Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2015 Jul 1;181(3):511–517. doi: 10.1111/cei.12650

Real-time quantitative reverse transcription–polymerase chain reaction to detect propionibacterial ribosomal RNA in the lymph nodes of Chinese patients with sarcoidosis

Y Zhou *,1, Y-R Wei *,1, Y Zhang *, S-S Du *, R P Baughman †, H-P Li *
PMCID: PMC4557386  PMID: 25959360

Abstract

The aim of this study was to investigate the diagnostic value of using the copy number of propionibacterial rRNA as a biomarker for sarcoidosis. Ribosomal RNA of Propionibacterium acnes and P. granulosum was measured by real-time quantitative reverse transcription–polymerase chain reaction (RT–PCR) using formalin-fixed and paraffin-embedded tissue of lymph node biopsy from 65 Chinese patients with sarcoidosis, 45 with tuberculosis and 50 controls with other diseases (23 with non-specific lymphadenitis and 27 with mediastinal lymph node metastasis from lung cancer). The receiver operating characteristic (ROC) curve was analysed to determine an optimal cut-off value for diagnosis, and the diagnostic accuracy of the cut-off value was evaluated in additional tissue samples [24 patients with sarcoidosis and 22 with tuberculosis (TB)]. P. acnes or P. granulosum rRNA was detected in 48 of the 65 sarcoidosis samples but only in four of the 45 TB samples and three of the 50 control samples. Analysis of the ROC curve revealed that an optimal cut-off value of the copy number of propionibacterial rRNA for diagnosis of sarcoidosis was 50·5 copies/ml with a sensitivity and specificity of 73·8 and 92·6%, respectively. Based on the cut-off value, 19 of the 24 additional sarcoidosis samples exhibited positive P. acnes or P. granulosum, whereas only one of the 22 additional TB samples was positive, resulting in a sensitivity and specificity of 79·2 and 95·5%, respectively. These findings suggest that propionibacteria might be associated with sarcoidosis granulomatous inflammation. Detection of propionibacterial rRNA by RT–PCR might possibly distinguish sarcoidosis from TB.

Keywords: diagnosis, propionibacterium acnes, propionibacterium granulosum, real-time quantitative reverse transcription–polymerase chain reaction, sarcoidosis

Introduction

Sarcoidosis is a systemic disease characterized by the formation of non-caseating epithelioid cell granulomas in multiple organs. The aetiology of sarcoidosis is still elusive. It has been suggested that exposure of genetically predisposed hosts to certain environmental agents might trigger excessive inflammatory immune responses in the hosts, consequently resulting in granuloma formation and sarcoidosis [1–3]. Environmental agents possibly contributing to sarcoidosis development include propionibacterium, mycobacterium, musty odours, insecticides or hazardous metal industry wastes [4]. Because of the clinical, histological and immunological similarities between tuberculosis (TB) and sarcoidosis, Mycobacterium tuberculosis (Mtb) has been suspected as one of the pathogens causing sarcoidosis. However, a consensus of the association between Mtb and sarcoidosis has not been reached in the medical community. Some reports have suggested that Mtb could be related to sarcoidosis development [5–8], whereas others have opposed the opinion [9–11]. Our previous study suggests that Mtb was unlikely to be a pathogenic bacterium for sarcoidosis [12].

Propionibacterium species including P. acnes and P. granulosum are micro-aerophilic, non-sporulating, pleomorphic and Gram-positive coccobacilli that reside commonly on human skin. P. acnes has been indicated to relate to sarcoidosis development. Abe et al. isolated P. acnes from lymph node biopsy tissue of 31 of 40 (77.5%) patients with sarcoidosis [13]. Injection of P. acnes into sensitized rats [14] and rabbits [15] induced granuloma formation in the animals. Thus, P. acnes is thought to be one of the most probable causative organisms for sarcoidosis. In addition, P. granulosum DNA has been found in the bronchoalveolar lavage cells, vitreous fluid or lymph nodes of patients with sarcoidosis [16–18].

In this study, we quantitatively determined P. acnes or P. granulosum ribosomal RNA (rRNA) in lymph node biopsy tissue of Chinese patients with sarcoidosis, TB or other diseases by real-time quantitative reverse transcription–polymerase chain reaction (qRT–PCR). By comparing the copy numbers of bacterial rRNA among the patients, we evaluated the diagnostic value of using the copy numbers of bacterial rRNA as a biomarker for sarcoidosis in Chinese patients.

Materials and methods

Tissue samples

The study protocol was approved by the Research Ethics Committee of School of Medicine of Tongji University. Informed consent was obtained from all patients. Formalin-fixed and paraffin-embedded tissue (FFPE) of lymph node biopsy from patients treated at Shanghai Pulmonary Hospital between December 2008 and January 2012 were reviewed by a pathologist. The diagnosis of sarcoidosis was confirmed by reviewing patients’ medical records. Absence of infection with Mtb or other organisms that are known to cause granulomatous diseases was confirmed. Patients with sarcoidosis were followed-up for at least 12 months to ensure the absence of Mtb infection. Non-caseating granulomas were present in the biopsy tissue from patients with sarcoidosis [1]. TB was also confirmed by positive Mtb on the biopsy samples, and the tissue samples exhibited caseating necrosis. The lymph node biopsy samples were from 65 Chinese patients with sarcoidosis, 45 with TB and 50 controls with other diseases (23 with non-specific lymphadenitis and 27 with mediastinal lymph node metastasis from lung cancer). To evaluate the diagnostic value, additional lymph node biopsy samples from 24 patients with sarcoidosis and 22 with TB were used.

RNA extraction

Six 8-μm-thick sections were cut from paraffin blocks and transferred immediately to sterilized test tubes without exposure to air. Total RNA was extracted by using the E.Z.N.A.™ FFPE RNA kit from Omega Biotek Inc. (Norcross, GA, USA) according to the protocol provided by the manufacturer. The concentration and quality of total RNA was determined by spectrophotometry.

Oligonucleotide primers for PCR and TaqMan probes

The expression of 16s rRNA of P. acnes and P. granulosum and the human β-actin gene were detected by real-time qRT–PCR. DNA sequences of PCR primers and TaqMan probes are listed in Table 1. The TaqMan probes PA-TAQ, PG-TAQ and BG-TAQ were designed to hybridize the PCR products of P. acnes, P. granulosum and human β-actin cDNA, respectively. These probes were labelled with 6-carboxyfluorescein (FAM) on the 5′- end and 6-carboxytetramethylrhodamine (TAMRA) on the 3′ end.

Table 1.

DNA sequences of polymerase chain reaction (PCR) primers and TaqMan probes

Target gene Forward primer (5′–3′) Reverse primer (5′–3′) Amplicon size (bp)
Propionibacterium acnes 16s rRNA AGGGCTCGTAGGTGGTTG CCGTTTACAGCGTGGACTA 246
P. granulosum 16s rRNA TCCTACGGGAGGCAGCAGT CTACGAGCCCTTTACGC 227
Human β-actin gene GCCGGGACCTGACTGACTAC TCTCCTTAATGTCACGCACGAT 101
TaqMan probes
PA-TAQ CTTAACCCTGAGCGTGC
PG-TAQ CACCGGCTAACTAC
BG-TAQ CATGAAGATCCTCACCGAGCGCG
Open in a new tab

bp = base pairs.

Real-time qRT–PCR

Reverse transcription reaction was a 20-μl mixture containing 4 μl of ×5 reverse transcription buffer, 0·5 μl random hexamer primers, 0·5 μl deoxynucleotide, 1 μl Moloney murine leukaemia virus (MMLV) reverse transcriptase, 10 μl diethylpyrocarbonate (DEPC)-treated water and 4 μl RNA sample. The condition for reverse transcription reaction was 37°C for 1 h and 95°C for 5 min to inactivate MMLV. Next, the cDNA products were amplified by real-time qRT–PCR. PCR reaction was 40 μl mixture containing 2 μl Taq enzyme, 20 μl probe, 0·5 μl primers, 12 μl double-distilled water (ddH2O) and 2 μl cDNA sample. The PCR reaction was completed in an ABI 7300 sequence detection system. When 16s rRNA of P. granulosum was detected, the PCR condition was 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 66°C for 45 s. When 16s rRNA of P. acnes was detected, the PCR condition was 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 45 s. After the PCR reaction, cycle threshold (Ct) was determined at the fluorescence level exceeding an arbitrary baseline level. The cycle threshold (Ct) value reflects the quantity of the copy numbers of the target gene in samples. Each sample was tested in triplicate. A standard curve was prepared by serial dilution of P. acnes and P. granulosum total RNA (10 copies to 107 copies). Human β-actin gene was used as the internal control. PCR reactions without cDNA temple and PCR reactions with total RNA without MMLV reverse transcriptase were used as negative controls.

Statistical analysis

The χ2 test was used to analyse the differences in copy number of propionibacterial rRNA between two groups. The Mann–Whitney U-test was used to evaluate the differences in the sarcoidosis, TB and control groups. P < 0·05 was considered significantly different. The statistical analysis software spss version 19·0 was used. The ROC curve was plotted and the areas under the curves (AUC) were calculated. If either P. acnes or P. granulosum rRNA was detected in a sample, the sample was considered positive for propionibacterial rRNA. When both P. acnes and P. granulosum rRNA were detected in one sample, the higher value of the copy number was used as the quantification value. Cut-off values were determined by analysing the ROC and the value maximizing the Youden index was used as the cut-off value for diagnosis (Youden index = sensitivity + specificity-1).

Evaluation of the cut-off value

To evaluate the accuracy of the cut-off value, 46 additional lymph node biopsy samples (24 sarcoidosis and 22 TB) from patients treated in our hospital between February 2013 and November 2013 were used. P. acnes and P. granulosum rRNA were determined as described above.

Results

Establishment of real-time qRT–PCR to detect propionibacterial rRNA

Among the 65 patients with sarcoidosis, 26 were stage I and 39 were stage II, based on the evaluation of chest radiography. Patients’ general demographic data are displayed in Table 2. The sensitivity and specificity of using qRT–PCR to detect propionibacterial rRNA were first determined. The qRT–PCR results using a serial dilution (101−107) of propionibacterial RNA showed that the Ct value of each diluted sample was correlated linearly with the dilution factor. The linear correlation coefficient was 0·998 (Fig. 1a). The lowest copy number within the linear range on the plot was 102 copies/ml. Thus, the sensitivity of using this qRT–PCR approach to detect propionibacterial rRNA appeared to be 102 copies/ml. The specificity of this qRT–PCR approach was estimated using total RNA from other respiratory bacteria, including Streptococcus pneumoniae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, M. gordonae, M. vaccae, M. avium, timothy grass bacillus and M. fortuitum. As expected, no cross-reactivity was detected for all these bacteria. The specificity of the primers and probes were cross-verified further using DNA of P. acnes, P. granulosum or M. tuberculosis as templates in the PCR reaction. The primers and probe for P. granulosum failed to produce positive signals when DNA of P. acnes or M. tuberculosis was used as the PCR template. No specific signals were detected when the primers and probe for P. acnes were used in the PCR reaction and DNA of P. granulosum or M. tuberculosis was used as PCR template (Fig. 1b,c).

Table 2.

Demographic characteristics of patients

Sarcoidosis n = 65 TB n = 45 Control diseases n = 50
Age (year)
 Medium 51 40 48
 Mean (years ± s.d.) 50·32 ± 1·44 45·11 ± 2·20 46·80 ± 1·44
 Range 24–72 19–75 25–65
Sex
 Men (%) 24 (36·9) 26 (57·8) 23 (46·0)
 Women (%) 41 (63·1) 19 (42·2) 27 (54·0)
Radiological stage
 Stage I (%) 26 (40·0)
 Stage II (%) 39 (60·0)
Open in a new tab

TB = tuberculosis; s.d. = standard deviation.

Fig. 1.

Fig. 1

Open in a new tab

Sensitivity and specificity of primers and probes. (a) Standard curve of quantitative reverse transcription–polymerase chain reaction (qRT–PCR) cycle threshold and the dilution factor of propionibacterium RNA. The y-axis represents cycle threshold value; the x-axis represents the log values of the dilution factor from 102 to 107. (b) Images of electrophoresis of PCR products with primers of Propionibacterium granulosum and DNA of P. granulosum or P. acnes as the template. (c) Images of electrophoresis of PCR products with primers of P. acnes and DNA of P. granulosum or P. acnes as the template.

A significantly higher proportion of patients with sarcoidosis exhibited positive propionibacterial rRNA compared to patients with other diseases

Our qRT–PCR results show that P. acnes rRNA was detected in 38·5% (25 of 65), 6·7% (three of 45) and 2% (one of 50) lymph node samples of patients with sarcoidosis, TB and other diseases, respectively (Table 3). The difference in the proportion of positive P. acnes between patients with sarcoidosis and with TB was significant (χ2 = 14·2, P < 0·0001), as was the difference between patents with sarcoidosis and other diseases (χ2 = 21·5, P < 0·0001). Patients with TB and patients with other diseases showed a similar proportion of positive P. acnes (χ2 = 1·3, P = 0·258). Similarly, P. granulosum rRNA was detected in 44·6% (29 of 65), 4·4% (two of 45) and 4% (two of 50) lymph node samples of patients with sarcoidosis, TB and other diseases, respectively. A significantly higher proportion of patients with sarcoidosis exhibited positive P. granulosum compared to patients with TB (χ2 = 21·2, P < 0·0001) or with other diseases (χ2 = 21·2, P < 0·0001), whereas a similar proportion of positive P. granulosum was detected in patients with TB versus with other diseases (χ2 = 0·01, P = 0·914). In total, 73·8% (48 of 65) patients with sarcoidosis exhibited either positive P. acnes or positive P. granulosum. In contrast, only 8·9% (four of 45) patients with TB and 6% (three of 50) patients with other diseases showed positive for either of the bacteria. The differences in the proportion of total positive cases between patients with sarcoidosis and patients with TB (χ2 = 45·0, P < 0·000) or with other diseases were also significant (χ2 = 52·7, P < 0·000, Table 3).

Table 3.

Detection of propionibacterial rRNA in patient tissue samples

Number of sample showing positive n (%) Sarcoidosis n = 65 TB n = 45 Other diseases n = 50
Propionibacterium acnes only 19 (29·2) 2 (4·4) 1 (2·0)
P. granulosum only 23 (35·4) 1 (2·2) 2 (4·0)
P. acnes and P. granulosum 6 (9·2) 1 (2·2) 0 (0·0)
Total 48 (73·8)* 4 (8·9) 3 (6·0)
Open in a new tab
*

P < 0·0001. Sarcoidosis versus tuberculosis (TB) and control disease group; the χ2 test was performed to compare the differences among the three groups.

Quantification of propionibacterial rRNA in patients’ samples

According to the qRT–PCR standard curve obtained from serial dilution of bacterial RNA, the copy numbers of bacterial rRNA in lymph node biopsy samples were calculated. The range of copy numbers of P. acnes rRNA in sarcoidosis samples (0–1·97 × 107 copies/ml) was wider than that in TB samples (0–1·64 × 105 copies/ml) and that in samples of other diseases (0–1·03 × 102 copies/ml, Fig. 2). The mean copy numbers of P. acnes rRNA in sarcoidosis samples (1·00 × 106 ± 4·73 × 105 copies/ml) were significantly higher than those in TB samples (3·95 × 103 ± 3·65 × 103 copies/ml) and samples of other diseases (2·06 ± 2·06 copies/ml, Mann–Whitney U-test, P < 0·0001 for both, Fig. 2), whereas the copy numbers of P. acnes rRNA were similarly low in TB samples and samples of other diseases (Mann–Whitney U-test; P = 0·247, Fig. 2). The copy numbers of P. granulosum rRNA were also significantly higher in sarcoidosis samples than TB samples or samples of other diseases (5·78 × 104 ± 3·59 × 104 copies/ml versus 5·62 ± 3·93 copies/ml or 4·56 ± 3·20 copies/ml, Mann–Whitney U-test, both P < 0·0001, Fig. 3). The range of copy numbers of P. granulosum rRNA in sarcoidosis samples was also wider than the other two groups (0–1·42 × 106 copies/ml versus 0–1·32 × 102 copies/ml in TB samples or 0–1·24 × 102 copies/ml in samples of other diseases, Fig. 3). The copy numbers of P. granulosum rRNA were not significantly different between TB samples and sample of other diseases (Mann–Whitney U-test, P = 0·898, Fig. 3).

Fig. 2.

Fig. 2

Open in a new tab

The copy number Propionibacterium acne rRNA in lymph node biopsy samples. Samples were analysed by real-time quantitative reverse transcription–polymerase chain reaction (qRT–PCR) as described in the Methods. The copy number of P. acne rRNA was calculated according to the standard curve.

Fig. 3.

Fig. 3

Open in a new tab

The copy number Propionibacterium granulosum rRNA in patients’ samples. Samples were analysed by real-time quantitative reverse transcription–polymerase chain reaction (qRT–PCR) as described in the Methods. The copy number of P. granulosum rRNA was calculated according to the standard curve.

Diagnostic value of propionibacterial rRNA for sarcoidosis

In this study, 55 (48 sarcoidosis + seven non-sarcoidosis) of 160 samples were positive for propionibacterial rRNA according to the qRT–PCR results. We then plotted a ROC curve according to the qRT–PCR results. The AUC of the ROC curve is 0·843. A cut-off value of 50·5 copies/ml was obtained from the ROC curve, and this cut-off value yielded a sensitivity of 73·8% and a specificity of 92·6% (Fig. 4). We used the cut-off value of 50·5 copies/ml to test additional lymph node biopsy samples. Tissue showing ≥ 50·5 copies/ml was considered positive for propionibacterial rRNA, while < 50·5 copies/ml was considered negative. Among the 24 additional sarcoidosis samples, 41·7% (10 of 24) were positive for P. acnes and 50·0% (12 of 24) for P. granulosum (Table 4). A total of 19 of 24 sarcoidosis samples were positive for either of the bacteria, yielding a diagnostic rate of 79·2%, which was similar to that from the first sarcoidosis group (73·8%). Among the 22 additional TB samples, only one was positive for P. acnes and none for P. granulosum, corresponding to a diagnostic rate of 4·5% in this new TB group and a specificity of 95·5% (Table 4).

Fig. 4.

Fig. 4

Open in a new tab

ROC curve of propionibacterial rRNA.

Table 4.

Diagnostic results of additional patient tissue samples using the cut-off value of 50·5 copies/ml

Propionibacterial rRNA copy Sarcoidosis n = 24 TB n = 22
≥ 50 copies/ml, n (%) 19 (79·2) 1 (4·5)
< 50 copies/ml, n (%) 5 (20·8) 21 (95·5)
Open in a new tab

Discussion

Since Abe et al. isolated P. acnes from lymph node biopsy samples of sarcoid patients in 1984 [13], growing evidence from multiple studies supports a role of Propionibacterium in the development of sarcoidosis. By using quantitative PCR, Ishige et al. detected genomic DNA of P. acnes or P. granulosum in lymph node biopsy samples of 15 Japanese patients with sarcoidosis [19]. Gazouli et al. found P. granulosum in 20 of 46 (43·47%) Greek patients with sarcoidosis, but did not detect the bacteria in patients with non-small-cell lung cancer or TB [20]. In addition, P. acnes DNA was detected in the bronchoalveolar lavage cells of 21 of 30 (70%) sarcoid patients, but in only seven of 30 (23%) patients with other pulmonary diseases [21]. Negi et al. performed immunohistochemical staining using a P. acnes-specific monoclonal antibody to screen tissue of patients with sarcoidosis or other diseases; they found that positive staining appeared in sarcoid granulomas and that a higher proportion of sarcoid samples exhibited positive staining than control samples [22]. These results indicate an aetiological link between Propionibacterium and sarcoidosis. Furthermore, the results from an international collaborative study also suggest an aetiological correlation between Propionibacterium and sarcoidosis in Japanese and European patients [18]. In that study, either P. acnes or P. granulosum was detected in 106 of 108 sarcoidosis samples, whereas only a few cases of TB and control samples exhibited positive for the bacteria.

In this report, we used real-time qRT–PCR to detect 16s rRNA of P. acnes and P. granulosum in biopsy samples of Chinese patients with sarcoidosis, TB or other diseases. P. acnes or P. granulosum rRNA was detected in a significantly greater proportion of sarcoidosis samples compared with TB samples or samples of other diseases. Moreover, the copy number of P. acnes or P. granulosum rRNA in sarcoidosis samples was significantly higher than that in TB samples or samples of other diseases. To our knowledge, this is the first report using real-time qRT–PCR to detect propionibacterial rRNA in lymph node biopsy samples of patients with sarcoidosis. Our results indicate that Propionibacterium might be associated with the development of sarcoidosis, which is consistent with previous studies [13,18,19,21]. The high positive rate of Propionibacterium in sarcoidosis samples suggests that the presence of Propionibacterium might be a diagnostic biomarker for sarcoidosis.

In this study, some sarcoidosis samples (17 of 65 samples and five of an additional 24 samples) were negative for P. acnes or P. granulosum rRNA. It is possible that, with the exception of P. acnes and P. granulosum, other bacteria such as different species of Propionibacterium and mycobacteria might also be pathogenic bacteria for sarcoidosis. Drake and colleagues have detected mycobacteria in patients with sarcoidosis [23,24].

The positive rate of P. acnes rRNA in sarcoidosis samples detected in this study is lower than that from our previous meta-analysis [25], which showed a positive rate of 78·4% for P. acnes DNA in patients with sarcoidosis. The reason for this difference might be related to the fact that bacterial rRNA, which is a marker for viable bacteria, was measured in this study, whereas bacterial DNA, which exists in viable, dead and dormant bacteria, was measured in the studies included in the meta-analysis.

P. acnes and P. granulosum are indigenous bacteria found commonly on normal human skin. In our study, total RNA was extracted from histological sections of lymph node biopsy samples and propionibacterial rRNA was abundant in the sarcoid lesions only. Thus, the possibility of propionibacterium contamination from the skin was minimal. It has been shown that P. acnes resides not only on the skin but also in the peripheral lung tissue and mediastinal lymph nodes of patients without sarcoidosis [26]. Eishi also found P. acnes in sarcoid lymph nodes [27]. These findings might explain our results showing that P. acnes was also detected in some non-sarcoidosis samples (four of 45 TB samples and three of 50 control samples), but the bacteria were in much lower copies in those non-sarcoidosis samples than in sarcoidosis samples. These results indicate that latent infection and endogenous reactivation of this indigenous bacterium occurs in lung tissue and mediastinal lymph nodes of patients even without sarcoidosis.

We plotted a ROC curve to determine the optimal cut-off value of copy number of propionibacterial rRNA to distinguish sarcoidosis from other diseases (TB and other diseases). The optimal cut-off value obtained from the ROC analysis was 50·5 copies/ml, which yielded a sensitivity of 73·8% and specificity of 92·6% for sarcoidosis diagnosis. We also used the cut-off value of 50·5 copies/ml to test additional tissue samples, and the diagnostic sensitivity and specificity of the additional samples were similar to those of samples used originally for establishing the ROC. Thus, we believe that real-time qRT–PCR of propionibacterial rRNA might be used for diagnosis and differential diagnosis of sarcoidosis, particularly for TB exclusion. In our previous study, Mtb genomic DNA copy number 1·14 × 103 copies/ml was found to be an optimal cut-off value to distinguish TB from sarcoidosis. Thus, the combination of propionibacterial rRNA and Mtb DNA should improve the accuracy of differential diagnosis of sarcoidosis and TB.

A limitation of this study is that the copy number of propionibacterial rRNA might be under- or over-estimated due to variation in the total RNA amount used in reverse transcription, although the same amount of tissues was used for extracting total RNA. In this study, the copy number of human β-actin was similar in TB samples and samples of other diseases, suggesting that the propionibacterial rRNA amount of these samples seemed unlikely to be skewed by different amounts of total RNA. Sarcoidosis samples showed a wider range of the copy numbers of human β-actin than TB samples and samples of other diseases, although the mean and median copy numbers of β-actin were very close among the three groups. The proportion of sarcoidosis samples (17%) with a very low level of total RNA (as reflected by high cycle threshold value of human β-actin in the PCR) was higher than that (3·7%) with a very high level of total RNA (as reflected by the low cycle threshold value of human β-actin). Therefore, the propionibacterial rRNA copy number of some sarcoidosis samples might be under-estimated due to low amounts of total RNA, and over-estimation seems to be associated with only a few samples. Thus, the rate of sarcoidosis samples with positive propionibacterial rRNA might be under-estimated in this study. Nevertheless, the main conclusion should not be affected. In future studies, we will further explore the proper application of internal controls and improve the accuracy of the assay.

In conclusion, our study suggests that Propionibacterium might contribute to the development of sarcoidosis. Propionibacterial rRNA might be possibly used to differentiate sarcoidosis from TB.

Acknowledgments

The study was funded by grants from the National Science Foundation of China (no: 91442103, 81170011, 81200046 and 81200045), the Science and Technology Commission of Shanghai Municipality (12DJ1400103, 124119a9000, 12DZ1942500 and 12411950105), the Health Bureau Program of Shanghai Municipality (SHDC12014120, 2013SY047) and Tongji University (1511219020). The authors would like to thank Professor Robert P. Baughman for providing valuable comments on the research and for editing the manuscript.

Disclosure

The authors declare no conflicts of interest.

References

  • 1.Statement on Sarcoidosis. Joint Statement of the American Thoracic Society (ATS), the European Respiratory Society (ERS) and the World Association of Sarcoidosis and Other Granulomatous Disorders (WASOG) adopted by the ATS Board of Directors and by the ERS Executive Committee, February 1999. Am J Respir Crit Care Med. 1999;160:736–55. doi: 10.1164/ajrccm.160.2.ats4-99. [DOI] [PubMed] [Google Scholar]
  • 2.Newman LS, Rose CS, Bresnitz EA, et al. A case control etiologic study of sarcoidosis: environmental and occupational risk factors. Am J Respir Crit Care Med. 2004;170:1324–30. doi: 10.1164/rccm.200402-249OC. [DOI] [PubMed] [Google Scholar]
  • 3.Grunewald J. Genetics of sarcoidosis. Curr Opin Pulm Med. 2008;14:434–9. doi: 10.1097/MCP.0b013e3283043de7. [DOI] [PubMed] [Google Scholar]
  • 4.Valeyre D, Prasse A, Nunes H, Uzunhan Y, Brillet PY, Muller-Quernheim J. Sarcoidosis. Lancet. 2014;383:1155–67. doi: 10.1016/S0140-6736(13)60680-7. [DOI] [PubMed] [Google Scholar]
  • 5.Fite E, Fernandez-Figueras MT, Prats R, Vaquero M, Morera J. High prevalence of Mycobacterium TB DNA in biopsies from sarcoidosis patients from Catalonia, Spain. Respiration. 2006;73:20–6. doi: 10.1159/000087688. [DOI] [PubMed] [Google Scholar]
  • 6.Drake WP, Pei Z, Pride DT, Collins RD, Cover TL, Blaser MJ. Molecular analysis of sarcoidosis tissues for Mycobacterium species DNA. Emerg Infect Dis. 2002;8:1334–41. doi: 10.3201/eid0811.020318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Li N, Bajoghli A, Kubba A, Bhawan J. Identification of mycobacterial DNA in cutaneous lesions of sarcoidosis. J Cutan Pathol. 1999;26:271–8. doi: 10.1111/j.1600-0560.1999.tb01844.x. [DOI] [PubMed] [Google Scholar]
  • 8.Drake WP, Dhason MS, Nadaf M, et al. Cellular recognition of Mycobacterium TB ESAT-6 and KatG peptides in systemic sarcoidosis. Infect Immun. 2007;75:527–30. doi: 10.1128/IAI.00732-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wilsher ML, Menzies RE, Croxson MC. Mycobacterium TB DNA in tissues affected by sarcoidosis. Thorax. 1998;53:871–4. doi: 10.1136/thx.53.10.871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Marcoval J, Benitez MA, Alcaide F, Mana J. Absence of ribosomal RNA of Mycobacterium TB complex in sarcoidosis. Arch Dermatol. 2005;141:57–9. doi: 10.1001/archderm.141.1.57. [DOI] [PubMed] [Google Scholar]
  • 11.Milman N, Lisby G, Friis S, Kemp L. Prolonged culture for mycobacteria in mediastinal lymph nodes from patients with pulmonary sarcoidosis. A negative study. Sarcoidosis Vasc Diffuse Lung Dis. 2004;21:25–8. [PubMed] [Google Scholar]
  • 12.Zhou Y, Li HP, Li QH, et al. Differentiation of sarcoidosis from TB using real-time PCR assay for the detection and quantification of Mycobacterium TB. Sarcoidosis Vasc Diffuse Lung Dis. 2008;25:93–9. [PubMed] [Google Scholar]
  • 13.Abe C, Iwai K, Mikami R, Hosoda Y. Frequent isolation of Propionibacterium acnes from sarcoidosis lymph nodes. Zentralbl Bakteriol Mikrobiol Hyg A. 1984;256:541–7. doi: 10.1016/s0174-3031(84)80032-3. [DOI] [PubMed] [Google Scholar]
  • 14.Yi ES, Lee H, Suh YK, et al. Experimental extrinsic allergic alveolitis and pulmonary angiitis induced by intratracheal or intravenous challenge with Corynebacterium parvum in sensitized rats. Am J Pathol. 1996;149:1303–12. [PMC free article] [PubMed] [Google Scholar]
  • 15.Ichiyasu H, Suga M, Matsukawa A, et al. Functional roles of MCP-1 in Propionibacterium acnes-induced, T cell-mediated pulmonary granulomatosis in rabbits. J Leukoc Biol. 1999;65:482–91. doi: 10.1002/jlb.65.4.482. [DOI] [PubMed] [Google Scholar]
  • 16.Ichikawa H, Kataoka M, Hiramatsu J, et al. Quantitative analysis of propionibacterial DNA in bronchoalveolar lavage cells from patients with sarcoidosis. Sarcoidosis Vasc Diffuse Lung Dis. 2008;25:15–20. [PubMed] [Google Scholar]
  • 17.Yasuhara T, Tada R, Nakano Y, et al. The presence of Propionibacterium spp. in the vitreous fluid of uveitis patients with sarcoidosis. Acta Ophthalmol Scand. 2005;83:364–9. doi: 10.1111/j.1600-0420.2005.00449.x. [DOI] [PubMed] [Google Scholar]
  • 18.Eishi Y, Suga M, Ishige I, et al. Quantitative analysis of mycobacterial and propionibacterial DNA in lymph nodes of Japanese and European patients with sarcoidosis. J Clin Microbiol. 2002;40:198–204. doi: 10.1128/JCM.40.1.198-204.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ishige I, Usui Y, Takemura T, Eishi Y. Quantitative PCR of mycobacterial and propionibacterial DNA in lymph nodes of Japanese patients with sarcoidosis. Lancet. 1999;354:120–3. doi: 10.1016/S0140-6736(98)12310-3. [DOI] [PubMed] [Google Scholar]
  • 20.Gazouli M, Ikonomopoulos J, Trigidou R, Foteinou M, Kittas C, Gorgoulis V. Assessment of mycobacterial, propionibacterial, and human herpesvirus 8 DNA in tissues of Greek patients with sarcoidosis. J Clin Microbiol. 2002;40:3060–3. doi: 10.1128/JCM.40.8.3060-3063.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hiramatsu J, Kataoka M, Nakata Y, et al. Propionibacterium acnes DNA detected in bronchoalveolar lavage cells from patients with sarcoidosis. Sarcoidosis Vasc Diffuse Lung Dis. 2003;20:197–203. [PubMed] [Google Scholar]
  • 22.Negi M, Takemura T, Guzman J, et al. Localization of Propionibacterium acnes in granulomas supports a possible etiologic link between sarcoidosis and the bacterium. Mod Pathol. 2012;25:1284–97. doi: 10.1038/modpathol.2012.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Drake WP, Newman LS. Mycobacterial antigens may be important in sarcoidosis pathogenesis. Curr Opin Pulm Med. 2006;12:359–63. doi: 10.1097/01.mcp.0000239554.01068.94. [DOI] [PubMed] [Google Scholar]
  • 24.Oswald-Richter KA, Culver DA, Hawkins C, et al. Cellular responses to mycobacterial antigens are present in bronchoalveolar lavage fluid used in the diagnosis of sarcoidosis. Infect Immun. 2009;77:3740–8. doi: 10.1128/IAI.00142-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhou Y, Hu Y, Li H. Role of Propionibacterium acnes in sarcoidosis: a meta-analysis. Sarcoidosis Vasc Diffuse Lung Dis. 2013;30:262–7. [PubMed] [Google Scholar]
  • 26.Ishige I, Eishi Y, Takemura T, et al. Propionibacterium acnes is the most common bacterium commensal in peripheral lung tissue and mediastinal lymph nodes from subjects without sarcoidosis. Sarcoidosis Vasc Diffuse Lung Dis. 2005;22:33–42. [PubMed] [Google Scholar]
  • 27.Eishi Y. Etiologic aspect of sarcoidosis as an allergic endogenous infection caused by Propionibacterium acnes. Biomed Res Int. 2013;;2013:935289. doi: 10.1155/2013/935289. doi: 10.1155/2013/935289. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES