Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2015 Mar;144(3):472–485. doi: 10.1111/imm.12395

Interleukin-17 regulates the expressions of RANKL and OPG in human periodontal ligament cells via TRAF6/TBK1-JNK/NF-κB pathways

Danping Lin 1, Lu Li 1,2, Ying Sun 1,2, Weidong Wang 1, Xiaoqian Wang 1, Yu Ye 1, Xu Chen 1, Yan Xu 1,2,✉
PMCID: PMC4557684  PMID: 25263088

Abstract

Interleukin-17 (IL-17 or IL-17A), a pleiotropic cytokine produced by T helper type 17 cells, is involved in the pathogenesis of various autoimmune and inflammatory disorders, including periodontitis. Although the ability of pro-inflammation in periodontitis has been widely investigated, the other biological functions of IL-17, including its role in bone remodelling and the underlying molecular mechanisms, have not been well clarified. In the present study, IL-17 could significantly enhance the expression of receptor activator for nuclear factor-κB ligand (RANKL) and inhibit the expression of osteoprotegerin (OPG) in human periodontal ligament cells, the two critical indicators for osteoclastogenesis, suggesting that IL-17 may play a destructive role in the pathogenesis of periodontal bone remodelling. Pharmaceutical signal inhibitors targeted at mitogen-activated protein kinases, Akt or nuclear factor-κB signals, inhibited IL-17-induced RANKL and OPG regulation. Notably, the enhancement of RANKL was significantly blocked by the inhibitors of c-Jun N-terminal kinase and nuclear factor-κB signals. The upstream signals were further investigated with the small interfering RNA. Both tumour necrosis factor receptor-associated factor 6 and TNF receptor associated factor (TRAF) family member-associated nuclear factor κ-light-chain enhancer of activated B cells (NF-κB) activator (TANK)- binding kinase 1 were found to be the critical signal molecules for IL-17-dependent RANKL regulation in human periodontal ligament cells. These findings may provide comprehensive understanding of the role of IL-17 in the pathogenesis of periodontitis and might also provide a reasonable route for periodontitis therapy.

Keywords: interleukin-17, osteoprotegerin, periodontal ligament cells, receptor activator for nuclear factor-κB ligand, signal transduction

Introduction

Periodontitis, which is a chronic inflammatory disease characterized by the destruction of the tooth’s supporting structure, is considered to be the main reason of tooth loss. The subgingival plaque is thought to be the initial factor for periodontitis, but the pathogenesis and progress of the disease are mainly regulated by the host immune response. The pathogenesis of periodontitis was classically postulated in the context of the T helper type 1 (Th1)/Th2 paradigm in the last two decades. However, it has been recognized that there are conflicting results with respect to this classical model.1 With the recognition of Th17, a third effector CD4+ T-cell population, many of these discrepancies have been resolved, but at the same time, new questions have been raised.2–5

Interleukin-17 (IL-17) is the most important cytokine of Th17 cells, which could induce the expressions of various pro-inflammatory molecules, including cytokines, chemokines and matrix metalloproteases.2 Th17 cells and IL-17 have been involved in a variety of autoimmune and inflammatory diseases, such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, psoriasis and allograft rejection.2,3,6 Th17 cells and IL-17 have also been detected in chronic periodontal lesions and the level of IL-17 was significantly increased in severe periodontitis compared with other T helper-secreted cytokines.7–9 Our previous work has shown that the level of IL-17 in gingival crevicular fluids is down-regulated in chronic periodontitis after non-surgical periodontal therapy.10 These findings strongly suggest that IL-17 plays a pro-inflammatory role in the pathogenesis of periodontitis.

Recently, several studies have indicated that IL-17 is also crucial for bone resorption. Moon et al. reported that IL-17 could promote bone destruction in rheumatoid arthritis in synergy with IL-32.11 Besides, IL-17 has been shown to promote osteoclast differentiation indirectly through the induction of IL-1, prostaglandin E2, tumour necrosis factor-α (TNF-α) and receptor activator for nuclear factor-κB (NF-κB) ligand (RANKL) in osteoblasts, synovial cells and mesenchymal stem cells.11–14 Recently, Hayashi et al. reported that IL-17 and IL-17 receptor could be detected in the periodontal ligament tissue during experimental tooth movement. It has also been shown in the same study that IL-17 could induce IL-6 production in human periodontal ligament cells (hPDLC) and stimulated osteo⁄odontoclastogenesis.13 Moreover, Eskan et al. have reported that Edil3−/− Il17ra−/− knockout mice were completely protected against ligature-induced periodontal bone loss.15 These studies indicate that IL-17 may contribute to the alveolar bone resorption. However, the mechanisms still need to be fully elucidated.

Bone remodelling is a dynamic process, which is regulated through the balance between bone formation and resorption. When this balance is disrupted and favours resorption, inflammation-mediated bone diseases arise, such as chronic periodontitis and rheumatoid arthritis. The bone resorption is dependent on the balance between the RANKL and osteoprotegerin (OPG). By binding to its cognate RANK receptor on osteoclast precursors in the presence of macrophage colony-stimulating factor, RANKL triggers the osteoclast precursors to differentiate into multinucleated osteoclasts, which are responsible for the bone resorption.16 There are two forms of RANKL: soluble form (sRANKL) and membrane-bound form (mRANKL).17 Both can regulate the differentiation of osteoclast precursors. OPG, the soluble inhibitor of RANKL, counter-regulates the excessive bone loss by preventing the RANKL from binding to its receptor RANK.16 Hence, the ratio of RANKL to OPG is viewed as the key parameter in osteoclastogenesis, as well as the indicator of alveolar bone resorption in periodontitis.18,19 The ratio of RANKL to OPG could be affected by various cytokines in the inflammatory tissue, such as IL-6, TNF-α, prostaglandin E2 and IL-1.

Periodontal ligament, which anchors the tooth root to the surrounding alveolar bone, plays a crucial role in the homeostasis of the periodontal tissue. Periodontal ligament cells, which are the main cell components of periodontal ligament, not only serve as support cells for periodontal tissues, but also play an important role in the alveolar bone metabolism for their ability to regulate the homeostasis of connective and osseous tissue. Human periodontal ligament cells constantly express OPG but do not regularly express RANKL, unless they are suffering from bacterially challenged or orthodontic tooth movement.20,21 The expressions of RANKL and OPG in hPDLC could be affected by various stimuli and might affect the alveolar metabolism as a consequence of the dysregulation of the osteoclastogenic molecules.22

In the present study, we aimed to elucidate the effects of IL-17 on RANKL and OPG expression in hPDLC. Furthermore, the signal transduction pathways were investigated using signal inhibitors and small interfering RNA. Our findings demonstrate that IL-17 could regulate the expressions of RANKL and OPG in hPDLC via TNF receptor-associated factor 6 (TRAF6)/TANK-binding kinase 1 (TBK1)–c-Jun N-terminal kinase (JNK)/NF-κB pathways.

Materials and methods

Materials

The recombinant human IL-17 was purchased from Peprotech (Rocky Hill, NJ). Primary antibodies to phospho-Akt (Ser473) [rabbit monoclonal antibody (mAb)], Akt (rabbit mAb), phospho-inhibitor of NF-κB α (IκBα; Ser32/36) (mouse mAb), IκBα (mouse mAb), phospho-p38 mitogen-activated protein kinase (MAPK; rabbit mAb), phospho-JNK (mouse mAb), phospho-extracellular signal-regulated kinase 1/2 (ERK1/2; rabbit mAb), and ERK1/2 (rabbit mAb) were purchased from Cell Signaling Technology (Danvers, MA). The antibodies to P38 (mouse mAb), JNK (rabbit mAb), histone H1 (rabbit mAb) were from Bioworld Biotechnology (St. Louis, MO). Antibodies against NF-κB P65 (rabbit mAb), Fos (rabbit mAb), TRAF6 (rabbit mAb), TBK1 (rabbit mAb), RANKL (rabbit mAb) were obtained from Abcam (Cambridge, UK). Cy3-conjugated secondary antibodies were supplied by Beyotime Institute of Biotechnology (Shanghai, China). SB203580 (p38MAPK inhibitor), U0126 (ERK1/2 inhibitor), SP600125 (JNK inhibitor), LY294002 (Akt inhibitor), pyrrolidine thiocarbamate (PDTC) (NF-κB inhibitor) were also obtained from Beyotime Institute of Biotechnology. All inhibitors were dissolved in DMSO and the final concentration of DMSO used in all solutions throughout the study did not exceed 0·1%.

Cell culture

Periodontal ligament tissues were isolated from the middle third of the root surface of healthy human premolars, which were extracted for orthodontic treatment and then placed into culture dishes. The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY) supplemented with 10% fetal calf serum (Gibco) and antibiotic reagent (10 000 units penicillin, 10 000 mg streptomycin; Gibco) in a humidified atmosphere of 95% air and 5% CO2 at 37°. Human PDLC in the present study were used between the fourth and seventh passages. The experimental procedure was approved by the ethics committee of Nanjing Medical University and informed consent was obtained from each person.

MTT assay

The hPDLC were treated with the indicated concentrations of IL-17 (0–100 ng/ml). MTT assay was used to detect the cytotoxicity of IL-17 on hPDLC. The treated hPDLC were rinsed and incubated with 0·5 mg/ml MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide) in serum-free culture medium at 37° for 4 hr. The blue formazan crystals of viable cells were dissolved in DMSO subsequently and the absorbance (OD value) was measured at 490 nm by using a microtitre plate reader (Titertek, Pforzheim, Germany). Results were expressed as percentages of control group.

Real-time PCR analysis

Total cellular RNA was extracted from treated hPDLC with Trizol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Complementary DNA was synthesized using a reverse transcription kit (TaKaRa Bio Inc., otsu, Japan). Real-time PCR analyses were performed by a quantitative PCR System (ABI 7300) with FastStart Universal SYBR Green Master (Roche, Basel, Switzerland). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer sequences for RANKL, OPG and GAPDH are presented in Table1. Gene expression levels were calculated using the 2−ΔΔCt method.

Table 1.

Primer sequences of receptor activator for nuclear factor-κB ligand (RANKL), osteoprotegerin (OPG) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

Gene name Primers Sequences (5′–3′)
RANKL (196 bp) Forward ACCAGCATCAAAATCCCAAG
Reverse CCCCAAAGTATGTTGCATCC
OPG (110 bp) Forward TGTGCGAATGCAAGGAAG
Reverse TGTATTTCGCTCTGGGGTTC
GAPDH (225 bp) Forward GAAGGTGAAGGTCGGAGTC
Reverse GAGATGGTGATGGGATTTC
Open in a new tab

Western blot analysis

Human PDLC were challenged with ascending concentrations of IL-17 (0–100 ng/ml) for 24 hr or treated with 50 ng/ml IL-17 for 0–48 hr. The pre-treated hPDLC were collected, washed and lysed in RIPA lysis buffer (Beyotime) supplemented with protease and phosphatase inhibitor, while the cytoplasmic and nuclear extracts from cells were prepared with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, IL). The protein concentration was measured using a bicinchoninic acid protein assay kit (Beyotime). Equal amounts of protein extracts were electrophoresed on 8–12% SDS–PAGE gels and electrotransferred onto PVDF membranes (Millipore, Bedford, MA) at 300 mA for 1 hr in a blotting apparatus (Bio-Rad, Hercules, CA). After being blocked with blocking solution, the membranes were incubated with corresponding primary antibodies (1 : 500 to 1 : 1000 diluted) at 4° overnight. The membranes were then incubated with appropriate horseradish peroxidase-conjugated secondary antibodies (1 : 10 000; Boster Biotech. Co. Ltd, Pleasanton, CA) at room temperature for 1 hr. The immunoreactive proteins were visualized with Immobilon Western Chemiluminescent HRP Substrate (Millipore, Billerica, MA) and were exposed to X-ray film (Eastman-Kodak, Rochester, NY). GAPDH served as the internal control in these experiments.

Immunofluorescence analysis

Human PDLC grown on glass coverslips were seeded at low density and incubated for 24 hr for attachment. Then the cells were stimulated with or without IL-17 for the indicated times. The hPDLC were fixed with 4% paraformaldehyde and blocked with goat serum, followed by incubation with the primary rabbit anti-NF-κB p65 and anti-Fos antibodies (1 : 100 diluted) at 4° overnight. The samples were incubated with Cy3-conjugated goat anti-rabbit IgG (1 : 100) for 1 hr at room temperature and co-stained with DAPI dye to visualize nuclei. Each step above was followed by washing three times with cold PBS for 5 min. Finally, coverslips were mounted on a microscope slide with embedding medium and the nuclear expression of NF-κB p65 and Fos was observed with a fluorescence microscope.

ELISA

The levels of sRANKL and OPG in the hPDLC culture supernatants were measured with commercial colorimetric sandwich ELISA kits according to the manufacturer’s instructions (CUSABIO, Wuhan, China) and cytokine levels were determined using the standard curve prepared for each assay.

RNA interference (RNAi) and transfection

Human PDLC were transfected with small interfering RNA (siRNA) oligonucleotides and lipofectamine2000 (Invitrogen) following the manufacturer’s instructions. The siRNA-annealed oligonucleotide duplexes for human TBK1 (sense 5′-GGUGGGGUGGAAUGAAUCAUTT-3′; antisense 5′-AUGAUUCAUUCCACCCACCTT-3′) and negative control (sense 5′-UUCUCCGAACGUGUCACGUTT-3′; antisense 5′-ACGUGACACGUUCGGAGAATT-3′) were obtained from GenePharma (GenePharma, Shanghai, China). TRAF6 siRNA (sc-36717) was from Santa Cruz Biotechnology (Santa Cruz, CA). After transfection for 48 hr, cells were treated with IL-17 (50 ng/ml) for the times indicated and harvested for quantitative real-time PCR or Western blot.

Statistical analysis

Experimental data were represented as mean ± SEM. Statistical significance was determined by the two-tailed Student’s t-test (SPSS 19.0 software IBM, New York, NY, USA). The level of significance was set at P < 0·05. Each assay was performed at least three times.

Results

IL-17 promoted the expression of RANKL and inhibited the expression of OPG in hPDLC

In the MTT assay, the concentration of IL-17 ranging from 1 to 100 ng/ml caused no significant reduction in cell viability (Fig.1a), so these concentrations were considered to be non-cytotoxic. Doses ranging from 1 to 100 ng/ml were used in the rest of the experiments.

Figure 1.

Figure 1

Open in a new tab

Effects of interleukin-17 (IL-17) on receptor activator for nuclear factor-κB ligand (RANKL) and osteoprotegerin (OPG) mRNA and protein levels in human periodontal ligament cells (hPDLC). (a) Human PDLC were treated with indicated concentrations of IL-17 (0–100 ng/ml). The cell viability was assessed by MTT assay after 24 hr. Data are expressed as percentage of cell viability relative to the control (0 ng/ml). (b–e) The cells were challenged with ascending concentrations of IL-17 (0–100 ng/ml) for 24 hr. (b and c) The expressions of RANKL and OPG mRNA were determined by real-time PCR. (d) The relative RANKL/OPG gene expression ratio was calculated based on the RANKL and OPG gene expression values measured by real-time PCR. (e) RANKL protein levels were assayed by Western blot, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for protein level normalization. The fold increase in mRANKL protein expression was calculated as the ratio of mRANKL : GAPDH. (f) The concentrations of OPG protein secreted into the culture supernatants were quantified by ELISA. (g–k) Cells were treated with 50 ng/ml IL-17 for 0–48 hr. (g, h) The levels of RANKL and OPG mRNA expression were determined by real-time PCR. (i) The relative RANKL/OPG gene expression ratio was calculated based on the RANKL and OPG gene expression values measured by real-time PCR. (j) RANKL protein levels were assayed by Western blot, GAPDH was used for protein level normalization. The fold increase in protein expression was calculated as the ratio of mRANKL/GAPDH. (k) The concentrations of OPG protein secreted into the culture supernatants were quantified by ELISA. *P < 0·05, **P < 0·01, ***P < 0·001 versus the untreated group. The data represent mean ± SEM of three independent experiments.

To identify the effects of IL-17 on the expressions of RANKL and OPG in hPDLC, we performed dose-dependent and time-dependent studies. In the dose-dependent study, hPDLC were treated with IL-17 (0–100 ng/ml) for 24 hr (Fig.1b–f). As shown in Fig.1(b), the mRNA expression of RANKL began to increase when cells were exposed to 10 ng/ml IL-17, and reached a plateau at 50 ng/ml. In contrast, the mRNA expression of OPG was significantly reduced at 25 and 50 ng/ml (Fig.1c), though the change of OPG was not as significant as that of RANKL. The dose-dependent protein increase of mRANKL was observed in Western blot analysis and the maximum expression was obtained at 50 ng/ml (Fig.1e). However, the concentration of sRANKL in the cell supernatant could not be detected. As the mRANKL plays a more important role in osteoclastogenesis than sRANKL,17 the protein expression of mRANKL, but not of sRANKL, was observed in the subsequent experiments. In contrast to RANKL, the protein level of OPG was highly expressed in hPDLC. However, in the presence of IL-17, there appeared to be a decrease in OPG protein expression in hPDLC, though there were no obvious differences among the groups treated with variable concentrations of IL-17 (Fig.1f). Based on these data, 50 ng/ml was selected as the optimal concentration of IL-17 for use in subsequent analyses.

We next performed the time-dependent analysis (Fig.1g–k). The results indicated that the mRNA expression of RANKL was enhanced by IL-17 in a time-dependent manner (Fig.1g) whereas the mRNA expression of OPG was decreased (Fig.1h). The protein level of mRANKL was increased and reached a plateau for 24 hr (Fig.1j), while the secretion of OPG began to reduce for 12 hr and significantly decreased for 24 hr and 48 hr (Fig.1k).

IL-17-mediated RANKL and OPG regulation in hPDLC through MAPK, Akt and NF-κB signalling

To determine the signals involved in IL-17-dependent RANKL and OPG regulation in hPDLC, we first investigated the signals activated by IL-17. It has been reported that MAPK, Akt and NF-κB are the common downstream signalling events of IL-17R signalling in various cell types.23 We treated hPDLC with IL-17 (50 ng/ml) for 15, 30 and 60 min, and the phosphorylation of P38, ERK1/2, JNK, Akt and IκBα were observed as early as 15 min and the maximal level was obtained at 15 min (Akt) or 30 min (all others) after IL-17 stimulation (Fig.2a). The transcription factors NF-κB and AP-1, which are the downstream signals of IkBα and JNK, respectively, are particularly involved in the induction of inflammatory mediators. Hence, the protein expressions of NF-κB P65 subunit and Fos (one of the components of AP-1) in hPDLC were detected subsequently. As shown in Fig.2(b–d), the nuclear translocation of NF-κB P65 subunit and the expression of Fos in the nucleus were increased dramatically at 60 min after IL-17 stimulation. The expression of Fos in IL-17-untreated hPDLC was not detected by immunoflurescence analysis. That may be attributed to the low expression of Fos in hPDLC. This was consistent with the previous study in which the c-fos gene expression in hPDLC was not shown by Northern blot analysis.24

Figure 2.

Figure 2

Open in a new tab

Interleukin-17 (IL-17) induced the activation of mitogen-activated protein kinases (MAPKs), Akt, nuclear factor-κB (NF-κB) and AP-1 pathways. (a, b) Cells were left untreated or treated for 0, 15, 30 or 60 min with IL-17 (50 ng/ml). (a) The phosphorylated (p-) and total of p38, extracellular signal-regulated kinase (ERK) 1/2, c-Jun N-terminal kinase (JNK), Akt and IκBα were evaluated by Western blot, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used for protein level normalization. The fold increase in protein expression was calculated as the ratio of phosphorylated protein/total protein. (b) The translocation of nuclear factor-κB (NF-κB) P65 to nuclear and the expression of Fos in nucleus were evaluated by Western blots, GAPDH and Lamin B1, Histone H1 expressions served as internal controls of cytoplasm and nucleus, respectively. The fold increase in protein expression was calculated as the ratio of P65 or Fos/GAPDH or Lamin B1. (c, d) Cells were treated with IL-17 (50 ng/ml) for 1 hr, and the nuclear translocation of P65 and expression of Fos were detected by immunofluorescence analysis. P65 subunit and Fos were visualized by binding with a Cy3-conjugated secondary antibody (red) and the nuclei were stained with DAPI (blue). The red area and blue area images were overlaid to create a purple fluorescence in areas of co-localization. One of three experiments with similar results is shown. Values are the mean ± SEM, n = 3. *P < 0·05, **P < 0·01, ***P < 0·001.

To determine whether intracellular signallings were required for IL-17-dependent RANKL and OPG regulation, pharmaceutical inhibitors were used. The hPDLCs were pre-treated with 10 μmol/l SB203580 (the inhibitor of P38), 10 μmol/l U0126 (the inhibitor of ERK1/2), 10 μmol/l SP600125 (the inhibitor of JNK), 10 μmol/l LY294002 (the inhibitor of Akt) and 10 μmol/l PDTC (the inhibitor of NF-κB) for 60 min, followed by treatment with IL-17 for 30 min to examine the effects of the inhibitors. As shown in Fig.3(a), the activation of the corresponding signals was significantly inhibited by the specific inhibitors, suggesting that the concentrations of the inhibitors were acceptable. Next, hPDLC were pre-treated with these inhibitors for 60 min and then incubated with IL-17 for 24 hr to examine the expressions of RANKL and OPG. As shown in Fig.3(b, e), the enhancement of RANKL was inhibited by all the inhibitors. The most significant effect on IL-17-induced RANKL expression was observed for SP600125 and PDTC, the inhibitors of JNK and NF-κB, respectively. Meanwhile, IL-17-induced OPG down-regulation was blocked by all the inhibitors (Fig.3c, f).

Figure 3.

Figure 3

Open in a new tab

Interleukin-17 (IL-17) -mediated receptor activator for nuclear factor-κB (NF-κB) ligand (RANKL) and osteoprotegerin (OPG) expression in human periodontal ligament cells (hPDLC) via p38, extracellular signal-regulated kinase (ERK 1/2), c-Jun N-terminal kinase (JNK), Akt and NF-κB pathways. (a) Cells were pre-treated with 10 μm SB203580, 10 μm U0126, 10 μm SP600125, 10 μm LY294002, or 10 μm PDTC for 1 hr, followed by incubation with 50 ng/ml IL-17 for 30 min. Total, nuclear, and cytoplasmic proteins were then extracted, p38, ERK1/2, JNK and NF-κB signals were evaluated by Western blot. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Lamin B1 served as internal controls of cytoplasm and nucleus, respectively. (b–f) Cells were pre-treated with the signalling inhibitors mentioned above, or 0·01% DMSO (untreated) for 1 hr, followed by addition of 50 ng/ml IL-17 for 24 hr. (b, c) The levels of RANKL, OPG mRNA expression were determined by real-time PCR. (d) The relative RANKL/OPG gene expression ratio was calculated based on the RANKL and OPG gene expression values measured by real-time PCR (e) The protein expression of RANKL was assayed by Western blot. The ratio of mRANKL : GAPDH intensity was described as a fold change. (f) OPG protein secretion level in supernatant was assayed by ELISA. *P < 0·05, **P < 0·01, ***P < 0·001 versus the untreated group, #P < 0·05, ##P < 0·01, ###P < 0·001 versus the IL-17 group. The data represent mean ± SEM of three independent experiments.

The involvement of TRAF6 in IL-17-dependent RANKL up-regulation

Evidence indicates that TRAF6 can regulate the activation of NF-κB and JNK signals, which result in the promotion of pro-inflammatory cytokines.25,26 However, the mechanisms of TRAF6 in IL-17-initiated NF-κB and JNK activation and RANKL/OPG regulation in hPDLC were still unknown. Hence, we performed RNA interference experiments targeted at TRAF6. As shown in Fig.4(a), the expression level of TRAF6 in hPDLC was up-regulated upon IL-17 stimulation, and the activation of TRAF6 was significantly inhibited by the siRNA for TRAF6. Treatment with siRNA for TRAF6 significantly inhibited the phosphorylation of IκBα and JNK of hPDLC. Interleukin-17-induced RANKL expression was also strongly inhibited (Fig.4b, e). Unexpectedly, the mRNA expression of OPG was inhibited in the TRAF6-deficient group without treatment with IL-17, whereas the IL-17-treated group showed no such effect (Fig.4c).

Figure 4.

Figure 4

Open in a new tab

Tumour necrosis factor receptor-associated factor 6 (TRAF6) was involved in interleukin-17 (IL-17) -mediated c-Jun N-terminal kinase (JNK) and nuclear factor-κB (NF-κB) activation and receptor activator for nuclear factor-κB (NF-κB) ligand (RANKL) up-regulation. (a) The cells transfected with scrambled (si-NC) or TRAF6 siRNA (si-TRAF6) oligonucleotides were left untreated (0) or were treated with IL-17 (50 ng/ml) for 15–60 min. Lysates were analysed by Western blot with the indicated antibodies. The fold change in protein expression was calculated as the ratio of TRAF6 or phosphorylated protein : glyceraldehyde-3-phosphate dehydrogenase (GAPDH). (b–e) Cells were transfected with either scrambled (si-NC) or TRAF6 siRNA (si-TRAF6) oligonucleotides. After 48 hr, the cells were left untreated or treated with IL-17 (50 ng/ml) for 24 hr. (b, c) Real-time PCR were employed to measure the mRNA of RANKL and osteoprotegerin (OPG). (d) The relative RANKL/OPG gene expression ratio was calculated based on the RANKL and OPG gene expression values measured by real-time PCR. (e) The protein level of RANKL was assayed by Western blot. Data are representative of three independent experiments. *P < 0·05, **P < 0·01, ***P < 0·001.

The involvement of TBK1 in IL-17-dependent RANKL up-regulation

TNF receptor associated factor (TRAF) family member-associated nuclear factor κ-light-chain enhancer of activated B cells (NF-κB) activator (TANK)-binding kinase 1 has been reported to regulate the activation of NF-κB and JNK signals mediated by IL-17.26 In the present study, the results showed that treatment with TBK1 siRNA could significantly block IL-17-dependent activation of JNK and NF-κB (Fig.5a), as well as the up-regulation of RANKL in hPDLC (Fig.5b, e). However, the mRNA expression of OPG was higher in TBK1-knocked down hPDLC than in the control treated without IL-17 (Fig.5c). In the IL-17-treated group, the mRNA expression of OPG in TBK1-deficient hPDLC was slightly higher than that in the control group, but without significance.

Figure 5.

Figure 5

Open in a new tab

TANK binding kinase 1 (TBK1) was involved in interleukin-17 (IL-17) -mediated c-Jun N-terminal kinase (JNK) and nuclear factor-κB (NF-κB) activation and receptor activator for NF-κB ligand (RANKL) up-regulation. (a) Cells transfected with scrambled (si-NC) or TBK1 siRNA (si-TBK1) oligonucleotides were left untreated (0) or treated with IL-17 (50 ng/ml) for 15–60 min, followed by Western blot analysis with indicated antibodies. The fold increase in protein expression was calculated as the ratio of TBK1 or phosphorylated protein/GAPDH. (b–e) Cells transfected with either scrambled (si-NC) or TBK1 siRNA (si-TBK1) oligonucleotides were left untreated (UN) or treated with IL-17 (50 ng/ml) for 24 hr. (b and c) Real-time PCR were employed to measure the mRNA of RANKL and osteoprotegerin (OPG). (d) The relative RANKL/OPG gene expression ratio was calculated based on the RANKL and OPG gene expression values measured by real-time PCR. (e) The protein level of RANKL was assayed by Western blot. Data are representative of three independent experiments. *P < 0·05, **P < 0·01, ***P < 0·001.

Discussion

It has been well documented that periodontal ligament cells could protect alveolar bone from bone resorption by the high expression of OPG in healthy periodontal tissue.27 But the ratio of RANKL and OPG in hPDLCs could be varied by various stimuli, including pathogens, osteolytic cytokines and orthodontic force.22 Moreover, it has been reported that direct cell–cell contact between osteoclast precursors and hPDLC could significantly induce a synergistically increased expression of osteoclastogenesis-related genes and ultimately promote the formation of osteoclasts,28 suggesting that hPDLC can support the osteoclast formation as osteoblasts. These findings indicate that hPDLC can serve as osteoclast-supporting cells to investigate the relationship between the immune response and inflammatory alveolar bone loss. Interleukin-17 is a crucial pro-inflammatory cytokine involved in a variety of inflammatory and autoimmune disorders. Recent evidence has indicated that IL-17 could promote bone destruction by enhancing the expression of RANKL in osteoclast-supporting cells and induce the differentiation of osteoclast progenitors into mature osteoclasts. Interleukin-17 stimulates the expression of IL-23 in hPDLC via IL-17 receptor signals.29 Another study shows that IL-17 can stimulate the migration of hPDLC.30 The present study has demonstrated that IL-17 could up-regulate the expression of RANKL and down-regulate the expression of OPG in hPDLC. Moreover, the up-regulated effect of IL-17 on RANKL expression was much more significant than the down-regulated effect on OPG. As a result, the ratio of RANKL to OPG in hPDLC was increased by IL-17 significantly. In the present study, the optimal concentration of IL-17 for RANKL up-regulation and OPG down-regulation was observed at 50 ng/ml. This is consistent with the previous study, which showed that the average concentration of IL-17 in gingival crevicular fluid of patients with chronic periodontitis was approximately 50 ng/ml.31 The expression of OPG mRNA decreased significantly for 6 hr, while the protein level decreased significantly for 12 hr, we hypothesize that this might be attributed to the fact that protein expression always lags behind mRNA expression. However, we cannot find such a phenomenon of RANKL expression at mRNA and protein levels. The relation between mRNA and protein is not strictly linear but has a more intrinsic and complex dependence, deviating from the classic view referred to as the molecular dogma. Different regulation mechanisms such as post-transcriptional processing, the degradation of the transcripts, translation, post-translational processing and modification, acting on both the synthesized mRNA and the synthesized protein, affect the amount of the two molecules differentially. So the effects are not exactly the same at the transcription and translation levels. It has been reported recently that Edil3−/− Il17ra−/− knockout mice were completely protected against ligature-induced periodontal bone loss.15 Hence we can reasonably suggest that the aberrant or prolonged IL-17 response in periodontal tissue could contribute to a suitable microenvironment for osteoclastogenesis via the dysregulation of RANKL and OPG system of hPDLC. Besides, it has been reported that the level of IL-17 was increased in periodontal ligament tissue subjected to orthodontic force, and IL-17 could stimulate osteoclastogenesis from human osteoclast precursor cells, suggesting that IL-17 could also aggravate the process of orthodontically induced root resorption beside the inflammatory setting.13 Notably, it has been reported recently that IL-17 could induced IL-6 production in hPDLC and stimulated osteoclastogenesis.13 As IL-17 may stimulate osteoclastogenesis via other pathways, more extensive studies are required to investigate the pro-osteoclastogenic mechanisms of IL-17 on hPDLC.

Interleukin-17 exhibits its inflammatory effects by activating NF-κB, MAPK and CCAAT-enhancer binding protein cascades to promote the expressions of a variety of pro-inflammatory chemokines and cytokines.32,33 The IL-17 can also act in synergy with TNF-α to increase the expressions of chemokine genes by promoting post-transcriptional stabilization of mRNAs induced by TNF-α.23,32,34 It has been reported that IL-17-induced IL-23 expression could be blocked through the inhibition of NF-κB, MAPK and Akt signals in hPDLC.29 Wu et al. have reported that IL-17 stimulates the migration of hPDLC via p38 MAPK/NF-κB pathways.30 In the present study, IL-17 led to significant increases in the phosphorylation of MAPK, Akt and NF-κB signals in hPDLC, further supporting the involvement of these pathways in IL-17 signalling. Further corroboration of the involvement of these intracellular signallings were provided by the blocking of IL-17-induced activation of p38, ERK1/2, JNK, Akt and NF-κB by the specific pharmacological inhibitors. All the inhibitors can inhibit IL-17-induced RANKL and OPG regulation. Notably, the enhancement of RANKL was blocked by the inhibitors of JNK, SP600125 and of NF-κB, PDTC most significantly, suggesting the critical involvement of JNK and NF-κB pathways in IL-17-induced RANKL expression.

TRAF6 plays a critical role in both the innate immunity and osteoclast development.35,36 It has been well documented that TRAF6 and its ubiquitination are important for the phosphorylation of JNK and IKK, which can activate the transcription factors AP-1 and NF-κB in various signalling pathways, such as signalling via Toll-like receptors, T-cell antigen receptors and the IL-1 receptor.37,38 Tang et al. have reported that the expression level of TRAF6 in hPDLC was markedly up-regulated upon the activation of Toll-like receptors and Nucleotide-binding oligomerization domain.39 In the present study, the expression of TRAF6 was also significantly enhanced upon IL-17 stimulation. Accumulated evidence suggests that upon IL-17 stimulation, TRAF6 will be recruited to the IL-17 receptor-associated signalling complex via the adapter Act1 and activate the downstream signals subsequently.40 In the present study, TRAF6 has been demonstrated as a critical signal for IL-17-induced JNK and NF-κB activation in hPDLC, as well as IL-17-induced RANKL up-regulation. Hence, in addition to the involvement in the promotion of pro-inflammatory cytokines, TRAF6 is also indispensable for the regulation of osteoclastogenic components induced by IL-17. However, the precise mechanism of TRAF6 activating the downstream signals is still unclear and needs further investigation.

TBK1 is well known as a key signal transducer in innate immune response stimulated by infection, which leads to the activation of NF-κB and the up-regulation of pro-inflammatory cytokines and chemokines.41,42 However, Qu et al. identified that TBK1 could suppress the NF-κB and JNK activation mediated by IL-17 instead of activating NF-κB and JNK.26 This raises doubts as to how TBK1 regulated the NF-κB and JNK pathways and the regulation of RANKL and OPG mediated by IL-17 in hPDLC. Our results showed that knocking down the expression of TBK1 in hPDLC blocked the activation of JNK and NF-κB cascades and the up-regulation of RANKL induced by IL-17 significantly. It has been reported that TBK1 is structurally related to IKK kinases (IKKα and IKKβ) and shares some substrates, such as IκBα and P65, which are important for NF-κB activation.42,43 These could be the reason why TBK1 plays a crucial role in IL-17-induced NF-κB activation in the present study. The discrepancy with Qu et al. may be attributed to the different cell types. The details of how TBK1 signals and its interaction with other signal molecules have to be well characterized.

In this study, we found that TRAF6 was critical for the high expression of OPG in hPDLC, whereas TBK1 inhibited it. However, neither TRAF6 nor TBK1 was required for IL-17-induced down-regulation of OPG. Inconsistent with IL-17-induced RANKL expression in hPDLC, which is highly dependent on JNK and NF-κB signals, the inhibited-effect of IL-17 on OPG expression depends on MAPK, Akt and NF-κB signals. Hence, even the activation of JNK and NF-κB signals was significantly blocked in the TRAF6 or TBK1-deficient hPDLC, IL-17-triggered activation of p38, ERK1/2 and Akt were still observed, which might be responsible for IL-17-mediated down-regulation of OPG. Further investigations are required to elucidate the mechanisms of IL-17-dependent OPG regulation in hPDLC.

In conclusion, we identify that IL-17 could induce the expression of RANKL and inhibit the expression of OPG in hPDLC, and thereby, provide suitable conditions for osteoclastogenesis. The p38, ERK1/2, JNK, Akt and NF-κB signalling pathways have been involved in the biological process while NF-κB and JNK cascades have been determined to be the most critical signals for IL-17-induced RANKL expression. Both TRAF6 and TBK1 are crucial events for IL-17-mediated RANKL up-regulation in hPDLC, for their essential roles in IL-17-mediated activation of NF-κB and JNK. The identification of IL-17 as a stimulus for the regulation of the RANKL and OPG system in hPDLC and the exploration of its mechanism could benefit our understanding of the relationship between IL-17 and the inflammatory bone destruction of periodontitis. In the present study, we mainly focused on the effects of IL-17 regulation of RANKL and OPG in hPDLC under a normal setting. However, we understand that the inclusion of a more physiological setting is better for data analysis and discussion, and it will be considered in our further study. Given the knowledge that humanized anti-interleukin-17 (anti-IL-17) mAb has become a promising therapy for various inflammatory disorders, including rheumatoid arthritis, psoriasis and other autoimmune conditions,33,44 our findings could be contributed to the development of new therapeutic approaches for periodontitis.

Acknowledgments

There are no conflicts of interest to declare. This study was supported by grants from the National Natural Science Foundation of China (Grants No. 81170962 & 81470749), Project of Science and Technology Department of Jiangsu Province (Grant No. BK2011763) and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, 2014-37).

Glossary

IL-17

interleukin-17

hPDLC

human periodontal ligament cells

RANKL

nuclear factor-κB ligand

OPG

osteoprotegerin

MAPK

mitogen-activated protein kinase

ERK

extracellular regulated protein kinases

JNK

c-Jun N-terminal kinase

NF-κB

nuclear factor-κB

AP-1

Activator Protein-1

TRAF6

tumour necrosis factor receptor-associated factor 6

TBK1

TANK binding kinase 1

Disclosures

The authors declare that there are no conflicts of interest.

References

  1. Gor DO, Rose NR, Greenspan NS. TH1-TH2: a procrustean paradigm. Nat Immunol. 2003;4:503–5. doi: 10.1038/ni0603-503. [DOI] [PubMed] [Google Scholar]
  2. Korn T, Bettelli E, Oukka M, Kuchroo VK. IL-17 and Th17 Cells. Annu Rev Immunol. 2009;27:485–517. doi: 10.1146/annurev.immunol.021908.132710. [DOI] [PubMed] [Google Scholar]
  3. Tesmer LA, Lundy SK, Sarkar S, Fox DA. Th17 cells in human disease. Immunol Rev. 2008;223:87–113. doi: 10.1111/j.1600-065X.2008.00628.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bettelli E, Korn T, Kuchroo VK. Th17: the third member of the effector T cell trilogy. Curr Opin Immunol. 2007;19:652–7. doi: 10.1016/j.coi.2007.07.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bi Y, Liu G, Yang R. Th17 cell induction and immune regulatory effects. J Cell Physiol. 2007;211:273–8. doi: 10.1002/jcp.20973. [DOI] [PubMed] [Google Scholar]
  6. Raychaudhuri SP. Role of IL-17 in psoriasis and psoriatic arthritis. Clin Rev Allergy Immunol. 2013;44:183–93. doi: 10.1007/s12016-012-8307-1. [DOI] [PubMed] [Google Scholar]
  7. Cardoso CR, Garlet GP, Crippa GE, Rosa AL, Junior WM, Rossi MA, Silva JS. Evidence of the presence of T helper type 17 cells in chronic lesions of human periodontal disease. Oral Microbiol Immunol. 2009;24:1–6. doi: 10.1111/j.1399-302X.2008.00463.x. [DOI] [PubMed] [Google Scholar]
  8. Shaker OG, Ghallab NA. IL-17 and IL-11 GCF levels in aggressive and chronic periodontitis patients: relation to PCR bacterial detection. Mediators Inflamm. 2012;2012:174764. doi: 10.1155/2012/174764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Adibrad M, Deyhimi P, Ganjalikhani HakemiM, Behfarnia P, Shahabuei M, Rafiee L. Signs of the presence of Th17 cells in chronic periodontal disease. J Periodontal Res. 2012;47:525–31. doi: 10.1111/j.1600-0765.2011.01464.x. [DOI] [PubMed] [Google Scholar]
  10. Zhao L, Zhou Y, Xu Y, Sun Y, Li L, Chen W. Effect of non-surgical periodontal therapy on the levels of Th17/Th1/Th2 cytokines and their transcription factors in Chinese chronic periodontitis patients. J Clin Periodontol. 2011;38:509–16. doi: 10.1111/j.1600-051X.2011.01712.x. [DOI] [PubMed] [Google Scholar]
  11. Moon YM, Yoon BY, Her YM, et al. IL-32 and IL-17 interact and have the potential to aggravate osteoclastogenesis in rheumatoid arthritis. Arthritis Res Ther. 2012;14:R246. doi: 10.1186/ar4089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Zhang F, Wang CL, Koyama Y, et al. Compressive force stimulates the gene expression of IL-17s and their receptors in MC3T3-E1 cells. Connect Tissue Res. 2010;51:359–69. doi: 10.3109/03008200903456942. [DOI] [PubMed] [Google Scholar]
  13. Hayashi N, Yamaguchi M, Nakajima R, Utsunomiya T, Yamamoto H, Kasai K. T-helper 17 cells mediate the osteo/odontoclastogenesis induced by excessive orthodontic forces. Oral Dis. 2012;18:375–88. doi: 10.1111/j.1601-0825.2011.01886.x. [DOI] [PubMed] [Google Scholar]
  14. Huang H, Kim HJ, Chang EJ, Lee ZH, Hwang SJ, Kim HM, Lee Y, Kim HH. IL-17 stimulates the proliferation and differentiation of human mesenchymal stem cells: implications for bone remodeling. Cell Death Differ. 2009;16:1332–43. doi: 10.1038/cdd.2009.74. [DOI] [PubMed] [Google Scholar]
  15. Eskan MA, Jotwani R, Abe T, et al. The leukocyte integrin antagonist Del-1 inhibits IL-17-mediated inflammatory bone loss. Nat Immunol. 2012;13:465–73. doi: 10.1038/ni.2260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Yasuda H, Shima N, Nakagawa N, et al. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA. 1998;95:3597–602. doi: 10.1073/pnas.95.7.3597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Nakashima T, Kobayashi Y, Yamasaki S, Kawakami A, Eguchi K, Sasaki H, Sakai H. Protein expression and functional difference of membrane-bound and soluble receptor activator of NF-kappaB ligand: modulation of the expression by osteotropic factors and cytokines. Biochem Biophys Res Commun. 2000;275:768–75. doi: 10.1006/bbrc.2000.3379. [DOI] [PubMed] [Google Scholar]
  18. Han X, Lin X, Yu X, Lin J, Kawai T, LaRosa KB, Taubman MA. Porphyromonas gingivalis infection-associated periodontal bone resorption is dependent on receptor activator of NF-kappaB ligand. Infect Immun. 2013;81:1502–9. doi: 10.1128/IAI.00043-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Belibasakis GN, Bostanci N. The RANKL-OPG system in clinical periodontology. J Clin Periodontol. 2012;39:239–48. doi: 10.1111/j.1600-051X.2011.01810.x. [DOI] [PubMed] [Google Scholar]
  20. Hasegawa T, Yoshimura Y, Kikuiri T, Yawaka Y, Takeyama S, Matsumoto A, Oguchi H, Shirakawa T. Expression of receptor activator of NF-kappa B ligand and osteoprotegerin in culture of human periodontal ligament cells. J Periodontal Res. 2002;37:405–11. doi: 10.1034/j.1600-0765.2002.01603.x. [DOI] [PubMed] [Google Scholar]
  21. Nishijima Y, Yamaguchi M, Kojima T, Aihara N, Nakajima R, Kasai K. Levels of RANKL and OPG in gingival crevicular fluid during orthodontic tooth movement and effect of compression force on releases from periodontal ligament cells in vitro. Orthod Craniofac Res. 2006;9:63–70. doi: 10.1111/j.1601-6343.2006.00340.x. [DOI] [PubMed] [Google Scholar]
  22. Kanzaki H, Chiba M, Shimizu Y, Mitani H. Periodontal ligament cells under mechanical stress induce osteoclastogenesis by receptor activator of nuclear factor kappaB ligand up-regulation via prostaglandin E2 synthesis. J Bone Miner Res. 2002;17:210–20. doi: 10.1359/jbmr.2002.17.2.210. [DOI] [PubMed] [Google Scholar]
  23. Song X, Qian Y. IL-17 family cytokines mediated signaling in the pathogenesis of inflammatory diseases. Cell Signal. 2013;25:2335–47. doi: 10.1016/j.cellsig.2013.07.021. [DOI] [PubMed] [Google Scholar]
  24. Ouyang H, McCauley LK, Berry JE, D’Errico JA, Strayhorn CL, Somerman MJ. Response of immortalized murine cementoblasts/periodontal ligament cells to parathyroid hormone and parathyroid hormone-related protein in vitro. Arch Oral Biol. 2000;45:293–303. doi: 10.1016/s0003-9969(99)00142-9. [DOI] [PubMed] [Google Scholar]
  25. Schwandner R, Yamaguchi K, Cao Z. Requirement of tumor necrosis factor receptor-associated factor (TRAF)6 in interleukin 17 signal transduction. J Exp Med. 2000;191:1233–40. doi: 10.1084/jem.191.7.1233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Qu F, Gao H, Zhu S, et al. TRAF6-dependent Act1 phosphorylation by the IkappaB kinase-related kinases suppresses interleukin-17-induced NF-kappaB activation. Mol Cell Biol. 2012;32:3925–37. doi: 10.1128/MCB.00268-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wada N, Maeda H, Tanabe K, Tsuda E, Yano K, Nakamuta H, Akamine A. Periodontal ligament cells secrete the factor that inhibits osteoclastic differentiation and function: the factor is osteoprotegerin/osteoclastogenesis inhibitory factor. J Periodontal Res. 2001;36:56–63. doi: 10.1034/j.1600-0765.2001.00604.x. [DOI] [PubMed] [Google Scholar]
  28. Bloemen V, Schoenmaker T, de Vries TJ, Everts V. Direct cell-cell contact between periodontal ligament fibroblasts and osteoclast precursors synergistically increases the expression of genes related to osteoclastogenesis. J Cell Physiol. 2010;222:565–73. doi: 10.1002/jcp.21971. [DOI] [PubMed] [Google Scholar]
  29. Zhu L, Wu Y, Wei H, Xing X, Zhan N, Xiong H, Peng B. IL-17R activation of human periodontal ligament fibroblasts induces IL-23 p19 production: Differential involvement of NF-kappaB versus JNK/AP-1 pathways. Mol Immunol. 2011;48:647–56. doi: 10.1016/j.molimm.2010.11.008. [DOI] [PubMed] [Google Scholar]
  30. Wu Y, Zhu L, Liu L, Zhang J, Peng B. Interleukin-17A stimulates migration of periodontal ligament fibroblasts via p38 MAPK/NF-kappaB -dependent MMP-1 expression. J Cell Physiol. 2014;229:292–9. doi: 10.1002/jcp.24444. [DOI] [PubMed] [Google Scholar]
  31. Vernal R, Dutzan N, Chaparro A, Puente J, Antonieta Valenzuela M, Gamonal J. Levels of interleukin-17 in gingival crevicular fluid and in supernatants of cellular cultures of gingival tissue from patients with chronic periodontitis. J Clin Periodontol. 2005;32:383–9. doi: 10.1111/j.1600-051X.2005.00684.x. [DOI] [PubMed] [Google Scholar]
  32. Song X, Qian Y. The activation and regulation of IL-17 receptor mediated signaling. Cytokine. 2013;62:175–82. doi: 10.1016/j.cyto.2013.03.014. [DOI] [PubMed] [Google Scholar]
  33. van den Berg WB, McInnes IB. Th17 cells and IL-17 a–focus on immunopathogenesis and immunotherapeutics. Semin Arthritis Rheum. 2013;43:158–70. doi: 10.1016/j.semarthrit.2013.04.006. [DOI] [PubMed] [Google Scholar]
  34. Sun D, Novotny M, Bulek K, Liu C, Li X, Hamilton T. Treatment with IL-17 prolongs the half-life of chemokine CXCL1 mRNA via the adaptor TRAF5 and the splicing-regulatory factor SF2 (ASF) Nat Immunol. 2011;12:853–60. doi: 10.1038/ni.2081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang Y, Zhang P, Liu Y, Cheng G. TRAF-mediated regulation of immune and inflammatory responses. Sci China Life Sci. 2010;53:159–68. doi: 10.1007/s11427-010-0050-3. [DOI] [PubMed] [Google Scholar]
  36. Lomaga MA, Yeh WC, Sarosi I, et al. TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling. Genes Dev. 1999;13:1015–24. doi: 10.1101/gad.13.8.1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mao R, Fan Y, Mou Y, Zhang H, Fu S, Yang J. TAK1 lysine 158 is required for TGF-beta-induced TRAF6-mediated Smad-independent IKK/NF-kappaB and JNK/AP-1 activation. Cell Signal. 2011;23:222–7. doi: 10.1016/j.cellsig.2010.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Chen F, Du Y, Zhang Z, Chen G, Zhang M, Shu HB, Zhai Z, Chen D. Syntenin negatively regulates TRAF6-mediated IL-1R/TLR4 signaling. Cell Signal. 2008;20:666–74. doi: 10.1016/j.cellsig.2007.12.002. [DOI] [PubMed] [Google Scholar]
  39. Tang L, Zhou XD, Wang Q, Zhang L, Wang Y, Li XY, Huang DM. Expression of TRAF6 and pro-inflammatory cytokines through activation of TLR2, TLR4, NOD1, and NOD2 in human periodontal ligament fibroblasts. Arch Oral Biol. 2011;56:1064–72. doi: 10.1016/j.archoralbio.2011.02.020. [DOI] [PubMed] [Google Scholar]
  40. Qian Y, Liu C, Hartupee J, et al. The adaptor Act1 is required for interleukin 17-dependent signaling associated with autoimmune and inflammatory disease. Nat Immunol. 2007;8:247–56. doi: 10.1038/ni1439. [DOI] [PubMed] [Google Scholar]
  41. Fitzgerald KA, McWhirter SM, Faia KL, et al. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat Immunol. 2003;4:491–6. doi: 10.1038/ni921. [DOI] [PubMed] [Google Scholar]
  42. Hacker H, Karin M. Regulation and function of IKK and IKK-related kinases. Sci STKE. 2006;2006:re13. doi: 10.1126/stke.3572006re13. [DOI] [PubMed] [Google Scholar]
  43. Shen F, Gaffen SL. Structure-function relationships in the IL-17 receptor: implications for signal transduction and therapy. Cytokine. 2008;41:92–104. doi: 10.1016/j.cyto.2007.11.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Leonardi C, Matheson R, Zachariae C, Cameron G, Li L, Edson-Heredia E, Braun D, Banerjee S. Anti-interleukin-17 monoclonal antibody ixekizumab in chronic plaque psoriasis. N Engl J Med. 2012;366:1190–9. doi: 10.1056/NEJMoa1109997. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES