmElovlb. The validation sequence of AtFad (accession: KR154727) was identical to the de novo assembled transcript, in protein sequence and only had five synonymous SNPs across the 1293bp ORF, which corresponded to 99.6% nucleotide similarity. The NmElovla (accession: KR154728) and NmElovlb (accession: KR154729) were also identical in protein sequence to the de novo assembled transcripts and had high similarity, 99.5% (three synonymous SNPs) to 99.9% (one synonymous SNP) to the ORF of their respective transcripts.

Discussion

In this study we investigated the distribution and phylogenetic relationship of Fad and Elovl genes, in a number of commercially important orders within the phylum Mollusca. Multiple Fad and Elovl genes were identified in Bivalvia, Gastropoda and Cephalopoda, while the phylogenetic analysis of Fad and Elovl sequences identified multiple well resolved clades in each of these gene families. This finding indicates that both the Fad and Elovl gene families in bivalves and gastropods have undergone at least one round of gene duplication in the last common ancestor of these orders. The novel and newly characterised sequences generated in this study also indicated that lineage specific duplication events have played a prominent role in the evolution and expansion of the Fad gene family in molluscs.

Multiple Fad genes were identified in both N. albicilla and N. melanotragus, while only a single Fad was found in A. trapezia. This pattern, where fewer Fad genes were observed in bivalves when compared to gastropods, was not mirrored across other surveyed species from these orders including those with full genome sequences (i.e. L. gigantea—3 genes, A. californica—4 genes, and C. gigas—3 genes). The presence of genes from both clades, in both bivalves and gastropods, indicates a duplication event in their common ancestor, estimated to be at least 300 million years ago [53]. This duplication event did not occur in cephalopods based on their sequences only occurring in clade A.

Lineage specific duplications of Fad genes were found in both bivalves and gastropods. This lineage specific duplication can be seen in clade A, where N. melanotragus (NmFadb and NmFadc), A. californica (A. califonica 3 and 4), C. gigas (C. gigas 2 and 3) and H. discus (H. discus (delta-5) 1 and 2), show evidence of recent gene duplications. An additional lineage specific duplication could be observed in clade B for the gastropod species with sequenced genomes, A. californica 1 and 2 and L. gigantea 1 and 3. These lineage specific duplication events appear to have increased gene numbers in the gastropod and bivalve lineage compared to the cephalopod lineage.

Duplication of Fad genes has also been observed in vertebrate taxa including mammals [18], birds and reptiles [54] as well as fish [55]. Previous work in vertebrates has found that the distribution of Fads was the result of both ancient and recent duplication events [54]. The ancient duplication predated the split of vertebrates and has resulted in formation of two distinct clades (Fads1 and Fads2), while lineage specific duplication events have led to increased gene copy number in species such as salmon (Salmo salar), chicken (Gallus gallus) and green anole (Anolis carolinensis) [54]. This pattern is largely consistent with our findings where clades A and B are likely to be the result of an ancient duplication event, while the more recent duplications have led to lineage specific expansions of Fad genes in both clades.

The discovery of clade B in the Fad phylogeny represents an interesting finding because it contained only uncharacterised, and potentially novel, proteins. These proteins are of interest for further functional characterisation to determine the specific role of these divergent Fads in the lcPUFA biosynthesis pathway. It may be hypothesised, therefore that if these genes were to have a new function, such as delta 4, 6 or 8 desaturase activity, then all necessary Fad enzymes for omega-3 lcPUFA synthesis would be present. A recent study supports this finding as a desaturase with delta-8 activity has been functionally characterised in the bivalve C. nobilis [52], allowing for the synthesis of EPA but not DHA. Some marine mollusc species, however, have an increased copy number of Fad genes when compared to the functionally characterised Fad enzymes found in C. nobilis. This increased copy number found in C. gigas, along with L. gigantea, A. californica and N. melanotragus, may therefore provide the additional desaturase activity required for the synthesis of DHA. This is plausible since the capacity for biosynthesis of lcPUFA was demonstrated in the bivalve C. gigas in previous studies [56, 57].

Multiple Elovl transcripts were identified in both N. albicilla and N. melanotragus but no full-length Elovl transcripts were found in the A. trapezia transcriptome. The observation that gastropods have a greater number of Elovl genes compared to bivalves was not supported by the genomic data, where C. gigas had the greatest number of Elovl genes (C. gigas—7 genes, A. californica—3 genes, L. gigantea—2 genes). Phylogenetic analysis identified that gene duplication has been a major force in the evolution and diversification of Elovl genes in molluscs. One duplication event in the Elovl gene family is likely to have occurred during the early diversification of molluscs (~ 500 million years ago) as cephalopods, bivalves and gastropods have sequences found in both clades [53]. Lineage specific duplications in C. gigas were identified in the Elovl phylogeny and are observed in clades B, C and D. This shows that, similar to the Fad gene family, gene duplication has played a major role in the evolution of the Elovl gene family in molluscs.

Duplication and neofunctionalisation have played an important role in the evolution of Elovl genes in various taxonomic groups but remains best studied in fish, where Elovl genes have evolved new functions following an ancient duplication [58]. A similar pattern is seen in our mollusc Elovl phylogeny where two O. vulgaris homologs, one homolog hypothesised to have Elovl4 activity and the other with Elovl5 activity [10, 23], are found within the different and well resolved clades that form the earliest split in the Elovl phylogeny. In fish, salmon (S. salar) have an increased number of Elovl genes compared to other species [59]. Again we observed a similar pattern in C. gigas, which had an increased number of Elovl genes compared to the other mollusc species examined. Functional characterisation of Elovl genes from C. gigas is needed before we can ascertain whether these duplicated genes have evolved new functions.

The lack of full-length Elovl transcripts and the presence of only a single Fad transcript in A. trapezia should be viewed with some caution. This is because the A. trapezia transcriptome was sequenced at a lower depth than the other transcriptomes used for the identification of Fads and Elovls in this study. Given that two bivalve species, C. gigas and C. farreri, each have two Fad proteins, and C. gigas had 7 Elovl proteins, additional Fad and Elovl transcripts may have been identified in A. trapezia if this transcriptome was sequenced to a greater depth. It is not uncommon that a functional gene is not captured during transcriptome sequencing, in particular if the gene is expressed at low levels or during specific developmental stages [60]. In future studies, more complete transcriptome or genome sequences may improve our ability to resolve the presence and absence of Fad and Elovl genes in these taxa.

In summary, this study has demonstrated that gene duplication has had a large influence on the evolution and distribution of Fad and Elovl genes in mollusc species. The identification of an uncharacterised clade of Fad proteins is of great interest as this may represent a group of Fads with novel functions. Our research also demonstrated that most mollusc species had orthologous genes of characterised Elovl4 and 5 proteins, which suggests that most molluscs can elongate PUFAs to lcPUFAs. Overall, this study has identified a number of uncharacterised Fad and Elovl proteins that require functional characterisation to further illuminate the role of these proteins in lcPUFA synthesis in molluscs.

Acknowledgments

The authors would like to acknowledge helpful advice from Mr. Vincent Chand, Dr. Linda Nothdurft and Mr. Shorash Amin. Computational resources were provided by the High Performance Computing Facility at Queensland University of Technology, Brisbane, Australia.

Data Availability

All validated sequences are available from the NCBI GenBank database (accession KR154727, KR154728, KR154729).

Funding Statement

The authors have no support or funding to report.

References

  • 1. Burri L, Hoem N, Banni S, Berge K. Marine Omega-3 Phospholipids: Metabolism and Biological Activities. Int. J Mol Sci.2012;13:15401–15419. 10.3390/ijms131115401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Calder PC, Yaqoob P. Omega-3 polyunsaturated fatty acids and human health outcomes. BioFactors. 2009;35:266–272. 10.1002/biof.42 [DOI] [PubMed] [Google Scholar]
  • 3. Harris WS, Lavie CJ, Lee JH, O’Keefe JH Omega-3 fatty acids: cardiovascular benefits, sources and sustainability. Nat Rev Cardiol. 2009;6:753 10.1038/nrcardio.2009.188 [DOI] [PubMed] [Google Scholar]
  • 4. Mozaffarian D, Wu JHY. Omega-3 fatty acids and cardiovascular disease: effects on risk factors, molecular pathways, and clinical events. J Am Coll Cardiol. 2011;58:2047–2067 10.1016/j.jacc.2011.06.063 [DOI] [PubMed] [Google Scholar]
  • 5. Mozaffarian D, Wu JHY. (n-3) Fatty Acids and Cardiovascular Health: Are Effects of EPA and DHA Shared or Complementary? J Nutr. 2012;142:614S–625S 10.3945/jn.111.149633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Swanson D, Block R, Mousa SA. Omega-3 Fatty Acids EPA and DHA: Health Benefits Throughout Life12. Adv. Nutr.2012;3:1–7 10.3945/an.111.000893 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Calder PC. Very long chain omega-3 (n-3) fatty acids and human health. Eur J Lipid Sci Technol. 2014;116:1280–1300. 10.1002/ejlt.201400025 [DOI] [Google Scholar]
  • 8. Patterson E, Wall R, Fitzgerald GF, Ross RP, Stanton C. Health Implications of High Dietary Omega-6 Polyunsaturated Fatty Acids. J Nutr Metab. 2012;2012: e539426 10.1155/2012/539426 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Simopoulos AP. Evolutionary aspects of diet: the omega-6/omega-3 ratio and the brain. Mol. Neurobiol. 2011;44:203–215 10.1007/s12035-010-8162-0 [DOI] [PubMed] [Google Scholar]
  • 10. Monroig Ó, Tocher DR, Navarro JC. Biosynthesis of Polyunsaturated Fatty Acids in Marine Invertebrates: Recent Advances in Molecular Mechanisms. Mar Drugs. 2013;11:3998–4018. 10.3390/md11103998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Vannice G, Rasmussen H. Position of the Academy of Nutrition and Dietetics: Dietary Fatty Acids for Healthy Adults. J Acad Nutr Diet. 2014;114:136–153. 10.1016/j.jand.2013.11.001 [DOI] [PubMed] [Google Scholar]
  • 12. Green CD, Ozguden-Akkoc CG, Wang Y, Jump DB, Olson LK. Role of fatty acid elongases in determination of de novo synthesized monounsaturated fatty acid species. J Lipid Res. 2010;51:1871–1877. 10.1194/jlr.M004747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Morais S, Monroig Ó, Zheng X, Leaver MJ, Tocher DR. Highly Unsaturated Fatty Acid Synthesis in Atlantic Salmon: Characterization of ELOVL5- and ELOVL2-like Elongases. Mar Biotechnol. 2009;11:627–639. 10.1007/s10126-009-9179-0 [DOI] [PubMed] [Google Scholar]
  • 14. Zheng X, Ding Z, Xu Y, Monroig Ó, Morais S, Tocher DR. Physiological roles of fatty acyl desaturases and elongases in marine fish: Characterisation of cDNAs of fatty acyl Δ6 desaturase and elovl5 elongase of cobia (Rachycentron canadum). Aquaculture. 2009;290:122–131. 10.1016/j.aquaculture.2009.02.010 [DOI] [Google Scholar]
  • 15. Hastings N, Agaba M, Tocher DR, Leaver MJ, Dick JR, Sargent JR, et al. A vertebrate fatty acid desaturase with Δ5 and Δ6 activities. Proc Natl Acad Sci U S A. 2001;98:14304–14309. 10.1073/pnas.251516598 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Monroig Ó, Navarro JC, Dick JR, Alemany F, Tocher DR. Identification of a Δ5-like Fatty Acyl Desaturase from the Cephalopod Octopus vulgaris (Cuvier 1797) Involved in the Biosynthesis of Essential Fatty Acids. Mar Biotechnol. 2011;14:411–422. 10.1007/s10126-011-9423-2 [DOI] [PubMed] [Google Scholar]
  • 17. Nakamura MT, Nara TY. Structure, Function, and Dietary Regulation of Δ6, Δ5, and Δ9 Desaturases. Annu Rev Nutr. 2004;24:345–376. 10.1146/annurev.nutr.24.121803.063211 [DOI] [PubMed] [Google Scholar]
  • 18. Zheng X, Seiliez I, Hastings N, Tocher DR, Panserat S, Dickson CA, et al. Characterization and comparison of fatty acyl Δ6 desaturasecDNAs from freshwater and marine teleost fish species. Comp Biochem Physiol B Biochem Mol Biol. 2004;139:269–279. 10.1016/j.cbpc.2004.08.003 [DOI] [PubMed] [Google Scholar]
  • 19. Monroig Ó, Webb K, Ibarra-Castro L, Holt GJ, Tocher DR. Biosynthesis of long-chain polyunsaturated fatty acids in marine fish: Characterization of an Elovl4-like elongase from cobia Rachycentron canadum and activation of the pathway during early life stages. Aquaculture. 2011;312:145–153. 10.1016/j.aquaculture.2010.12.024 [DOI] [Google Scholar]
  • 20. Monroig Ó, Rotllant J, Cerdá-Reverter JM, Dick JR, Figueras A, Tocher DR. Expression and role of Elovl4 elongases in biosynthesis of very long-chain fatty acids during zebrafish Danio rerio early embryonic development. BBA Molecular and Cell Biology of Lipids. 2010;1801(10):1145–1154. 10.1016/j.bbalip.2010.06.005 10.1016/j.bbalip.2010.06.005 [DOI] [PubMed] [Google Scholar]
  • 21. Pereira SL, Leonard AE, Mukerji P. Recent advances in the study of fatty acid desaturases from animals and lower eukaryotes. Prostag Leukotr Essnt Fatty Acids. 2003;68:97–106. 10.1016/S0952-3278(02)00259-4 [DOI] [PubMed] [Google Scholar]
  • 22. Giri A, Ohshima T. Chapter 5—Bioactive Marine Peptides: Nutraceutical Value and Novel Approaches In: Kim S-K, editor. Advances in Food and Nutrition Research. Academic Press; 2012. pp.73–105. Available:http://www.sciencedirect.com/science/article/pii/B9780124160033000056 10.1016/B978-0-12-416003-3.00005-6 [DOI] [PubMed] [Google Scholar]
  • 23. Monroig Ó, Guinot D, Hontoria F, Tocher DR, Navarro JC. Biosynthesis of essential fatty acids in Octopus vulgaris (Cuvier, 1797): Molecular cloning, functional characterisation and tissue distribution of a fatty acyl elongase. Aquaculture. 2012;360–361:45–53. 10.1016/j.aquaculture.2012.07.016 [DOI] [Google Scholar]
  • 24. Reis DB, Acosta NG, Almansa E, Navarro JC, Tocher DR, Monroig Ó, et al. In vivo metabolism of unsaturated fatty acids in Octopus vulgaris hatchlings determined by incubation with 14C-labelled fatty acids added directly to seawater as protein complexes. Aquaculture, 2014;431:28–33. doi.org/10.1016/j [Google Scholar]
  • 25. Li M, Mai K, He G, Ai Q, Zhang W, Xu W, et al. Characterization of two Δ5 fatty acyl desaturases in abalone (Haliotis discus hannai Ino). Aquaculture. 2013;416–417:48–56. 10.1016/j.aquaculture.2013.08.030 [DOI] [Google Scholar]
  • 26. Liu H, Guo Z, Zheng H, Wang S, Wang Y, Liu W, et al. Functional characterization of a Δ5-likefatty acyl desaturase and its expression during early embryogenesis in the noble scallop Chlamys nobilis Reeve. Mol Biol Rep. 2014;41:7437–7445. 10.1007/s11033-014-3633-4 [DOI] [PubMed] [Google Scholar]
  • 27. Liu H, Zheng H, Wang S, Wang Y, Li S, Liu W, et al. Cloning and functional characterization of a polyunsaturated fatty acid elongase in a marine bivalve noble scallop Chlamys nobilis Reeve. Aquaculture. 2013;416–417:146–151. 10.1016/j.aquaculture.2013.09.015 [DOI] [Google Scholar]
  • 28. Ekblom R, Stapley J, Ball AD, Birkhead T, Burke T, Slate J. Genetic mapping of the major histocompatibility complex in the zebra finch (Taeniopygia guttata). Immunogenetics. 2011;63:523–530. 10.1007/s00251-011-0525-9 [DOI] [PubMed] [Google Scholar]
  • 29. Prentis PJ, Pavasovic A. The Anadara trapezia transcriptome: A resource for molluscan physiological genomics. Mar Genomics. 2014;18, Part B: 113–115. 10.1016/j.margen.2014.08.004 [DOI] [PubMed] [Google Scholar]
  • 30. Przeslawski R. Temporal patterns of gastropod egg mass deposition on southeastern Australian shores. Mar Freshwater Res. 2008;59:457–466. doi.org/10.1071/MF07229 [Google Scholar]
  • 31. Saito H, Aono H. Characteristics of lipid and fatty acid of marine gastropod Turbo cornutus: High levels of arachidonic and n-3 docosapentaenoic acid. Food Chem. 2014;145:135–144. 10.1016/j.foodchem.2013.08.011 [DOI] [PubMed] [Google Scholar]
  • 32. Abbas Alkarkhi FM, Ismail N, Easa AM. Assessment of arsenic and heavy metal contents in cockles (Anadara granosa) using multivariate statistical techniques. J Hazard Mater. 2008;150:783–789. 10.1016/j.jhazmat.2007.05.035 [DOI] [PubMed] [Google Scholar]
  • 33. Nell JA, O’Connor WA, Heasman MP, Goard LJ. Hatchery production of the venerid clam Katelysia rhytiphora (Lamy) and the Sydney cockle Anadara trapezia (Deshayes). Aquaculture. 1994;119:149–156. 10.1016/0044-8486(94)90171-6 [DOI] [Google Scholar]
  • 34. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotech. 2011;29:644–652. 10.1038/nbt.1883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Fu L, Niu B, Zhu Z, Wu S, Li W. CD-HIT: accelerated for clustering the next-generation sequencing data. Bioinformatics. 2012;28:3150–3152. 10.1093/bioinformatics/bts565 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Götz S, Arnold R, Sebastián-León P, Martín-Rodríguez S, Tischler P, Jehl M-A, et al. B2G-FAR, a species-centered GO annotation repository. Bioinformatics. 2011;27:919–924. 10.1093/bioinformatics/btr059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. Pfam: the protein families database. Nucleic Acids Res. 2014;42:D222–D230. 10.1093/nar/gkt1223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Cai Y, Luqing P, Fengxiao H, Qian Ji, Tong L. Deep Sequencing-Based Transcriptome Profiling Analysis of Chlamys farreri Exposed to Benzo[a]pyrene. Gene. 2014;551(2):261–70. 10.1016/j.gene.2014.09.003 [DOI] [PubMed] [Google Scholar]
  • 39. Du Xuedi, Li Li, Zhang Shoudu, Meng Fei, and Zhang Guofan. “SNP Identification by Transcriptome Sequencing and Candidate Gene-Based Association Analysis for Heat Tolerance in the Bay Scallop Argopecten irradians .” PLoS ONE 9, no. 8 (August 14, 2014):e104960 10.1371/journal.pone.0104960 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Riesgo A, Andrade SCS, Sharma PP, Novo M, Pérez-Porro AR, Vahtera V, et al. Comparative description of ten transcriptomes of newly sequenced invertebrates and efficiency estimation of genomic sampling in non-model taxa. Frontiers in Zoology. 2012;9:33 10.1186/1742-9994-9-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.ORF Finder—(http://www.ncbi.nlm.nih.gov/gorf/gorf.html)
  • 42. Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. SMART 5: domains in the context of genomes and networks. Nucleic Acids Res. 2006;34:D257–D260. 10.1093/nar/gkj079 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Leonard AE, Pereira SL, Sprecher H, Huang Y-S. Elongation of long-chain fatty acids. Prog Lipid Res. 2004;43:36–54. 10.1016/S0163-7827(03)00040-7 [DOI] [PubMed] [Google Scholar]
  • 44. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001;305:567–580. 10.1006/jmbi.2000.4315 [DOI] [PubMed] [Google Scholar]
  • 45.Ensembl Metazoa database (http://metazoa.ensembl.org/index.html).
  • 46. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Henikoff S, Henikoff JG. Amino acid substitution matrices from protein blocks. Proc Natl Acad Sci U S A. 1992;89:10915–10919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hall, T. (2005). BioEdit v. 7.0.5: Biological sequence alignment editor for Windows. Ibis Therapeutics a Division of Isis Pharmaceuticals. Retrieved from http://www.mbio.ncsu.edu/BioEdit/bioedit.html
  • 49. Notredame C, Higgins DG, Heringa J. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol. 2000;302:205–217. 10.1006/jmbi.2000.4042 [DOI] [PubMed] [Google Scholar]
  • 50. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 2013;30:2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Prentis PJ, Woolfit M, Thomas-Hall SR, Daniel Ortiz-Barrientos, Pavasovic A, Lowe AJ, et al. Massively parallel sequencing and analysis of expressed sequence tags in a successful invasive plant. Ann Bot. 2010; mcq201. 10.1093/aob/mcq201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Liu H, Zhang H, Zheng H, Wang S, Guo Z, Zhang G. PUFA Biosynthesis Pathway in Marine Scallop Chlamys nobilis Reeve. J Agricult Food Chem. 2014;62(51):12384–12391. doi.org/10.1021/jf504648f [DOI] [PubMed] [Google Scholar]
  • 53. Stoger I, Sigwart JD, Kano Y, Knebelsberger T, Marshall BA, et al. The Continuing Debate on Deep Molluscan Phylogeny: Evidence for Serialia (Mollusca, Monoplacophora. BioMed Research International. 2013;2013:e407072 10.1155/2013/407072 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Castro LFC, Monroig Ó, Leaver MJ, Wilson J, Cunha I, Tocher DR. Functional desaturase Fads1 (Δ5) and Fads2 (Δ6) orthologues evolved before the origin of jawed vertebrates. PLoS ONE. 2012;7:e31950 10.1371/journal.pone.0031950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Monroig Ó, Zheng X, Morais S, Leaver MJ, Taggart JB, Tocher DR. Multiple genes for functional 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation. Biochim Biophys Acta. 2010;1801:1072–1081. 10.1016/j.bbalip.2010.04.007 [DOI] [PubMed] [Google Scholar]
  • 56. Saito H, Marty Y. High levels of icosapentaenoic acid in the lipids of oyster Crassostrea gigas ranging over both Japan and France. J Oleo Sci. 2010;59:281–292. [DOI] [PubMed] [Google Scholar]
  • 57. Waldock MJ, Holland DL. Fatty acid metabolism in young oysters, Crassostrea gigas: Polyunsaturated fatty acids. Lipids. 1984;19:332–336. 10.1007/BF02534783 [DOI] [Google Scholar]
  • 58. Monroig Ó, Wang S, Zhang L, You C, Tocher DR, Li Y. Elongation of long-chain fatty acids in rabbitfish Siganus canaliculatus: Cloning, functional characterisation and tissue distribution of Elovl5-and Elovl4-like elongases. Aquaculture. 2012;350–353:63–70. 10.1016/j.aquaculture.2012.04.017 [DOI] [Google Scholar]
  • 59. Carmona-Antoñanzas G, Tocher DR, Taggart JB, Leaver MJ. An evolutionary perspective on Elovl5 fatty acid elongase: comparison of Northern pike and duplicated paralogs from Atlantic salmon . BMC Evolutionary Biology. 2013;13:85 10.1186/1471-2148-13-85 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Helm RR, Siebert S, Tulin S, Smith J, Dunn CW. Characterization of differential transcript abundance through time during Nematostella vectensis development. BMC Genomics. 2013;14:266 10.1186/1471-2164-14-266 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All validated sequences are available from the NCBI GenBank database (accession KR154727, KR154728, KR154729).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES