Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Sep 1.
Published in final edited form as: Fungal Genet Biol. 2015 Jun 24;82:51–55. doi: 10.1016/j.fgb.2015.06.005

The Aspergillus nidulans bimC4 mutation provides an excellent tool for identification of kinesin-14 inhibitors

Betsy Wang 1,2, Kristin Li 1,3, Max Jin 1,4, Rongde Qiu 1, Bo Liu 5, Berl R Oakley 6, Xin Xiang 1
PMCID: PMC4554971  NIHMSID: NIHMS705401  PMID: 26117688

Abstract

Centrosome amplification is a hallmark of many types of cancer cells, and clustering of multiple centrosomes is critical for cancer cell survival and proliferation. Human kinesin-14 HSET/KFIC1 is essential for centrosome clustering, and its inhibition leads to the specific killing of cancer cells with extra centrosomes. Since kinesin-14 motor domains are conserved evolutionarily, we conceived a strategy of obtaining kinesin-14 inhibitors using Aspergillus nidulans, based on the previous result that loss of the kinesin-14 KlpA rescues the non-viability of the bimC4 kinesin-5 mutant at 42°C. However, it was unclear whether alteration of BimC or any other non-KlpA protein would be a major factor reversing the lethality of the bimC4 mutant. Here we performed a genome-wide screen for bimC4 suppressors and obtained fifteen suppressor strains. None of the suppressor mutations maps to bimC. The vast majority of them contain mutations in the klpA gene, most of which are missense mutations affecting the C-terminal motor domain. Our study confirms that the bimC4 mutant is suitable for a cell-based screen for chemical inhibitors of kinesin-14. Since the selection is based on enhanced growth rather than diminished growth, cytotoxic compounds can be excluded.

Keywords: kinesin-14, kinesin-5, Aspergillus nidulans, suppressor mutations, cancer-drug screening

1. Introduction

The cancer cell-specific centrosome clustering process has recently emerged as a target for potential anti-cancer drugs (Korzeniewski et al., 2013). Centrosome amplification, i.e., an abnormal increase in centrosome numbers, is a hallmark of many types of cancer cells, and it has also been associated with cancer aggressiveness (Brinkley, 2001; Marx, 2001; Pihan et al., 2001; D’Assoro et al., 2002a; D’Assoro et al., 2002b; Pihan et al., 2003; Ogden et al., 2013; Godinho and Pellman, 2014; Godinho et al., 2014). Cancer cells with supernumerary centrosomes almost always undergo a process in which centrosomes are clustered into two poles before mitosis for bipolar cell division, which is critical for cancer cell proliferation yet causes chromosomal segregation errors that subsequently lead to more mutations (Gergely and Basto, 2008; Ganem et al., 2009; Crasta et al., 2012; Zhang et al., 2015). A protein essential for centrosome clustering is HSET (also known as KIFC1), a minus-end-directed microtubule motor that belongs to the kinesin-14 family (Kwon et al., 2008). Importantly, as HSET is not essential for proliferation of normal cells with two centrosomes, HSET RNAi specifically kills cancer cells with extra centrosomes (Kwon et al., 2008). Small-molecule inhibitors of HSET/KIFC1 have been recently found using enzyme activity-based screens and iterative cycles of medicinal chemistry (Watts et al., 2013; Wu et al., 2013; Yang et al., 2014). However, their clinical efficacy has not been evaluated, and the possibility of off-target cytotoxicity has not been eliminated.

We have conceived a cell-based screening strategy using Aspergillus nidulans for obtaining non-cytotoxic kinesin-14 inhibitors. This is based on the notion that loss of kinesin-14 KlpA function in A. nidulans partially rescues the non-viability of the temperature-sensitive (ts) bimC4 mutant of kinesin-5 (O’Connell et al., 1993). As first revealed in Saccharomyces cerevisiae, the microtubule minus-end-directed kinesin-14 antagonizes the plus-end-directed kinesin-5 during mitotic spindle assembly (Saunders and Hoyt, 1992). While loss of kinesin-5 causes a collapse of the bipolar spindle, leading to monopolar spindle formation, mitotic failure and cell death, loss of kinesin-14 attenuates these defects (Saunders and Hoyt, 1992; O’Connell et al., 1993; Mountain et al., 1999; Wu et al., 2013). Functions of these mitotic kinesins are highly conserved evolutionarily from fungi to humans. In fact, the function of kinesin-5 in mitosis was first discovered in A. nidulans based on the genetic study on the bimC4 ts mutant (Enos and Morris, 1990). In A. nidulans, the kinesin-14 KlpA is not essential for mitosis and its loss partially suppresses the lethality of the bimC4 mutant at 42°C (O’Connell et al., 1993; Prigozhina et al., 2001). Thus, kinesin-14 inhibitors can be identified based on their ability to allow the bimC4 mutant to grow at 42°C. Because the motor domains of kinesin-14s are highly conserved evolutionarily, we believe that a cell-based high-throughput screen using the bimC4 mutant will be an ideal way of obtaining kinesin-14 inhibitors. Since the selection will be made based on enhanced growth rather than diminished growth, cytotoxic compounds would be excluded.

In order to use the bimC4 mutant for kinesin-14 inhibitor screening, it is important to know if factors affecting BimC itself or other non-KlpA motor proteins could also reverse the growth defect of the bimC4 mutant. The nature of the bimC4 mutation is not known, however, because bimC4 is a ts mutant that grows normally at the permissive temperature of 32°C, the mutant protein must be made and functional at 32°C. Thus, it is possible that factors affecting the folding or the function of the BimC protein may result in reversion of bimC4 lethality at 42°C, which would make the bimC4-based screen less effective. To address this possibility, we performed a genome-wide screen for genetic suppressors that allowed the bimC4 mutant to grow at 42°C. Our result shows that no bimC4 intragenic suppressor was found, and importantly, the vast majority of suppressors contain a KlpA kinesin-14 mutation, with many of them consisting of missense mutations affecting the conserved C-terminal motor domain. Our study further supports the idea that the bimC4 mutant is ideal for a high-throughput screen for inhibitors of kinesin-14.

2. Materials and Methods

2.1 A. nidulans strains, media, mutagenesis and genetic crosses

We first crossed the LBA44 strain (bimC4; alcA(p)::GFP-tubA::pyr4; pyroA4; pyrG89; wA2) with XX222 (GFP-nudAHC; argB2::[argB*-alcAp::mCherry-RabA]; pantoB100; yA2) (Abenza et al., 2009; Zhang et al., 2010) to generate the XX315 strain (bimC4; alcA(p)::GFP-tubA::pyr4; argB2::[argB*-alcAp::mCherry-RabA]; pyroA4, yA2; possibly GFP-nudAHC). XX315 was used for mutagenesis, and thus, all the original bimC4 suppressor strains were all derived from XX315. UV mutagenesis on spores of A. nidulans strains was done as previously described (Willins et al., 1995; Xiang et al., 1999). The mutagenized spores were plated out on YAG (yeast extract + agar + glucose) rich medium and incubated at 42°C for 3–4 days. For genetic analyses of the suppressor mutations, the original suppressors were crossed to a strain containing wild-type bimC (HookA-GFP-AfpyrG; argB2::[argB*-alcAp::mCherry-RabA]; pabaA1; possibly ΔnkuA::argB; possibly pyrG89) (Zhang et al., 2014). Sexual spores from the crosses were plated out on minimal medium and each progeny was replica plated at 32°C and 42°C on YAG medium. The appearance of the non-viable bimC4-like progeny at 42°C indicates that the suppressor mutation is not linked to the bimC gene. To determine if the suppressor mutations were genetically linked to klpA, we crossed the original suppressor (sbc#/bimC4) strains with the MO61 strain containing the ΔklpA allele (ΔklpA-pyr4 or klpA1; argB2; nicA2; pabaA1) (O’Connell et al., 1993). Sexual spores from the crosses were plated out on YAG + Arginine medium and colonies at 32°C were point-inoculated on the same medium to be incubated at 42°C. The appearance of any non-viable bimC4-like progeny at 42°C would suggest that the suppressor mutation is not in the klpA gene.

2.2 Genomic DNA preparation, PCR and sequencing analysis

Genomic DNA was prepared using the Dneasy Plant Mini Kit from Qiagen, Inc. (Valencia, CA, USA). The AccuPrime™ Taq DNA Polymerase from Invitrogen™- Life Technologies, Inc. (Grand Island, NY, USA) was used for polymerase chain reactions (PCRs) to generate the ~3 kb genomic DNA template from each suppressor strain. The set of primers used for PCR were KLPAF1 (ACCTCACATCATTCGCATAC) + KLPAR1 (GTGACTGGAGTCTAAACATCAC), or KLPAF0 (AAAGATAGCTCCCCCACTC) + KLPAR0 (GCAACATCTCCAAAAGACAG). For sequencing, we used these primers plus two other primers, KLPAF2 (CGTTCCCTGGTGAAATTAT) and KLPAF3 (GGAACGAAAGAACACCAATA). Sequencing was done using the DNA sequencing service of Quintara Biosciences (Allston, MA, USA). Analyses on the sequencing results were done using MacVector 11.0.4 (MacVector, Inc. Cary, NC, USA).

3. Results

3.1 Fifteen bimC4 suppressors were obtained

To obtain bimC4 suppressor mutations, we first collected asexual spores of the bimC4 mutant grown at the permissive temperature of 32°C. We performed UV mutagenesis on the spores and spread them on solid medium at the restrictive temperature of 42°C. After 3–4 days, we selected colonies and inoculated them on new plates that were incubated at 42°C for 3 days. None of the colonies formed at 42°C had asexual spores, suggesting that the suppression is partial, which is similar to that caused by deletion of klpA. The new colonies were selected and inoculated at the permissive temperature of 32°C to allow formation of healthy colonies with asexual spores. To confirm the suppressor phenotype, we inoculated the spores onto plates and incubated them at 42°C for one more round of testing. Only those strains that formed colonies again at 42°C were kept for further analyses. During these experiments, we also obtained several spontaneous suppressors that formed colonies at 42°C without going through UV mutagenesis. These were tested for stability the same way as for the UV-generated suppressors, and then the two classes were combined for further analyses. At this stage, we collected a total of 15 suppressor strains, and they are named as sbc1/bimC4, sbc2/bimC4, etc. (sbc stands for suppressor of bimC4). The colony phenotypes of the strains are shown in Figure 1.

Figure 1.

Figure 1

Colony phenotypes of the bimC4 suppressors at 32°C (permissive temperature for bimC4) and 42°C (restrictive temperature for bimC4). The strains were grown for 2 days on YAG plates. Every suppressor strain contains the bimC4 mutation plus the sbc (suppressor of bimC4) mutation but labeled only with a number for simplicity (the number corresponds to the sbc number). At 32°C, the bimC4 mutant grows as well as the wild-type control. At 42°C, the bimC4 mutant is not viable. The sbc mutations made the bimC4 mutant viable so that the suppressors strains formed small colonies. All the original suppressor strains are shown except for 4 and 20, which were progeny from a cross. The extent of growth shown here does not necessarily indicates the strength of suppression because an original suppressor strain may contain other non-related mutations that affect growth.

3.2 None of the suppressor mutations is in bimC

Our genetic analysis on these strains was first focused on testing whether any of them represents an intragenic suppressor, which contains a bimC mutation compensating for the structural/functional defect caused by the bimC4 mutation. To do this, we crossed every sbc#/bimC4 (# indicates a sbc number such as 1 and 2) strain to another strain containing the wild-type bimC gene. We reasoned that if the suppressor mutation is in bimC, then we should not obtain any progeny with a bimC4 phenotype at 42°C. However, every cross produced progeny with a bimC4 phenotype. Thus, none of the suppressor mutations is in the bimC gene. From every cross, we were also able to see a class of progeny that grew like the original suppressor strains, and these should have the genotype of sbc#/bimC4. For sequencing analysis, we used these progeny instead of the original suppressor strains.

3.3 Thirteen out of the fifteen suppressor strains contain mutations in the klpA gene

Since klpA deletion suppresses the bimC4 lethality, it is possible that null or loss-of-function mutations in klpA can be isolated by this method. Thus, we directly tested if the suppressor strains carry any mutation in the klpA gene. Specifically, we amplified klpA genomic DNA in the suppressor strains with high-fidelity polymerase for sequencing analysis. From fourteen out of fifteen sbc#/bimC4 strains, we were able to amplify the ~3 kb klpA genomic DNA. However, we were not able to obtain any PCR product from the sbc3/bimC4 strain, although several different sets of primers were tried on more than one DNA preparation, and this strain was not included in further sequencing analysis. It remains possible that the klpA locus may be grossly altered in this strain, and our genetic analysis result is consistent with the possibility that the suppression-causing mutation is linked to klpA. Specifically, not a single progeny with a bimC4 phenotype was found after we analyzed more than 80 progenies from a cross between the original sbc3/bimC4 strain and a ΔklpA strain.

For the other fourteen sbc#/bimC4 strains, we performed sequencing analysis of the ~3 kb klpA genomic DNA. Our results show that 13 suppressors contain a mutation in the KlpA-coding region. Except for the sbc1/bimC4 strain that contains a deletion of nucleotide G causing a frame shift after aa164 of KlpA, all other 12 strains contain mutations around the region encoding the KlpA C-terminal motor domain. The nucleotide changes in sbc2, sbc4, sbc7, sbc8, sbc9, sbc15, sbc17, sbc20 and sbc22 cause missense mutations affecting the motor domain. Specifically, they are R408W (sbc15), T431K (sbc4), I455S (sbc9), F466S (sbc17), I510N (sbc8), L566S (sbc7), T598G (sbc22), L667P (sbc20) and L687P (sbc2) (Figure 2). In addition, the sbc16/bimC4 strain contains a nonsense mutation, K548Stop, which deletes the C-terminal motor domain of KlpA. This demonstrates that null or loss-of-function mutation of klpA can be identified from this genetic screen. The sbc10/bimC4 and sbc18/bimC4 strains contain exactly the same mutation in klpA, an insertion of a nucleotide G that causes a frame shift after aa753. One possibility we cannot rule out is that the same original suppressor might have been picked twice from the original plate after mutagenesis and treated as different strains. It is interesting to point out that aa753 is only 18 amino acids away from the Stop codon, and the mutation changes VHNTHIGTAKKQTRVRDVStop to GTQHSHWNREETDPCPStop. While the amino acids affected could be specifically required for KlpA function, the possibility that they affect the overall folding/stability of KlpA is not excluded.

Figure 2.

Figure 2

Positions of the amino acids that are mutated in the bimC4 suppressor mutants. A sequence alignment of the motor domain of A. nidulans KlpA (accession CAA45887) with that of human HSET/KIFC1 (Q9BW19) is shown. The alignment was done using CLUSTALW. Residues that are identical (*), strongly similar (:) or weakly similar (.) are shown as red, green and blue letters, respectively. Note that the amino acids mutated are either highly conserved (identical or highly similar) or right next to a highly conserved amino acid.

While we have not transformed any mutation-containing klpA genomic fragment into a bimC4 mutant to directly demonstrate suppression caused by the klpA mutation, our genetic analyses on several suppressor strains including sbc10/bimC4 and sbc16/bimC4 are consistent with suppression being caused by the klpA mutations. Specifically, not a single progeny with a bimC4 phenotype was found after we analyzed more than 100 progenies from a cross between a ΔklpA strain and an sbc10/bimC4 or an sbc16/bimC4 strain.

The sbc23/bimC4 strain is the only strain that does not contain any mutation in the KlpA-coding region or in introns of the klpA gene. To confirm this result, we performed the sequencing analyses on both the original suppressor and the sbc23/bimC4 progeny from the cross between the original suppressor and a wild type strain. The results of these analyses further confirmed that the sbc23 mutation is not in the KLPA-coding region or in introns of the klpA gene. We also analyzed a cross between the original sbc23/bimC4 strain and a ΔklpA strain and found four bimC4-like progeny among 75 analyzed progeny, consistent with the idea that the sbc23 mutation is not linked to klpA. However, as sbc23 is a very weak suppressor (Figure 1) and the sbc23/bimC4 strain is only slightly bigger than the bimC4 mutant, further work will be needed to confirm this conclusion.

4. Discussion

In this work, we provided data to suggest that rescue of the bimC4 lethality is mainly achieved via mutations in klpA, the only kinesin-14-encoding gene in A. nidulans. Although the bimC4 mutation has not been fully characterized, its temperature-sensitive nature suggests that the full-length protein can be made and therefore it is possible that an alteration of BimC itself may compensate for the defect caused by the bimC4 mutation. Our study, however, indicates that the chance of this happening would be low based on the fact that none of the suppressor mutations we obtained is in the bimC gene itself. This result supports the notion that the bimC4 mutant is an excellent tool for identifying kinesin-14 inhibitors.

Our identification of the klpA kinesin-14 mutations from the genetic screen is consistent with previous data from S. cerevisiae (Hoyt et al, 1993). In S. cerevisiae, there are two kinesin-5-encoding genes, Kip1 and Cin8, which play redundant roles (Hoyt et al., 1992). A suppressor screen using a double mutant containing kip1Δ and a cin8 ts mutation yielded seven suppressor strains all containing missense mutations affecting the C-terminal motor domain of the kinesin-14 Kar3 (Hoyt et al., 1993). It is possible that kinesin-14 may have positive regulators in vivo. In S. cerevisiae, the kinesin-14 Kar3 (Meluh and Rose, 1990) has two light chains, Vik1 and Cik1 (Sproul et al., 2005; Allingham et al., 2007), which play distinct roles in regulating Kar3 function during vegetative growth and mating, respectively (Page et al., 1994; Manning et al., 1999). However, these two light chains are not present in higher eukaryotes and not in A. nidulans either. In theory, if there exists a protein specifically required for KlpA function, our genetic screen may discover such a protein. However, if the gene encoding such a protein is of small size or if there is another gene playing a redundant role, the probability of getting a mutation in the gene during UV mutagenesis would be low. This notion is consistent with previous data from S. cerevisiae in which a screen for kinesin-5 suppressors yielded seven missense mutations in Kar3 but not in the Vik1 gene (Hoyt et al., 1993), although vik1Δ also suppresses the lethality of the kip1Δ/cin8ts double mutations (Manning et al., 1999). In this current study, we have found a suppressor mutation (sbc23) possibly unlinked to klpA, which may suggest the existence of a regulator, but future work will be needed to confirm this notion. Nevertheless, regardless of the identity of any positive regulator, if such a regulator is essential for kinesin-14 function, its inhibitors should be just as useful as kinesin-14 inhibitors. Thus, the bimC4-based kinesin-14 inhibitor screen we have conceived is more inclusive than the enzyme-based screen because inhibitors of the potential regulators may also be obtained.

We are aware that during the proposed inhibitor screen, some chemicals acting on targets other than kinesin-14 (or its potential regulators) may still be obtained, and thus, a secondary screen would be necessary. It is worth pointing out that while ΔklpA has no obvious colony phenotype, specific A. nidulans γ-tubulin mutants have been found to be synthetically lethal with ΔklpA (Prigozhina et al, 2001), a result similarly obtained in Schizosaccharomyces pombe (Paluh et al., 2000). Thus, kinesin-14 inhibitors obtained from the bimC4-based screen should be tested in these γ-tubulin mutants to determine if they specifically kill the mutants but not wild-type strains. Ultimately, any candidate kinesin-14 inhibitors will need to be tested using mammalian cells with and without extra centrosomes to determine if they inhibit the function of HSET/KIFC1 (Kwon et al., 2008). Because the motor domain of KlpA shows a high degree of sequence similarity to that of HSET/KIFC1 (Figure 2), we believe that the A. nidulans-based screen should obtain inhibitors of HSET/KIFC1. Alternatively, one can introduce the human HSET/KIFC1 gene into A. nidulans, and if it can functionally substitute for klpA, a bimC4 mutant containing this human gene would be ideally suited for directly identifying HSET/KIFC1 inhibitors. A. nidulans is a well established genetic system for studying mitosis and microtubule motors in general (Morris, 1975; Enos and Morris, 1990; O’Connell et al., 1993; Oakley, 2004; Osmani and Mirabito, 2004; Xiang and Fischer, 2004; Peñalva et al., 2012; Pantazopoulou et al., 2014; Steinberg, 2014; Egan et al., 2015; Xiang et al., 2015) and A. nidulans-based drug screening has been performed previously (Kiso et al., 2004; Mircus et al., 2009; Zhai et al., 2010), further supporting the feasibility of our proposed kinesin-14 inhibitor screen.

Highlights.

  • A genome-wide screen for bimC4 suppressors was performed.

  • None of the fifteen suppressor mutations was intragenic at the bimC locus.

  • Most mutations were in the conserved C-terminal motor domain of KlpA (kinesin-14).

  • The bimC4 mutant can be used for a cell-based screen for kinesin-14 inhibitors.

Acknowledgments

We thank Dr. David Pellman for helpful discussions and suggestions on the proposed inhibitor-screening strategy. We thank Dr. Jun Zhang for providing the initial student training on molecular techniques and Ms. Elizabeth Oakley for sending us the klpA deletion strain used in this work. We also thank the USU Summer Research Training Program organizers, especially Drs. Rachel Cox and Frank Shewmaker, for organizing high-school research activities. This work was supported by the National Institutes of Health grant RO1 GM097580 (to X.X.) and a Uniformed Services University intramural grant (to X.X.).

Abbreviations

bim

blocked in mitosis

klp

kinesin-like protein

sbc

suppressor of bimC4

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abenza JF, et al. Long-distance movement of Aspergillus nidulans early endosomes on microtubule tracks. Traffic. 2009;10:57–75. doi: 10.1111/j.1600-0854.2008.00848.x. [DOI] [PubMed] [Google Scholar]
  2. Allingham JS, et al. Vik1 modulates microtubule-Kar3 interactions through a motor domain that lacks an active site. Cell. 2007;128:1161–72. doi: 10.1016/j.cell.2006.12.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brinkley BR. Managing the centrosome numbers game: from chaos to stability in cancer cell division. Trends Cell Biol. 2001;11:18–21. doi: 10.1016/s0962-8924(00)01872-9. [DOI] [PubMed] [Google Scholar]
  4. Crasta K, et al. DNA breaks and chromosome pulverization from errors in mitosis. Nature. 2012;482:53–8. doi: 10.1038/nature10802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. D’Assoro AB, et al. Amplified centrosomes in breast cancer: a potential indicator of tumor aggressiveness. Breast Cancer Res Treat. 2002a;75:25–34. doi: 10.1023/a:1016550619925. [DOI] [PubMed] [Google Scholar]
  6. D’Assoro AB, et al. Centrosome amplification and the development of cancer. Oncogene. 2002b;21:6146–53. doi: 10.1038/sj.onc.1205772. [DOI] [PubMed] [Google Scholar]
  7. Egan MJ, et al. Cytoplasmic Dynein Is Required for the Spatial Organization of Protein Aggregates in Filamentous Fungi. Cell Rep. 2015;11:201–9. doi: 10.1016/j.celrep.2015.03.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Enos AP, Morris NR. Mutation of a gene that encodes a kinesin-like protein blocks nuclear division in A. nidulans. Cell. 1990;60:1019–27. doi: 10.1016/0092-8674(90)90350-n. [DOI] [PubMed] [Google Scholar]
  9. Ganem NJ, et al. A mechanism linking extra centrosomes to chromosomal instability. Nature. 2009;460:278–82. doi: 10.1038/nature08136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gergely F, Basto R. Multiple centrosomes: together they stand, divided they fall. Genes Dev. 2008;22:2291–6. doi: 10.1101/gad.1715208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Godinho SA, Pellman D. Causes and consequences of centrosome abnormalities in cancer. Philos Trans R Soc Lond B Biol Sci. 2014;369 doi: 10.1098/rstb.2013.0467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Godinho SA, et al. Oncogene-like induction of cellular invasion from centrosome amplification. Nature. 2014;510:167–71. doi: 10.1038/nature13277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hoyt MA, et al. Two Saccharomyces cerevisiae kinesin-related gene products required for mitotic spindle assembly. J Cell Biol. 1992;118:109–20. doi: 10.1083/jcb.118.1.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hoyt MA, et al. Loss of function of Saccharomyces cerevisiae kinesin-related CIN8 and KIP1 is suppressed by KAR3 motor domain mutations. Genetics. 1993;135:35–44. doi: 10.1093/genetics/135.1.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kiso T, et al. Screening for microtubule-disrupting antifungal agents by using a mitotic-arrest mutant of Aspergillus nidulans and novel action of phenylalanine derivatives accompanying tubulin loss. Antimicrob Agents Chemother. 2004;48:1739–48. doi: 10.1128/AAC.48.5.1739-1748.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Korzeniewski N, et al. The centrosome as potential target for cancer therapy and prevention. Expert Opin Ther Targets. 2013;17:43–52. doi: 10.1517/14728222.2013.731396. [DOI] [PubMed] [Google Scholar]
  17. Kwon M, et al. Mechanisms to suppress multipolar divisions in cancer cells with extra centrosomes. Genes Dev. 2008;22:2189–203. doi: 10.1101/gad.1700908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Manning BD, et al. Differential regulation of the Kar3p kinesin-related protein by two associated proteins, Cik1p and Vik1p. J Cell Biol. 1999;144:1219–33. doi: 10.1083/jcb.144.6.1219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Marx J. Cell biology. Do centrosome abnormalities lead to cancer? Science. 2001;292:426–9. doi: 10.1126/science.292.5516.426. [DOI] [PubMed] [Google Scholar]
  20. Meluh PB, Rose MD. KAR3, a kinesin-related gene required for yeast nuclear fusion. Cell. 1990;60:1029–41. doi: 10.1016/0092-8674(90)90351-e. [DOI] [PubMed] [Google Scholar]
  21. Mircus G, et al. Identification of novel cell wall destabilizing antifungal compounds using a conditional Aspergillus nidulans protein kinase C mutant. J Antimicrob Chemother. 2009;64:755–63. doi: 10.1093/jac/dkp270. [DOI] [PubMed] [Google Scholar]
  22. Morris NR. Mitotic mutants of Aspergillus nidulans. Genet Res. 1975;26:237–54. doi: 10.1017/s0016672300016049. [DOI] [PubMed] [Google Scholar]
  23. Mountain V, et al. The kinesin-related protein, HSET, opposes the activity of Eg5 and cross-links microtubules in the mammalian mitotic spindle. J Cell Biol. 1999;147:351–66. doi: 10.1083/jcb.147.2.351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. O’Connell MJ, et al. Suppression of the bimC4 mitotic spindle defect by deletion of klpA, a gene encoding a KAR3-related kinesin-like protein in Aspergillus nidulans. J Cell Biol. 1993;120:153–62. doi: 10.1083/jcb.120.1.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Oakley BR. Tubulins in Aspergillus nidulans. Fungal Genet Biol. 2004;41:420–7. doi: 10.1016/j.fgb.2003.11.013. [DOI] [PubMed] [Google Scholar]
  26. Ogden A, et al. Heading off with the herd: how cancer cells might maneuver supernumerary centrosomes for directional migration. Cancer Metastasis Rev. 2013;32:269–87. doi: 10.1007/s10555-012-9413-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Osmani SA, Mirabito PM. The early impact of genetics on our understanding of cell cycle regulation in Aspergillus nidulans. Fungal Genet Biol. 2004;41:401–10. doi: 10.1016/j.fgb.2003.11.009. [DOI] [PubMed] [Google Scholar]
  28. Page BD, et al. Localization of the Kar3 kinesin heavy chain-related protein requires the Cik1 interacting protein. J Cell Biol. 1994;124:507–19. doi: 10.1083/jcb.124.4.507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Paluh JL, et al. A mutation in gamma-tubulin alters microtubule dynamics and organization and is synthetically lethal with the kinesin-like protein pkl1p. Mol Biol Cell. 2000;11:1225–39. doi: 10.1091/mbc.11.4.1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pantazopoulou A, et al. Maturation of late Golgi cisternae into RabE(RAB11) exocytic post-Golgi carriers visualized in vivo. Mol Biol Cell. 2014;25:2428–43. doi: 10.1091/mbc.E14-02-0710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Peñalva MA, et al. Searching for gold beyond mitosis: Mining intracellular membrane traffic in Aspergillus nidulans. Cell Logist. 2012;2:2–14. doi: 10.4161/cl.19304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pihan GA, et al. Centrosome defects can account for cellular and genetic changes that characterize prostate cancer progression. Cancer Res. 2001;61:2212–9. [PubMed] [Google Scholar]
  33. Pihan GA, et al. Centrosome abnormalities and chromosome instability occur together in pre-invasive carcinomas. Cancer Res. 2003;63:1398–404. [PubMed] [Google Scholar]
  34. Prigozhina NL, et al. Gamma-tubulin and the C-terminal motor domain kinesin-like protein, KLPA, function in the establishment of spindle bipolarity in Aspergillus nidulans. Mol Biol Cell. 2001;12:3161–74. doi: 10.1091/mbc.12.10.3161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Saunders WS, Hoyt MA. Kinesin-related proteins required for structural integrity of the mitotic spindle. Cell. 1992;70:451–8. doi: 10.1016/0092-8674(92)90169-d. [DOI] [PubMed] [Google Scholar]
  36. Sproul LR, et al. Cik1 targets the minus-end kinesin depolymerase kar3 to microtubule plus ends. Curr Biol. 2005;15:1420–7. doi: 10.1016/j.cub.2005.06.066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Steinberg G. Endocytosis and early endosome motility in filamentous fungi. Curr Opin Microbiol. 2014;20:10–8. doi: 10.1016/j.mib.2014.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Watts CA, et al. Design, synthesis, and biological evaluation of an allosteric inhibitor of HSET that targets cancer cells with supernumerary centrosomes. Chem Biol. 2013;20:1399–410. doi: 10.1016/j.chembiol.2013.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Willins DA, et al. An alpha tubulin mutation suppresses nuclear migration mutations in Aspergillus nidulans. Genetics. 1995;141:1287–98. doi: 10.1093/genetics/141.4.1287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wu J, et al. Discovery and Mechanistic Study of a Small Molecule Inhibitor for Motor Protein KIFC1. ACS Chem Biol. 2013 doi: 10.1021/cb400186w. [DOI] [PubMed] [Google Scholar]
  41. Xiang X, Fischer R. Nuclear migration and positioning in filamentous fungi. Fungal Genet Biol. 2004;41:411–9. doi: 10.1016/j.fgb.2003.11.010. [DOI] [PubMed] [Google Scholar]
  42. Xiang X, et al. Cytoplasmic dynein and early endosome transport. Cell Mol Life Sci. 2015 doi: 10.1007/s00018-015-1926-y. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Xiang X, et al. Isolation of a new set of Aspergillus nidulans mutants defective in nuclear migration. Curr Genet. 1999;35:626–30. doi: 10.1007/s002940050461. [DOI] [PubMed] [Google Scholar]
  44. Yang B, et al. Discovery of potent KIFC1 inhibitors using a method of integrated high-throughput synthesis and screening. J Med Chem. 2014;57:9958–70. doi: 10.1021/jm501179r. [DOI] [PubMed] [Google Scholar]
  45. Zhai B, et al. Polymyxin B, in combination with fluconazole, exerts a potent fungicidal effect. J Antimicrob Chemother. 2010;65:931–8. doi: 10.1093/jac/dkq046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang CZ, et al. Chromothripsis from DNA damage in micronuclei. Nature. 2015;522:179–84. doi: 10.1038/nature14493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang J, et al. HookA is a novel dynein-early endosome linker critical for cargo movement in vivo. J Cell Biol. 2014;204:1009–26. doi: 10.1083/jcb.201308009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhang J, et al. The microtubule plus-end localization of Aspergillus dynein is important for dynein-early-endosome interaction but not for dynein ATPase activation. J Cell Sci. 2010;123:3596–604. doi: 10.1242/jcs.075259. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES