Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Sep 4.
Published in final edited form as: Environ Microbiol. 2010 Mar 7;12(7):1878–1888. doi: 10.1111/j.1462-2920.2010.02192.x

Mutational and gene expression analysis of mtrDEF, omcA and mtrCAB during arsenate and iron reduction in Shewanella sp. ANA-3

Carolina Reyes 1, Julie N Murphy 1, Chad W Saltikov 1,*
PMCID: PMC4559585  NIHMSID: NIHMS286488  PMID: 20236164

Summary

Arsenate respiration and Fe(III) reduction are important processes that influence the fate and transport of arsenic in the environment. The goal of this study was to investigate the impact of arsenate on Fe(III) reduction using arsenate and Fe(III) reduction deficient mutants of Shewanella sp. strain ANA-3. Ferrihydrite reduction in the absence of arsenate was similar for an arsenate reduction mutant (arrA and arsC deletion strain of ANA-3) compared with wild-type ANA-3. However, the presence of arsenate adsorbed onto ferrihydrite impeded Fe(III) reduction for the arsenate reduction mutant but not in the wild-type. In an Fe(III) reduction mutant (mtrDEF, omcA, mtrCAB null mutant of ANA-3), arsenate was reduced similarly to wild-type ANA-3 indicating the Fe(III) reduction pathway is not required for ferrihydrite-associated arsenate reduction. Expression analysis of the mtr/omc gene cluster of ANA-3 showed that omcA and mtrCAB were expressed under soluble Fe(III), ferrihydrite and arsenate growth conditions and not in aerobically grown cells. Expression of arrA was greater with ferrihydrite pre-adsorbed with arsenate relative to ferrihydrite only. Lastly, arrA and mtrA were simultaneously induced in cells shifted to anaerobic conditions and exposed to soluble Fe(III) and arsenate. These observations suggest that, unlike Fe(III), arsenate can co-induce operons (arr and mtr) implicated in arsenic mobilization.

Introduction

Microbial reductive dissolution of arsenic and iron(III)-bearing minerals impacts arsenic fate and transport in aquifers (Nickson et al., 1998; 2000; Harvey et al., 2002; Smedley and Kinniburgh, 2002). Under anaerobic conditions, certain bacteria can reduce arsenate to arsenite; the latter arsenical has greater hydrologic mobility compared with arsenate (reviewed in Oremland and Stolz, 2005). Although a variety of arsenic and Fe(III)-reducing bacteria have been isolated from arsenic impacted sediments (Islam et al., 2004) (reviewed in Reyes et al., 2008), a detailed understanding of how arsenic and iron effects the metabolism of these microbes is needed.

Model metal-reducing bacteria have been used to work out the molecular mechanisms for iron and arsenate reduction. One such model, Shewanella sp. ANA-3, has detoxifying (arsC) and respiratory (arrA) arsenate reductases. The respiratory pathway (encoded by arrAB) allows the cell to couple the oxidation of an electron donor to the reduction of arsenate resulting in cell growth (Saltikov and Newman, 2003). The arsenate detoxification pathway is encoded by the ars operon, which comprises a cytoplasmic arsenate reductase (ArsC) and an ATP driven pump arsenite efflux pump (ArsAB) that extrudes arsenite out of the cell (Saltikov et al., 2003). Both arsenate and iron reduction in Shewanella sp. ANA-3 are dependent on the membrane bound tetraheme c-type cytochrome, CymA (Murphy and Saltikov, 2007; Zargar and Saltikov, 2009). The mechanism for iron reduction has been extensively investigated (reviewed in Shi et al., 2007; Fredrickson et al., 2008). In Shewanella, certain genes within the mtr/omc cluster are necessary for iron reduction. This cluster includes genes encoding for three outermembrane decaheme cytochromes (MtrF, OmcA, MtrC), two periplasmic decaheme cytochromes (MtrD and MtrA), and two outer membrane noncytochrome proteins (MtrE, MtrB) (Pitts et al., 2003). The gene synteny and sequence homologies within the mtr/omc cluster are highly conserved in many Shewanella species (Fredrickson et al., 2008). Most studies have focused on the outer membrane cytochromes MtrC and OmcA because they are required for the majority of iron oxide reduction activity in Shewanella (Shi et al., 2007). However, various mutations in mtrCAB can still exhibit Fe(III) reductase activity (Beliaev et al., 2001).

We previously generated a seven-gene deletion strain (ΔmtrDEF, ΔomcA, ΔmtrCAB, called ‘FERM’) of ANA-3 that was used to investigate how the absence of iron reduction affected the release of arsenic from columns packed with ferrihydrite-coated sand (Tufano et al., 2008). The results showed that under hydrodynamic (with flow) conditions, columns inoculated with the iron reduction deficient strain (FERM) mobilized the most arsenic compared with wild-type and iron reduction-only strains (ΔarrA, ΔarsC, called ARM1). Here, we further characterize the FERM strain for its ability to reduce arsenate-ferrihydrite minerals in batch conditions as well as other electron acceptors. We also investigated the impact of arsenate on the expression of the mtr/omc genes and how arrA and mtrA gene expression responded to a shifting from aerobic to anaerobic iron and arsenate-reducing conditions.

Results

Growth rate analysis of ANA-3 mutant strains

The first part of our study was to generate a series of mutants that (i) lacked the ability to reduce arsenate (called ‘ARM1’, arsenate reduction mutant), (ii) lacked the ability to reduce soluble and mineral forms of Fe(III) (called ‘FERM’, Fe(III) reduction mutant) and (iii) lacked both iron and arsenate reduction abilities (called ‘FARM’, Fe(III)/As(V) reduction mutant). The latter strain served as a biological control strain for background iron and arsenate reduction activities. ARM1 and FERM were generated in previous reports for investigating arsenic dependent gene expression of arr (Saltikov et al., 2005) and arsenic mobilization under hydrodynamic conditions (Tufano et al., 2008). In this report, we performed a thorough examination of the growth response of each strain to different electron acceptors. Growth rate analyses were done to characterize the phenotypes of the various Shewanella strains listed in Table 1 and are summarized in Table 2 and Fig. S1. In general, the growth phenotypes of the FERM, FARM and ARM1 strains were similar to that of the wild-type ANA-3 strain when grown on several terminal electron acceptors: fumarate, oxygen, nitrate and trimethyl-N-amine oxide (TMAO) (Table 2, Fig. S1). These results indicate that deleting the mtr/omc and/or arrA/arsC genes specifically affected growth on iron and arsenate respectively.

Table 1.

Bacterial strains, plasmids and primers used in this study.

Strain or plasmid Genotype or markers; characteristics and uses Source or reference
E. coli strains
 UQ950 E. coli DH5α λ(pir) host for cloning; F-Δ(argF-lac)169φ80dlacZ58(ΔM15)glnV44(AS)rfbD1gyrA96(NalR) recA1 endA1 spoT1 thi-1 hsdR17 deoR λpir+ Saltikov and Newman (2003)
 WM3064 Donor strain for conjugation: thrB1004 pro thi rpsL hsdS lacZΔM15 RP4-1360 Δ(araBAD)567 ΔdapA1341::[erm pir(wt)] Saltikov and Newman (2003)
Shewanella strains
 Shewanella sp. ANA-3 Isolated from an As-treated wooden pier pilling in a brackish estuary (Eel Pond, Woods, Hole, MA) Saltikov et al. (2003)
 ARMI Shewanella sp. ANA-3; ΔarrA(Shewana3_2341),ΔarsC(Shewana3_2345) Saltikov et al. (2005)
 FERM Shewanella sp. ANA-3; ΔmtrD(Shewana3_2672), ΔmtrE(Shewana3_2673), ΔmtrF(Shewana3_2674), ΔomcA(Shewana3_2674), ΔmtrC(Shewana3_2676), ΔmtrA(Shewana3_2677), ΔmtrB(Shewana3_2678) This study
 FARM Shewanella sp. ANA-3; ΔarrA, ΔarsC, ΔmtrD, ΔmtrE, ΔmtrF, ΔomcA, ΔmtrC, ΔmtrA, ΔmtrB This study
Plasmid
 pSMV10 9.1 kb mobilizable suicide vector; oriR6K, mobR4, sacB, Kmr,Gmr Saltikov and Newman (2003)
Deletion primers 5′ to 3′
 X-mtrD-A GGACTAGTGCCGTCAAATAGAGGT
 X-mtrD-B [CCCATCCAGCATGCTTAAACA]TTCCCGAGTGCGTTTTAT
 X-mtrB-C [TGTTTAAGCATGCTGGATGGG]GATAGTCAAAAGCCCGCACTG
 X-mtrB-D GGACTAGTGCAATTCGGCCTGACACAGTT
qPCR Primers
 qmtrD-F2 AACGCTCATCCCATCCATT
 qmtrD-R1 CGCTCATTTGCTTCAGACT
 qmtrE-F1 CCGTTATTCACCTGCTTGGT
 qmtrE-R1 AAGGGTTGCTCGGACTTTG
 qmtrF-F1 TCTATGCTAACTGGGGAACC
 qmtrF-R1 AGTGTAAGTGCCGTTGCTG
 qomcA-F1 ATCCACGCTATCCACAAAGG
 qomcA-R2 TGTAATGAACCACCGTAACCAA
 qomcB-F1 TCACCAACGAAGACGATTTG
 qomB-R2 GAGGCATTACCAGCACCTGT
 qmtrA-F1 CTTGCCACGGACCTATGG
 qmtrA-R1 ACGCTGTTTTGCTTGTCG
 qmtrB-F2 GCAACAGCCTTCTACAACCA
 qmtrB-R2 CCAACCACATCCACTTTGTC
Open in a new tab

SpeI sites are underlined; the bracketed areas are the 21 bp PCR linkers with SphI sites underlined.

Table 2.

Growth rates of ANA-3 wild-type and mutants for different terminal electron acceptors.

Strain TMAO (h−1) Fumarate (h−1) Nitrate (h−1) Arsenate (h−1) Oxygen (h−1)
ANA-3 0.7 ± 0.05 0.7 ± 0.03 0.3 ± 0.07 0.8 ± 0.06 0.4 ± 0.04
FERM 0.8 ± 0.02 0.7 ± 0.04 0.3 ± 0.03 0.9 ± 0.07 0.4 ± 0.03
ARM1 0.7 ± 0.03 0.6 ± 0.11 0.2 ± 0.03 – 0.4 ± 0.00
FARM 0.7 ± 0.02 0.7 ± 0.06 0.3 ± 0.07 – 0.4 ± 0.01
Open in a new tab

Data represent averages and standard deviations of quadruplicate cultures.

Membrane cytochrome content of ANA-3

After characterizing the phenotypes of the mtr/omc and arrA/arsC mutant strains, we next examined the total cytochrome content in these strains. Table 3 summarizes the pyridine-hemochrome analysis of total membrane prepared from anaerobically and aerobically grown ANA-3 and FERM cells. In general, the wild-type had 1.4- to 2-fold higher c-type haem content compared with total membranes prepared from the FERM strain. Haem staining of total membrane protein preparations from FERM cells, grown under aerobic and anaerobic conditions, showed very little to no cytochromes when compared with the wild-type ANA-3 samples (Fig. S2). These results indicate that the mtr/omc gene cluster encode nearly 50% of the total membrane-associated cytochromes.

Table 3.

Haem content of wild-type and FERM strains of ANA-3 grown on different terminal electron acceptors.

Terminal electron acceptor Wild-type (μmol haem per g protein) FERM (μmol haem per g protein)
Fumarate 3.1 ± 0.27 1.7 ± 0.46
Arsenate 2.5 ± 0.11 1.3 ± 0.18
TMAO 1.4 ± 0.09 1.0 ± 0.04
Nitrate 2.0 ± 0.65 1.4 ± 0.02
Oxygen 1.7 ± 0.46 0.9 ± 0.17
Open in a new tab

Data represent averages and standard deviations of triplicate samples.

Incubations of arsenate-ferrihydrite with ANA-3 strains

Next we determined the iron and arsenate reducing capabilities of the mutant Shewanella sp. ANA-3 strains. This was carried out using batch growth conditions and ferrihydrite (8 mM) presorbed with 1 mM arsenate. Based on an Fe(III) surface site density of 2.2 sites nm−2 we calculate 5.8% of the iron mineral was covered by arsenate and 4.1% by phosphate. Approximately 300 μM of arsenate was detected in solution at the initial time point, indicating that arsenic desorption had occurred prior to inoculation with cells (Fig. 1A). Within 48 h, 300 μM of the dissolved arsenate was reduced to arsenite in the incubations with the wild-type and FERM strains (Fig. 1A and B). Conversely, no dissolved arsenite was detected for the arsenate reduction mutants (ARM1 and FARM) and no-cell control (Fig. 1B). Solid-phase arsenic was determined at the final time point, 144 h, for incubations of each strain (Fig. 1C). Approximately 90% of the adsorbed arsenic was arsenite for the wild-type and FERM strains (Fig. 1C). Conversely, 95% of the adsorbed arsenic remained as arsenate in the ARM1, FARM and no cell incubations (Fig. 1C). It is concluded that deleting the mtr/omc genes had no observable effect on mineral-associated arsenate reduction.

Fig. 1. Measured concentrations of arsenate and arsenite in incubations with wild-type FERM, FARM and ARM1 null mutants incubated with arsenate-equilibrated ferrihydrite.

Fig. 1

Open in a new tab

A. Dissolved concentrations of arsenate.

B. Dissolved concentrations of arsenite.

C. Concentrations of solid-phase arsenate and arsenite determined at 144 h. Symbols correspond to: ○, No cell; ✕, FARM; ▲, ARM1; ●, ANA-3; □, FERM. The data points and error bars represent the means and standard deviations of triplicate samples respectively.

Because the ARM1 strain reduces Fe(III) and not arsenate, we were interested in determining if arsenate would affect its ability to reduce ferrihydrite presorbed with arsenate. In the absence of arsenate, the wild-type and ARM1 strains showed similar trends in ferrihydrite (Fig. 2A) and Fe(III)-citrate (Fig. 2C) reduction. In cultures containing ferrihydrite and the FERM strain, only minor increases in Fe(II) were observed, which was similar to the FARM strain and the no-cell control (Fig. 2A). In addition to being deficient in reduction of ferrihydrite, the FERM (and FARM) strain was completely deficient in soluble Fe(III)-citrate reduction (Fig. 2C). The iron reduction phenotype for ARM1 and the wild-type were different when grown with arsenate presorbed onto ferrihydrite. Fe(III)-reduction by the wild-type appeared to be unaffected by the presence of arsenate (Fig. 2B). However, the ARM1 strain reduced 50% less Fe(III) than the wild-type ANA-3. These results demonstrate that the presence of arsenate negatively affected iron reduction in strains that cannot reduce arsenate.

Fig. 2.

Fig. 2

Open in a new tab

Measured total concentration of Fe(II) in incubations with wild-type, FERM, FARM and ARM1 null mutants in batch cultures containing: (A) ferrihydrite, (B) arsenate presorbed onto ferrihydrite and (C) Fe(III) citrate. Symbols correspond to: □, No cell; ◆, FARM; ○, ARM1; ●, ANA-3; ▲, FERM. The data points and error bars represent the means and standard deviations of triplicate samples respectively.

Quantitative expression of omc/mtr iron reduction genes relative to gyrB

To further investigate the effects of arsenate on the iron reduction, we used quantitative RT-PCR (qRT-PCR) to monitor the expression of the omc/mtr cluster relative to the housekeeping gene, gyrB (DNA gyrase) in the wild-type under several growth conditions. Total RNA was extracted from cultures grown to mid-log phase (OD600, 0.1) aerobically or anaerobically with either 10 mM Fe(III) oxide, 10 mM Fe(III)-AsV oxide, 10 mM Fe(III) citrate or 10 mM arsenate as the terminal electron acceptor. Expression of mtrC and mtrB was greater than the other mtr/omc genes in samples grown on Fe(III) oxide followed by mtrA and omcA (Fig. 3). Little to no expression was detected for the mtrDEF genes in RNA prepared from samples grown with oxygen, arsenate, Fe(III) citrate and Fe(III) oxide (Fig. 3). Expression of the omcAmtrCAB genes was very low when samples were grown on oxygen. Surprisingly, omcAmtrCAB genes were expressed in samples grown on arsenate and showed a two- to fourfold increase in expression over samples grown on Fe(III) citrate (Fig. 3). Expression of mtrA and arrA were also determined in cells grown on arsenate presorbed onto ferrihydrite. Expression of mtrA was similar to cells grown either on arsenate or ferrihydrite. Transcriptional patterns of arrA showed its expression was highest under arsenate only conditions compared with samples grown on ferrihydrite and arsenate or ferrihydrite alone. These results show that the highest expression of omcAmtrCAB genes occurs in the presence of iron oxide or arsenate. Additionally, these results imply that the omcAmtrCAB genes are expressed in response to anaerobic conditions and that growth on oxygen represses the expression of these genes.

Fig. 3.

Fig. 3

Open in a new tab

Expression of mtrDEFomcAmtrCAB and arrA genes relative to that of housekeeping gene gyrB in wild-type Shewanella sp. strain ANA-3 as determined by quantitative RT-PCR. Transcriptional patterns of mtrDEFomcAmtrCAB and arrA were done for ANA-3 grown aerobically and anaerobically with different terminal electron acceptors. Relative expression refers to the ng genomic equivalent of mRNA for each gene normalized to the ng equivalent of mRNA for the DNA gyrase gene, gyrB. Data points represent the averages and standard deviations of mRNA extracts from triplicate cultures. Expression of arrA was not measured under oxygen or Fe(III) citrate conditions.

Expression analysis of arrA and mtrA genes relative to 16S rRNA gene

Having determined that arsenate, soluble and insoluble Fe(III) induces the expression of the omcAmtrCAB and given that arsenate triggers the expression of the arr genes, we were interested in knowing the relative order of expression of these genes when ANA-3 encounters both arsenate and Fe(III). To examine the induction of iron and arsenic reduction pathways, upon iron and arsenic exposure, we performed an aerobic-anaerobic shift experiment with ANA-3. We selected mtrA as a target for expression of the iron cluster genes under soluble iron-reducing conditions because MtrA is involved in reducing Fe(III) citrate (Pitts et al., 2003). The wild-type ANA-3 was grown aerobically to mid-log growth phase, shifted to anaerobic conditions, and induced with 10 mM Fe(III) citrate and 10 mM arsenate. The presence of arrA- and mtrA-specific mRNA was analysed by RT-PCR at several time points (0, 2, 4 and 8 h) post-shift to anaerobic conditions (Fig. 4). At the start of the shift with Fe(III) citrate and arsenate, arrA expression and mtrA expression were nearly undetectable (Fig. 4A). At 2, 4 and 8 h, arrA and mtrA expression increased (Fig. 4A, lanes 3–8 of the top and middle gels respectively). The 16S rRNA gene was detectable by RT-PCR with similar intensities for each strain and throughout the time-course (Fig. 4, bottom gel, lanes 1–8). The arrA and mtrA genes were induced approximately fivefold within 8 h post shifting into anaerobic-Fe(III) citrate/arsenate reducing conditions (Fig. 4B). Gene expression also coincided with increased arsenite (Fig. 4C) and Fe(II) concentrations (Fig. 4D). At 2 h post induction, arsenite was detectable at 2 mM. Background levels of Fe(II) were detectable at the initial time point because of its presence in the Fe(III) citrate stock solution. Nevertheless, Fe(III) reduction occurred within the 2–4 h time interval, which was a slight delay compared with the onset of arsenate reduction.

Fig. 4.

Fig. 4

Open in a new tab

Reverse transcription PCR (RT-PCR) analysis (A) of arrA (top), mtrA (middle) and 16S rRNA genes (bottom) in Shewanella sp. ANA-3 after shift from aerobic to anaerobic conditions. Duplicate cultures of ANA-3 were grown aerobically with vigorous shaking until OD600 of 0.1. The cultures were placed in an anaerobic chamber and supplemented with arsenate (10 mM) and Fe(III)-citrate (10 mM). RT-PCR for 16S rRNA gene, arrA and mtrA were carried out with RNA extracts from duplicate cultures sampled at the initial anaerobic shift (lanes 1 and 2); 2 h post shift (lanes 3 and 4); 4 h post shift (lanes 5 and 6); and 8 h post shift (lanes 7 and 8). ANA-3 genomic DNA and no DNA controls are shown in lanes 9 and 11 respectively. ‘L’ indicates 100 bp region of the DNA ladder.

B. Semi-quantitative analysis of arrA (black bars) and mtrA (white bars) gene expression was determined by subtracting the gel background from the band intensities and normalizing the difference in intensity of the arrA [RT-PCR product (top) and mtrA RT-PCR product (middle)] to the corresponding 16S rRNA gene RT-PCR product (bottom).

C and D. (C) Arsenate (white bars) and arsenite (black bars) and (D) Fe(II) concentrations determined for each time point. Data points and error bars for (C) and (D) represent the average and range for the concentrations of the duplicate cultures respectively.

Discussion

The overarching goal of this work is to address the hypothesis that arsenic contaminated groundwater is caused by Fe(III) reduction and dissolution of arsenic-bearing iron oxides (Smedley and Kinniburgh, 2002; McArthur et al., 2004; Zheng et al., 2004). However, an alternative hypothesis is emerging that arsenate reduction alone can lead to arsenic release from solid-phase arsenate-bearing minerals (Zobrist et al., 2000; Kocar et al., 2006; Tufano et al., 2008). Moreover, abiotic studies have demonstrated that arsenite can strongly adsorb to iron minerals (Dixit and Hering, 2003). Such observations raise questions about the relative role of arsenate verses iron-reducing bacteria in processes that lead to arsenic contamination of drinking water. Because most arsenate respiratory reducers can also reduce Fe(III), it is difficult to conclude which metal-reduction pathway is most influential in controlling arsenic transport.

Additional laboratory studies with model metal-reducing bacteria have shown that simultaneous Fe(III) and arsenate reduction can promote arsenic retention into a solid phase (Zobrist et al., 2000; Kocar et al., 2006). These studies were carried out with either different genera of metal-reducers or a bacterium capable of Fe(III) and arsenate reduction. As an improvement over using different genera with varying arsenate or Fe(III) reduction abilities, we used a single species, Shewanella sp. ANA-3, to generate specific mutant strains with limited capacities to reduce either Fe(III), arsenate, none or both. These strains were used to address which metal-reduction pathway was most dominant over arsenic transport (Tufano et al., 2008). When these strains (ARM1 and FERM) were examined in more detail, we found that the presence of arsenate impeded ferrihydrite reduction in the arsenate reduction deficient ANA-3 strain (deletion of arrA and arsC, ARM1 strain). Compared with the wild-type ANA-3, the arsenate reduction mutant (ARM1) reduced twofold less Fe(III) in both batch (Fig. 2B) and hydrodynamic conditions (Tufano et al., 2008). When we repeated the batch experiment with ferrihydrite in the absence of arsenate, the ARM1 strain was able to reduce Fe(III) comparable to the wild-type (Fig. 2A). We envisage several possible reasons that may contribute to this difference. First, the adsorbed arsenate may have altered the reactivity of the iron oxide surface. Studies with Shewanella putrefaciens strain CN-32, an Fe(III) and arsenate reducing bacterium, showed that Fe(III) reduction rates decreased with increasing phosphate concentrations (Borch et al., 2007). Because phosphate and arsenate have similar adsorption properties to ferrihydrite (Manning and Goldberg, 1996; Jain and Loeppert, 2000; Dixit and Hering, 2003), then the presence of arsenate on an iron oxide surface should have a similar negative impact that phosphate has on Fe(III) oxide reduction. This effect would be dependent on arsenate and phosphate surface coverage. In our batch experiments, we estimated that ~90% of the reactive Fe(III) sites should be unoccupied by phosphate or arsenate. Therefore, it is unlikely that the arsenate surface coverage was a significant factor in the decreased Fe(III) reduction observed for the ARM1 strain relative to wild-type ANA-3. Second, ARM1 may be more sensitive to arsenate compared with the wild-type and FERM strain. The lack of an internal arsenate reductase could lead to accumulation of toxic levels of arsenate in the cytoplasm, which would impede growth of the strain. However, ARM1 and wild-type have similar growth phenotypes with fumarate containing 10 mM arsenate (Saltikov et al., 2005), indicating that arsenate toxicity may not be a factor. Third, because the ARM1 strain is not able to reduce and grow on arsenate, lower cell numbers relative to wild-type might have been present in the ARM1 batch cultures. This could result in less Fe(III) reduction compared with the wild-type and FERM strains. Since we did not determine the cell densities throughout the time-course, we cannot rule out this third possibility.

Because single gene deletions in mtrC or omcA (as shown in Shewanella oneidensis MR-1) are not completely deficient in Fe(III) reduction (Beliaev et al., 2001), we needed a strain that would be completely deficient in iron reduction. We constructed FERM, a strain lacking mtrDEFomcAmtrCAB, with the expectation to obtain a complete Fe(III) reduction deficient strain. As expected, this strain exhibited very little Fe(III) reduction abilities both for soluble and hydr(oxide) forms of iron. When originally tested under hydrodynamic conditions, FERM showed the greatest release of arsenic (as arsenite) from ferrihydrite-coated sands compared with the wild-type and ARM1 strain (Tufano et al., 2008). However, we did not know if deleting the mtrDEF omcA mtrCAB caused secondary growth defects or altered its arsenate reduction abilities. Using batch growth conditions, we showed that the FERM strain reduced arsenate similarly to the wild-type ANA-3 strain. In the absence of iron reduction under batch conditions, arsenate reduction alone is sufficient to reduce adsorbed and dissolved arsenate. However, under flow conditions, simultaneous iron and arsenate reduction can increase arsenic retention on ferrihydrite-coated sands, probably as a secondary iron-arsenic mineral.

In our batch incubations, ferrihyrdite reduction by the FERM strain, although extremely low, was not completely abolished. The low background Fe(III)-oxide reduction may have involved other c-type cytochromes. Shewanella species are known to have over 40 genes encoding for various c-type cytochromes (Meyer et al., 2004; Hau and Gralnick, 2007). Haem profiles for FERM showed that the strain still expressed some membrane-associated cytochromes (Fig. S1). Two additional genes are present in ANA-3 that may encode for outer membrane multiheme c-type cytochromes (Shewana3_1409 and Shewana3_ 2787). However, we did not test if these genes were expressed under iron-reducing conditions. Background Fe(III) reduction could also be due to secretion of organic ligands and electron shuttling molecules such as flavins (Taillefert et al., 2007; von Canstein et al., 2008; Marsili et al., 2008). Decreased Fe(III) reduction activity in FERM is consistent with nearly 50% diminished cytochrome content within membrane preparations of the FERM (and FARM) strain relative to the wild-type. Although the FERM has lower cytochrome content, the mutations of mtr/omc appeared to be specific to Fe(III) reduction because FERM can grow on other terminal electron acceptors similarly to the wild-type.

Expression analysis of each gene within the mtr/omc gene cluster showed that insoluble and soluble Fe(III) as well as arsenate and fumarate can cause increased expression of the omcA mtrCAB, but not mtrDEF. This result is consistent with a past study showing that an mtrC promoter fusion to lacZ exhibited similar LacZ activity for nitrate, fumarate and iron-citrate grown cells of Shewanella oneidensis MR-1. Interestingly, a transcriptome study with Shewanella oneidensis MR-1 showed that mtrCAB mRNA was two- to eightfold lower in cells grown under metal-reducing conditions compared with fumarate-grown cells (Beliaev et al., 2005). Although no comparisons to oxygen-grown cells were made, it is likely that the mtrCAB genes in MR-1 were induced under anaerobic conditions relative to aerobic conditions. The mechanism for this aerobic-anaerobic regulation likely involves cAMP-CRP. Previously, we showed that cAMP-CRP binds upstream (~75 bp) of the arrA gene and that several CRP binding motifs are present upstream of several mtr/omc genes (Murphy et al., 2009). Moreover, a crp null mutant in ANA-3 cannot reduce Fe(III) or arsenate. Based on this observation it is highly likely that omcA and/or mtrCAB are part of the cAMP-CRP regulon. Further work will be needed to determine how omcA and mtrCAB genes are regulated.

It has been hypothesized that due to their high degree of sequence homology to mtrCAB, mtrDEF could be involved in Fe(III) reduction. Interestingly, we found no increase in the expression of the mtrDEF gene cluster in cells grown on Fe(III) and other electron acceptors. A previous study by Mclean and colleagues (2008), however, showed that the mtrDEF genes were expressed in MR-1 grown under highly aerobic chemostat conditions (50% oxygen saturation). Addition of Ca2+ to cells grown under this condition caused aggregation. The physiological relevance for this is not known. Further work is needed to determine the functional roles for mtrDEF.

We also addressed the temporal changes in arrA verses mtrA transcription from aerobic to anaerobic Fe(III)-citrate/arsenate conditions. It is possible that the mtr/omc and arr operons are differently expressed such that one is induced prior to the other. However, we found that both genes were induced within 2 h post-anaerobic shift into arsenate and Fe(III)-reducing conditions requiring nearly 8 h to reach fivefold induction compared with arrA and mtrA expression determined in aerobic grown cells (Fig. 4). It appeared that arsenate reduction preceded Fe(III) reduction. Compared with solid-phase arsenate-Fe(III) substrates, ANA-3 appeared to simultaneously reduce arsenate and Fe(III) (Campbell et al., 2006). In light of these results, the timing of Fe(III) reduction (whether soluble or solid) might be constrained by the bioavailability of arsenate and Fe(III).

In summary, our findings indicate that deleting the mtr/ omc genes (mtrDEFomcAmtrCAB) dramatically lowered the ability of ANA-3 to reduce insoluble and soluble Fe(III), but the strain is still capable of reducing arsenate and mobilizing arsenite from Fe(III) oxides. This observation demonstrates that arsenate respiration pathway alone is sufficient for reducing arsenate associated with ferrihydrite. However, deleting the arsenate reduction pathway lowers the amount of ferrihydrite ANA-3 can reduce in the presence of arsenate. Expression of the mtrc/omc genes under arsenate respiring conditions is consistent with the ability of Shewanella sp. to adapt to anoxic metal-reducing conditions in redox stratified anaerobic sediments. The order in which the arsenate respiration and Fe(III) reducing genes are expressed, along with the relative order that arsenate and Fe(III) reduction occurs, may depend on the mineralogy, total surface area on the mineral and arsenic surface coverage of the Fe(III) oxide. Additional work is needed to determine if varying the Fe(III)-oxide and arsenic conditions will lead to changes in the expression of Fe(III) and arsenate respiration genes.

Experimental procedures

Strains and plasmids

All Escherichia coli and Shewanella sp. ANA-3 strains used in this study are described in Table 1.

Mutagenesis

In-frame non-polar deletions of mtrDEF omcA mtrCAB (Shewana3_2672-Shewana3_2678; FERM; iron reduction mutant) and arrA3, arsC1 (Shewana3_2341, Shewana3_ 2345; ARM1; arsenate reduction mutant) (Saltikov et al., 2005) were generated using previously published methods (Saltikov and Newman, 2003). The primers used to generate the FERM mutant are listed in Table 1 as mtrD-A, mtrD-B, mtrB-C and mtrB-D. The arrA3, arsC1 mutations were introduced into the FERM mutant by conjugation to generate the FARM mutant (iron and arsenate reducing mutant; Shewana3_2341, Shewana3_2345, Shewana3_2672-Shewana3_2678).

Growth conditions

Standard culturing of E. coli was done in Luria–Bertani (LB) medium. Culturing of ANA-3 was done in a basal salts medium [called ‘TME’ (Saltikov et al., 2005)] with the following composition per litre: 1.5 g of NH4Cl, 0.6 g of NaH2PO4, 0.1 g of KCl, 0.5 g of yeast extract, 10 mM Hepes, 10 ml each of trace elements and vitamin solution (Kostka and Nealson, 1998), the media was adjusted to pH 7. Lactate was included in the medium as the electron donor at 20 mM final concentration. For the batch experiments yeast extract was excluded from the medium and the phosphate decreased to 500 μM. ANA-3 strains were grown at 30°C in liquid cultures shaken at 250 r.p.m. Preparation of anaerobic media and anaerobic culturing was done as previously described (Saltikov et al., 2005). The following electron acceptors were used at 10 mM: fumarate, nitrate, arsenate, TMAO, ferric citrate and ferrihydrite, unless otherwise indicated.

Growth experiments

Aerobic cultures were grown overnight in basal salts medium. The optical densities (OD) at 600 nm of each culture were adjusted to below 0.6 and standardized to each other by the addition of medium to ensure that inoculation levels for each strain were equal. Cells were inoculated at 1/100 dilution into anaerobic medium. Growth was monitored using a Spectronic 20+. Control cultures were also grown and monitored in anaerobic medium without added electron acceptor. For the analysis of aerobic conditions 20 ml cultures were grown in 250 ml Erlenmeyer flasks shaken at 250 r.p.m. All growth experiments were done in triplicates unless otherwise indicated.

Preparation of ferrihydrite

Ferrihydrite was prepared by rapid drop-wise addition of 1 N NaOH to 27 g of Fe(III) chloride (Cl3Fe6H2O) in 500 ml of water and the pH brought up to 7.5. The precipitated iron was washed four times with sterile water and resuspened in 1.9 l of Hepes buffer pH 7. The ferrihydrite was sonicated to prevent aggregation of the ferrihydrite and 100 ml of a 1 M arsenate filter sterilized solution was added. An aliquot of the supernatant was taken for arsenic measurement and the ferrihydrite-arsenate slurry incubated overnight while stirring. Following overnight incubation, the ferrihydrite-arsenate slurry was washed with Nanopure water several times and aliquots taken of each wash. Aliquots before and after the incubation as well as the washes were analysed for total arsenic with inductively coupled plasma optical emission spectrometry (ICP-OES).

Arsenate surface coverage on the synthetic ferrihydrite was determined from the estimated surface area and surface site density as described by Dzombak and Morel (1990). Based on the concentration of arsenate adsorbed to Fe(III) at the start of the experiment (700 μM) the concentration of total iron (6 g l−1), a surface area of 600 m2 g−1 and a surface site density of 2.2 sites nm−2, we calculated 5.8% of the reactive Fe(III) sites were covered by arsenate at the start of the experiment. Using the same parameters and a phosphate concentration of 500 μM, we calculated 4.1% of reactive Fe(III) sites were covered by phosphate.

Incubations with ANA-3

Ten grams of ferrihydrite adsorbed arsenate was dissolved in 1.5 l of modified TME and distributed (75 ml each) into anaerobic serum bottles. ANA-3, FERM, ARM1 and FARM strains were inoculated into these anaerobic bottles. Lactate was included in all bottles as the electron donor. Bottles were inoculated to 106 cells ml−1 initially. Aliquots were taken at 30, 48, 72 and 144 h. All manipulations were carried out in a Coy anaerobic glovebox.

Iron and arsenic analyses

At each time point aliquots were filtered through a 0.2 μm filter and stored for arsenic analysis at −80°C. Aliquots of 100 μl were acidified in 900 μl 1 N Trace Metal HCl, filtered through a 0.2 μm filter and Fe(II) measured using the Ferrozine assay (Stookey, 1970). Aliquots of 100 μl were acidified in 900 μl 6 N Trace Metal HCl for total Fe measurements. For dissolved arsenic speciation, 1 ml of filtered sample was diluted in 4 ml of Nanopure water, and processed as previously described (Langner and Inskeep, 2000; Kocar and Inskeep, 2003). Arsenic samples were measured using ICP-OES and hydride generation. Prior to the ICP-OES analysis, 5 ml samples were acidified with 1.7 ml of 5% potassium iodide in 12 N trace metal-grade HCl and mixed with 0.6% NaBH4 in 0.5% NaOH. Total dissolved arsenic was determined by adding 1 ml of filtered sample to 4 ml of 1 N trace metal-grade HCl, processed and measured as described above. Concentrations of dissolved arsenite were determined as the difference between total arsenic and dissolved arsenate. To determine arsenic species bound by the ferrihydrite solid phase, samples taken at the final time point (144 h) were prepared using previously published methods (Langner and Inskeep, 2000) and measured using ICP-OES as described above.

Semi-quantification of arrA and mtrA transcription

For the analysis of arrA and mtrA transcription, 20 ml duplicate cultures were grown aerobically in 500 ml Erlenmeyer flasks shaken at 250 r.p.m. to an OD600 of 0.1 (exponential phase of growth). Cultures were then transferred to an anaerobic chamber and amended with 10 mM arsenate and ferric citrate. Samples (1.5 ml) were removed for RNA extraction (described below) at several time points. Arsenic analysis was done on culture filtrates and total Fe(II) monitored using ferrozine assay as described above.

RNA was extracted from the cell pellets using the QIAGEN RNeasy miniprep kit according to the manufacturer’s instructions, with a final elution volume of 30 μl. DNA contamination was removed by DNase (Promega RQ1 DNase) digestion. cDNA was synthesized as previously described (Saltikov et al., 2005). RT-PCR and agarose gel electrophoresis on a 2.5% gel were used to monitor arrA, mtrA and 16S rRNA gene expression at time points 0, 2, 4 and 8 h post shift to anaerobic conditions. The efficiency of DNase treatment of RNA extracts was assessed from control cDNA reaction lacking reverse transcriptase enzyme; no RT-PCR products were detected in the control cDNA samples (data not shown). The intensities of the RT-PCR DNA bands were quantified with the ImageJ software (http://rsb.info.nih.gov/ij/). For semi-quantitative analysis, the background intensity of the negative control lane from of the arrA, mtrA and 16S rRNA gels was subtracted from the DNA band intensities for arrA, mtrA and 16S rRNA. The resulting pixel intensities for arrA and mtrA were normalized to the pixel intensities for the corresponding 16S rRNA gene.

Quantitative reverse transcriptase PCR analysis (qRT-PCR)

RNA from arsenate-grown cells was prepared as previously described (Saltikov et al., 2005). For cells grown with iron oxide, 5 ml aerobically grown ANA-3 cultures (OD600 ~0.6) were transferred to 50 ml serum bottles containing anaerobic TME with 10 mM ferrihydrite or 10 mM ferrihydrite presorbed with arsenate as the electron acceptors. Cultures were incubated at 30°C in the anaerobic chamber. Upon detection of increased Fe(II), cells were harvested from 3 ml of culture under anaerobic conditions. The cell pellets were placed on ice; resuspended in 1 ml of 0.3 M oxalic acid pH 3; and centrifuged again at 4°C to collect the cells. RNA extraction and cDNA synthesis were carried out as described above.

The real-time PCRs (30 μl) consisted of 15 μl 2× Syber-Green Taq Mix (Applied Biosystems), 300 nM of primes listed in Table 1 and 4 μl of RNA sample diluted 1/4 in nuclease-free water. Each sample was run in duplicate using the MJ Research Opticon2. The thermocycle profile consisted of 95°C for 10 min, 40 cycles of 95°C for 30 s and 60°C for 1 min, and a final denaturing cycle to examine the DNA melting curves of PCR products. Quantification of expression and normalization to DNA gyrase gene gyrB have been described elsewhere (Saltikov et al., 2005; Murphy and Saltikov, 2007; Murphy et al., 2009).

Cell fractionation and membrane preparation

ANA-3 cells were grown to an O.D. of ~0.16 for haem quantification or overnight for SDS-PAGE analysis on 10 mM fumarate, arsenate, TMAO, nitrate or aerobically on TME. Cells were harvested and centrifuged at 6000 r.p.m. for 30 min, the supernatant discarded and the pellet resuspended in 30 ml of 0.25 g l−1 sodium bicarbonate buffer pH 7.5. Cell pellets were lysed by sonicating cells at 30 s cycles at 70% amplitude with 1–2 min breaks in an ice bath at 4°C. To pellet the cell debris, the cell lysate solution was centrifuged at 10 000 r.p.m. for 30 min. To obtain the total membrane fraction, the cell lysate solution was centrifuged at 45 000 r.p.m. for 1 h in a Sorvall Ultraspeed Centrifuge with rotor T-865 at 4°C. The cellular fraction was separated from the pellet containing the total membrane fraction. This pellet was resuspended in 400 μl of 0.1% Triton X-100, 0.25 g l−1 sodium bicrabonate buffer solution pH 7.5.

Protein quantification

The Bradford Assay was used to determine total protein concentrations (Sambrook et al., 1989; Ausubel, 1999).

Haem quantification

Reduced minus oxidized spectra of total membrane preparations of ANA-3 were obtained on a Beckman DU650 spectrophotometer. Samples were analysed for haem content by a pyridine haemochrome assay (Berry and Trumpower, 1987). Briefly, 200 μl of total membrane sample was combined with 800 μl of 40% pyridine made in 200 mM NaOH in a 1 ml quartz cuvette. Total membrane samples were oxidized by adding 3 μl of potassium ferricyanide [K3Fe(CN)6] (Sigma). Samples were mixed and scanned within 1 min of adding the potassium ferricyanide, between 400 and 600 nm and the oxidized absorbance recorded. Samples were transferred to a Coy anaerobic chamber and reduced with 10 μl of a 500 mM stock of sodium dithionite in 50 mM Tris pH 10, mixed and the reduced absorbance measured within 1 min. Haem content was determined using the extinction coefficient of 21.84 mM−1 cm−1 at 550 nm for the pyridine reduced minus oxidized haemochrome spectra using the Beer–Lambert law equation. The haem concentration was normalized to the total protein content of the sample.

Supplementary Material

Supplementary

Fig. S1. Growth of ●, wild-type; ○, ARM1; ◆, FARM; ▲, FERM and □, No cell (A) aerobically or (B) anaerobically on nitrate (C) fumarate (D) TMAO and (E) arsenate. The time-course for growth was inferred from the optical density at 600 nm. The data points and error bars represent the means and standard deviations of triplicate cultures respectively.

Fig. S2. Haem staining total membrane preparations of wild-type Shewanella sp. ANA-3 (lanes 1, 3, 5, 7) and FERM (ΔmtrDEF, ΔomcA, ΔmtrCAB) (lanes 2, 4, 6, 8) strain grown on various terminal electron acceptors: fumarate (lanes 1–2), TME (lanes 3–4), TMAO (lanes 5–6), As(V) (lanes 7–8). ‘L’ indicates 20 μl of Precision Plus Protein Kaleidoscope (Bio-Rad) prestained standard. The lanes 1–8 were loaded with 60 μg of total protein onto a 10% SDS polyacrylamide gel.

Acknowledgments

The authors wish to thank Dr Rob Franks at the Institute of Marine Sciences at UC Santa Cruz for assistance with ICP-OES measurements; Professor Scott Fendorf (Stanford University) for assistance with ferrihydrite surface site reactivity calculations; Kamrun Zargar for assistance with haem quantification; and undergraduate assistants Roseanna Dueñas, Diana Arujo and Lilia Magaña. This research was supported by National Science Foundation grant EAR-0535392; UC Toxic Substances Research and Teaching Program (UCTSR & TP), UC Santa Cruz Graduate Research Mentorship Program (GRMP) and Eugene Cota Robles fellowships to C.R.; and the UC Santa Cruz Minority Biomedical Research Support (MBRS) program.

Footnotes

Additional Supporting Information may be found in the online version of this article:

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

References

  1. Ausubel FM. Short protocols in molecular biology second edition a compendium of methods from current protocols in molecular biology. In: Ausubel FM, editor. Short Protocols in Molecular Biology 4th Ed: A Compendium of Methods from Current Protocols in Molecular Biology. New York, NY, USA: John Wiley and Sons and Green Publishing Associates; 1999. pp. 10-8–10-9. [Google Scholar]
  2. Beliaev AS, Saffarini DA, McLaughlin JL, Hunnicutt D. MtrC, an outer membrane decahaem c cytochrome required for metal reduction in Shewanella putrefaciens MR-1. Mol Microbiol. 2001;39:722–730. doi: 10.1046/j.1365-2958.2001.02257.x. [DOI] [PubMed] [Google Scholar]
  3. Beliaev AS, Klingeman DM, Klappenbach JA, Wu L, Romine MF, Tiedje JM, et al. Global transcriptome analysis of Shewanella oneidensis MR-1 exposed to different terminal electron acceptors. J Bacteriol. 2005;187:7138–7145. doi: 10.1128/JB.187.20.7138-7145.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berry EA, Trumpower BL. Simultaneous determination of hemes a, b, and c from pyridine hemochrome spectra. Anal Biochem. 1987;161:1–15. doi: 10.1016/0003-2697(87)90643-9. [DOI] [PubMed] [Google Scholar]
  5. Borch T, Masue Y, Kukkadapu RK, Fendorf S. Phosphate imposed limitations on biological reduction and alteration of ferrihydrite. Environ Sci Technol. 2007;41:166–172. doi: 10.1021/es060695p. [DOI] [PubMed] [Google Scholar]
  6. Campbell KM, Malasarn D, Saltikov CW, Newman DK, Hering JG. Simultaneous microbial reduction of iron(III) and arsenic(V) in suspensions of hydrous ferric oxide. Environ Sci Technol. 2006;40:5950–5955. doi: 10.1021/es0600476. [DOI] [PubMed] [Google Scholar]
  7. von Canstein H, Ogawa J, Shimizu S, Lloyd JR. Secretion of flavins by Shewanella species and their role in extracellular electron transfer. Appl Environ Microbiol. 2008;74:615–623. doi: 10.1128/AEM.01387-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dixit S, Hering JG. Comparison of arsenic(V) and arsenic(III) sorption onto iron oxide minerals: Implications for arsenic mobility. Environ Sci Technol. 2003;37:4182–4189. doi: 10.1021/es030309t. [DOI] [PubMed] [Google Scholar]
  9. Dzombak DA, Morel FMM. Surface Complexation Modeling Hydrous Ferrric Oxide. New York, NY, USA: John Wiley and Sons; 1990. [Google Scholar]
  10. Fredrickson JK, Romine MF, Beliaev AS, Auchtung JM, Driscoll ME, Gardner TS, et al. Towards environmental systems biology of Shewanella. Nat Rev Microbiol. 2008;6:592–603. doi: 10.1038/nrmicro1947. [DOI] [PubMed] [Google Scholar]
  11. Harvey CF, Swartz CH, Badruzzaman AB, Keon-Blute N, Yu W, Ali MA, et al. Arsenic mobility and groundwater extraction in Bangladesh. Science. 2002;298:1602–1606. doi: 10.1126/science.1076978. [DOI] [PubMed] [Google Scholar]
  12. Hau HH, Gralnick JA. Ecology and biotechnology of the genus Shewanella. Annu Rev Microbiol. 2007;61:237–258. doi: 10.1146/annurev.micro.61.080706.093257. [DOI] [PubMed] [Google Scholar]
  13. Islam FS, Gault AG, Boothman C, Polya DA, Charnock JM, Chatterjee D, Lloyd JR. Role of metal-reducing bacteria in arsenic release from Bengal delta sediments. Nature. 2004;430:68–71. doi: 10.1038/nature02638. [DOI] [PubMed] [Google Scholar]
  14. Jain A, Loeppert RH. Effect of competing anions on the adsorption of arsenate and arsenite by ferrihydrite. J Environ Qual. 2000;29:1422–1430. [Google Scholar]
  15. Kocar BD, Inskeep WP. Photochemical oxidation of As(III) in ferrioxalate solutions. Environ Sci Technol. 2003;37:1581–1588. doi: 10.1021/es020939f. [DOI] [PubMed] [Google Scholar]
  16. Kocar BD, Herbel MJ, Tufano KJ, Fendorf S. Contrasting effects of dissimilatory iron (III) and arsenic (V) reduction on arsenic retention and transport. Environ Sci Technol. 2006;40:6715–6721. doi: 10.1021/es061540k. [DOI] [PubMed] [Google Scholar]
  17. Kostka J, Nealson KH. Isolation, cultivation and characterization of iron- and manganese-reducing bacteria. In: Burlage RS, Atlas R, Stahl D, Geesey G, Sayler G, editors. Techniques in Microbial Ecology. New York, NY, USA: Oxford University Press; 1998. pp. 58–78. [Google Scholar]
  18. Langner HW, Inskeep WP. Microbial reduction of arsenate in the presence of ferrihydrite. Environ Sci Technol. 2000;34:3131–3136. [Google Scholar]
  19. McArthur JM, Banerjee DM, Hudson-Edwards KA, Mishra R, Purohit R, Ravenscroft P, et al. Natural organic matter in sedimentary basins and its relation to arsenic in anoxic ground water: the example of West Bengal and its worldwide implications. Appl Geochem. 2004;19:1255–1293. [Google Scholar]
  20. McLean JS, Pinchuk GE, Geydebrekht OV, Bilskis CL, Zakrajsek BA, Hill EA, et al. Oxygen-dependent autoaggregation in Shewanella oneidensis MR-1. Environ Microbiol. 2008;10:1861–1876. doi: 10.1111/j.1462-2920.2008.01608.x. [DOI] [PubMed] [Google Scholar]
  21. Manning BA, Goldberg S. Modeling competitive adsorption of arsenate with phosphate and molybdate on oxide minerals. Soil Sci Soc Am J. 1996;60:121–131. [Google Scholar]
  22. Marsili E, Baron DB, Shikhare ID, Coursolle D, Gralnick JA, Bond DR. Shewanella secretes flavins that mediate extracellular electron transfer. Proc Natl Acad Sci USA. 2008;105:3968–3973. doi: 10.1073/pnas.0710525105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Meyer TE, Tsapin AI, Vandenberghe I, de Smet L, Frishman D, Nealson KH, et al. Identification of 42 possible cytochrome c genes in the Shewanella oneidensis genome and characterization of six soluble cytochromes. OMICS. 2004;8:57–77. doi: 10.1089/153623104773547499. [DOI] [PubMed] [Google Scholar]
  24. Murphy JN, Saltikov CW. The cymA gene encoding a tetraheme c-type cytochrome is required for arsenate respiration in Shewanella species. J Bacteriol. 2007;189:2283–2290. doi: 10.1128/JB.01698-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Murphy JN, Durbin KJ, Saltikov CW. Functional roles of arcA, etrA, cyclic AMP (cAMP)-cAMP receptor protein, and cya in the arsenate respiration pathway in Shewanella sp. strain ANA-3. J Bacteriol. 2009;191:1035–1043. doi: 10.1128/JB.01293-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Nickson R, McArthur J, Burgess W, Ahmed KM, Ravenscroft P, Rahman M. Arsenic poisoning of Bangladesh groundwater [letter] Nature. 1998;395:338. doi: 10.1038/26387. [DOI] [PubMed] [Google Scholar]
  27. Nickson RT, McArthur JM, Ravenscroft P, Burgess WG, Ahmed KM. Mechanism of arsenic release to groundwater, Bangladesh and West Bengal. Appl Geochem. 2000;15:403–413. [Google Scholar]
  28. Oremland RS, Stolz JF. Arsenic, microbes and contaminated aquifers. Trends Microbiol. 2005;13:45–49. doi: 10.1016/j.tim.2004.12.002. [DOI] [PubMed] [Google Scholar]
  29. Pitts KE, Dobbin PS, Reyes FR, Thomson AJ, Richardson DJ, Seward HE. Characterization of the Shewanella oneidensis MR-1 decaheme cytochrome MtrA. J Biol Chem. 2003;278:27758–27765. doi: 10.1074/jbc.M302582200. [DOI] [PubMed] [Google Scholar]
  30. Reyes C, Lloyd JR, Saltikov CW. Geomicrobiology of iron and arsenic in anoxic sediments. In: Ahuja S, editor. Arsenic Contamination of Groundwater: Mechanisms, Analysis, and Remediation. Hoboken, NJ, USA: John Wiley and Sons; 2008. pp. 123–146. [Google Scholar]
  31. Saltikov CW, Newman DK. Genetic identification of a respiratory arsenate reductase. Proc Natl Acad Sci USA. 2003;100:10983–10988. doi: 10.1073/pnas.1834303100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Saltikov CW, Cifuentes A, Venkateswaran K, Newman DK. The ars detoxification system is adventageous but not required for As(V)-respiration by the genetically tractable Shewanella species, strain ANA-3. Appl Environ Microbiol. 2003;69:2800–2809. doi: 10.1128/AEM.69.5.2800-2809.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Saltikov CW, Wildman RA, Jr, Newman DK. Expression dynamics of arsenic respiration and detoxification in Shewanella sp. strain ANA-3. J Bacteriol. 2005;187:7390–7396. doi: 10.1128/JB.187.21.7390-7396.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning : A Laboratory Manual. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  35. Shi L, Squier TC, Zachara JM, Fredrickson JK. Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes. Mol Microbiol. 2007;65:12–20. doi: 10.1111/j.1365-2958.2007.05783.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Smedley PL, Kinniburgh DG. A review of the source, behaviour and distribution of arsenic in natural waters. Appl Geochem. 2002;17:517–568. [Google Scholar]
  37. Stookey LL. Ferrozine – a new spectrophotometric reagent for iron. Anal Chem. 1970;42:779–781. [Google Scholar]
  38. Taillefert M, Beckler JS, Carey E, Burns JL, Fennessey CM, DiChristina TJ. Shewanella putrefaciens produces an Fe(III)-solubilizing organic ligand during anaerobic respiration on insoluble Fe(III) oxides. J Inorg Biochem. 2007;101:1760–1767. doi: 10.1016/j.jinorgbio.2007.07.020. [DOI] [PubMed] [Google Scholar]
  39. Tufano KJ, Reyes C, Saltikov CW, Fendorf S. Reductive processes controlling arsenic retention: revealing the relative importance of iron and arsenic reduction. Environ Sci Technol. 2008;42:8283–8289. doi: 10.1021/es801059s. [DOI] [PubMed] [Google Scholar]
  40. Zargar K, Saltikov CW. Lysine-91 of the tetraheme c-type cytochrome CymA is essential for quinone interaction and arsenate respiration in Shewanella sp strain ANA-3. Arch Microbiol. 2009;191:797–806. doi: 10.1007/s00203-009-0511-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zheng Y, Stute M, van Geen A, Gavrieli I, Dhar R, Simpson HJ, et al. Redox control of arsenic mobilization in Bangladesh groundwater. Appl Geochem. 2004;19:201–214. [Google Scholar]
  42. Zobrist J, Dowdle PR, Davis JA, Oremland RS. Mobilization of arsenite by dissimilatory reduction of adsorbed arsenate. Environ Sci Technol. 2000;34:4747–4753. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary

Fig. S1. Growth of ●, wild-type; ○, ARM1; ◆, FARM; ▲, FERM and □, No cell (A) aerobically or (B) anaerobically on nitrate (C) fumarate (D) TMAO and (E) arsenate. The time-course for growth was inferred from the optical density at 600 nm. The data points and error bars represent the means and standard deviations of triplicate cultures respectively.

Fig. S2. Haem staining total membrane preparations of wild-type Shewanella sp. ANA-3 (lanes 1, 3, 5, 7) and FERM (ΔmtrDEF, ΔomcA, ΔmtrCAB) (lanes 2, 4, 6, 8) strain grown on various terminal electron acceptors: fumarate (lanes 1–2), TME (lanes 3–4), TMAO (lanes 5–6), As(V) (lanes 7–8). ‘L’ indicates 20 μl of Precision Plus Protein Kaleidoscope (Bio-Rad) prestained standard. The lanes 1–8 were loaded with 60 μg of total protein onto a 10% SDS polyacrylamide gel.

NIHMS286488-supplement-Supplementary.pdf (499.9KB, pdf)

RESOURCES