Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Sep 4.
Published in final edited form as: Environ Microbiol Rep. 2014 Dec 17;7(2):180–187. doi: 10.1111/1758-2229.12217

Single amino acid substitution in homogentisate 1,2-dioxygenase is responsible for pigmentation in a subset of Burkholderia cepacia complex isolates

Laura A Gonyar 1, Sarah C Fankhauser 2, Joanna B Goldberg 1,2,*
PMCID: PMC4560265  NIHMSID: NIHMS717889  PMID: 25294803

Summary

The Burkholderia cepacia complex (Bcc) is a group of Gram-negative bacilli that are ubiquitous in the environment and have emerged over the past 30 years as opportunistic pathogens in immunocompromised populations, specifically individuals with cystic fibrosis (CF) and chronic granulomatous disease. This complex of at least 18 distinct species is phenotypically and genetically diverse. One phenotype observed in a subset of Burkholderia cenocepacia (a prominent Bcc pathogen) isolates is the ability to produce a melanin-like pigment. Melanins have antioxidant properties and have been shown to act as virulence factors allowing pathogens to resist killing by the host immune system. The melanin-like pigment expressed by B. cenocepacia is produced through tyrosine catabolism, specifically through the autoxidation and polymerization of homogentisate. Burkholderia cenocepacia J2315 is a CF clinical isolate that displays a pigmented phenotype when grown under normal laboratory conditions. We examined the amino acid sequences of critical enzymes in the melanin synthesis pathway in pigmented and non-pigmented Bcc isolates, and found that an amino acid substitution of glycine for arginine at amino acid 378 in homogentisate 1,2-dioxygenase correlated with pigment production; we identify this as one mechanism for expression of pigment in Bcc isolates.

Introduction

The Burkholderia cepacia complex (Bcc) is a group of Gram-negative bacilli that are found ubiquitously in the environment and have emerged over the past 30 years as opportunistic pathogens in immunocompromised populations, specifically cystic fibrosis (CF) and chronic granulomatous disease (CGD). This complex of at least 18 distinct species is the leading cause of bacterial infections in CGD patients, who are characterized by increased susceptibility to bacterial and fungal infections caused by genetic defects in phagocyte Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Phox) (Winkelstein et al., 2000). Bcc is a significant cause of morbidity and mortality in both CGD and CF (Winkelstein et al., 2000; Courtney et al., 2004; Holland, 2010) and reviewed in Mahenthiralingam and colleagues (2005). During the course of an infection, Bcc must combat the innate immune system in order to persist. Because of the prevalence of Bcc as CGD pathogens and the fact that CGD patients have defects in oxidative killing mechanisms, it is hypothesized that this mechanism of killing by host phagocytes is essential for Bcc clearance in healthy individuals (Zelazny et al., 2009; Greenberg et al., 2010) and reviewed in Porter and Goldberg (2011). Superoxide dismutases and catalases are enzymes commonly used to protect bacteria from oxidative damage during normal respiration and in interactions with the host innate immune response, but pathogens can also utilize additional factors that assist in protection from host oxidative killing mechanisms.

Melanins are produced by all kingdoms of life and are a normal component of human skin and hair, but they can also be exploited by pathogens to promote their own survival in human hosts. Melanins are characterized as structurally diverse, high molecular weight polymers that are composed of quinolines, which can exist in three different oxidation states (White, 1958; Nosanchuk and Casadevall, 1997; Nosanchuk et al., 1999; Jacobson, 2000). Melanins act as a trap for unpaired electrons and this activity contributes to the antioxidant role in the presence of reactive oxygen species (Sichel et al., 1991). Different types of melanins are characterized by the pathways from which they are derived. Eumelanins are synthesized from 3,4-dihydroxyphenylalanine (DOPA) by phenoloxidases. Yellow or reddish melanins incorporate cysteine with DOPA and are called pheomelanins. Melanins derived from homogentisic acid (HGA) by tyrosinases are called pyomelanin (Yabuuchi and Ohyama, 1972). Melanins formed from acetate via the polyketide synthesis pathway are called dihydroxynaphthalene melanins (Nosanchuk and Casadevall, 2006).

Melanins confer a survival advantage in the environment as well as the host. Melanins have been shown to increase microbe survival through protection from oxidative stress, digestive enzymes (in amoeboid and nematode predators, as well as phagocytes), radiation, extreme temperature and heavy metal toxicity (Nosanchuk and Casadevall, 2006). Cryptococcus neoformans, Aspergillus sp., Wangiella dermatitidis, Sporothrix schenckii and Burkholderia cepacia are all pathogens that produce melanin, but the role of melanin in defence against the host is best characterized in C. neoformans and Aspergillus species (Liu and Nizet, 2009).

The melanin-like pigment produced by B. cenocepacia C5424 was characterized in a study by Keith and colleagues, and it was shown in vitro that absence of the pigment led to an increase in sensitivity to hydrogen peroxide and extracellular superoxide (Keith et al., 2007). This study also showed that the pigment-deficient mutant colocalized to a higher extent than the wild-type strain with more degradative compartments in macrophages and that this increase in colocalization was dependent on Phox activity (Keith et al., 2007). This suggested that pigment-deficient bacteria were less protected from oxidative killing in the phagosome, and the inability to delay progression to a more degradative compartment was a potential reason for the sensitivity. The study by Keith and colleagues also began to describe the distribution of this pigmented phenotype among Bcc strains. They reported that out of the 22 B. cenocepacia isolates in their collection, only four were pigmented after 72 h of culture on L-agar. They attempted to complement the non-pigmented B. cenocepacia strain K56-2 with the 4-hydroxyphenylpyruvate dioxygenase (hppD) gene from the pigmented B. cenocepacia C5424 strain; however, this did not confer a pigmented phenotype to B. cenocepacia K56-2 (Keith et al., 2007). These data demonstrate that the pigment is important for B. cenocepacia survival in interactions with host immune cells, but it is still not understood what mechanisms allow for pigmentation in a subset of Bcc isolates.

We have identified homogentisate 1,2-dioxygenase (HmgA) as a potentially critical enzyme for regulation of pigment production. We have observed a correlation between a glycine to arginine change at residue 378 of HmgA and pigment production in members of the Bcc. This study tests the hypothesis that one mechanism for pigmentation in Bcc isolates is defective HmgA activity due to a G378R amino acid substitution.

Results and discussion

Burkholderia cenocepacia J2315 produces a melanin-like pigment

Because of the established role of the pigment produced by Bcc as a potential virulence factor, we began to characterize the expression of this pigment by B. cenocepacia J2315. Burkholderia cenocepacia J2315 is the sequenced type strain and a member of the ET-12 lineage. Burkholderia cenocepacia J2315 is a CF clinical isolate that displays a pigmented phenotype when grown under normal laboratory conditions; pigment becomes visually detectable at stationary phase.

Burkholderia cenocepacia J2315 encodes homologous genes for all enzymes in the pyomelanin synthesis pathway (Fig. 1A) but does not encode any genes required for eumelanin or pheomelanin synthesis (Kanehisa and Goto, 2000) (data not shown). Pyomelanins are synthesized through tyrosine catabolism with HGA as an intermediate. Tyrosine is converted to 4-hydroxyphenylpyruvate (4HPP) by the aromatic aminotransferase TyrB. There are two homologues to TyrB encoded in the genome of B. cenocepacia J2315: BCAL2303 and BCAM1478. 4HPP is then modified by HppD (BCAL0207) to form HGA. HGA is then released from the cell, oxidized and polymerized to form pyomelanin. HmgA facilitates diversion of HGA into an alternative pathway, resulting in the production of acetoacetic acid and fumaric acid.

Fig. 1. The pigment produced by B. cenocepacia J2315 is a pyomelanin and is synthesized through tyrosine catabolism.

Fig. 1

Open in a new tab

A. Genes homologous to enzymes involved in the pyomelanin synthesis pathway were identified in the B. cenocepacia J2315 genome using sequence homology and KEGG pathway annotations. 4-HPP, 4-hydroxyphenylpyruvate; HGA, homogentisic acid.

B. Growth of B. cenocepacia J2315 in LB with 1 mg ml−1 tyrosine resulted in increased pigment production in comparison to growth in LB without tyrosine as determined by the OD480 of the culture supernatant at 24 h.

C. An unmarked deletion mutant in the gene that encodes the last enzyme in the pathway to make the pigment, hppD (BCAL0207), was constructed in B. cenocepacia J2315 and this strain was non-pigmented. The system for making unmarked deletions through gene splicing by overlap extension described by Flannagan and colleagues (2008) was used to create B. cenocepacia J2315 ΔhppD. The deletion construct was made by amplifying the flanking regions of the gene using the following four primers: F1-XbaI (GGTCTAGAAATCGGCAACGCCGTCGTTTCCTTGAAGC), R1 (TGCCGCGCGGTGCAAGCGGTCGTGTCTCCTGTGCGG), F2 (CCGCACAGGAGACACGACCGCTTGCACCGCGCGGCA) and R2 EcoRV (GGGATATCTTCGCCGGTTTTACGGGATGGTAGCACTGG).

Previous work by Keith and colleagues defined the pigment produced by B. cenocepacia strain C5424 as a pyomelanin synthesized by this pathway (Keith et al., 2007), and we predicted that the pigment produced by J2315 would be synthesized via the same mechanism. As expected with a pigment synthesized through tyrosine catabolism, growth in tyrosine (Luria broth supplemented with 1 mg ml−1 L-tyrosine) leads to increased pigment production (Fig. 1B). Additionally, we created a deletion mutant in hppD in B. cenocepacia J2315 and this mutant, J2315 ΔhppD, exhibited a non-pigmented phenotype (Fig. 1C) that corroborates what was shown by Keith and colleagues (2007) in B. cenocepacia C5424. Since HppD is required for pyomelanin production and not involved with other melanin synthesis pathways, we concluded that B. cenocepacia J2315 is producing a pigment through the pyomelanin synthesis pathway, which had not previously been established.

Identification of amino acid substitution in HmgA

Several studies using other pathogenic bacteria have associated defects in HmgA function with a pigmented or hyperpigmented phenotype (Rodriguez-Rojas et al., 2009; Schmaler-Ripcke et al., 2009; Valeru et al., 2009; Wang et al., 2013). Since HmgA catalyses an enzymatic step that shuttles HGA into another pathway where it is further degraded to acetoacetic acid and fumaric acid, a decrease in HmgA activity would lead to accumulation of HGA and to an increase in pigment production. After aligning the inferred amino acid sequence of HmgA from publicly available Bcc sequences (NCBI, 8 September 2014), we observed a glycine to arginine amino acid change at residue 378 that only occurred in pigmented Bcc strains (Fig. 2). The glycine at this residue was conserved among Bcc isolates and in other bacterial genera (Fig. 2). To further investigate this correlation, we characterized the pigmentation phenotype and sequenced HmgA in two additional Bcc isolates that did not have public sequence data available (B. cenocepacia C3865 and C5424). The hmgA genes from B. cenocepacia C5424 and C3865 were amplified from genomic DNA using hmgA seq Fd (GCGCGATCCACCTGTATG) and hmgA seq Rv (GTTGCTCCGGATTGAAGTGT). All non-pigmented strains encoded a glycine at residue 378 (Table 1). Out of the four pigmented strains in our collection, three encoded an arginine at residue 378 (Table 1). Burkholderia cenocepacia C3865 is pigmented and encodes a glycine at residue 378. We observed differences in this strain in both the timing of pigment production and the hue of the pigment, and we hypothesize that this strain may produce pigment through an alternative, not yet defined mechanism.

Fig. 2. A glycine at residue 378 of HmgA is conserved among Bcc strains and is changed to an arginine in B. cenocepacia J2315.

Fig. 2

Open in a new tab

A. Diagram of the HmgA gene of Bcc showing iron-binding sites. The region marked in brackets corresponds to residues 363–400, which are aligned below.

B. Sequences of inferred amino acid sequence of the hmgA gene from Bcc strains from residues 364–400 were aligned to show conservation of a glycine at residue 378. Sequence identity of the entire proteins ranged between 94% and 99%.

Table 1.

Correlation of sequence identify at residue 378 of HmgA and pigment production in Bcc strains.

Strain Amino acid at residue 378 Produces pigment under normal laboratory conditions Type of isolate Lineage Reference/Assembly ID
Burkholderia cenocepacia
 J2315 R Yes CF clinical isolate ET12 (Holden et al., 2009)/ #GCF_000009485.1
 BC7 R Yes CF clinical isolate ET12 (Varga et al., 2013)/ #GCF_000333135.2
 C5424 R Yes CF clinical isolate ET12 This study
 K56-2 G No CF clinical isolate ET12 (Varga et al., 2013)/ #GCF_000333155.2
 H111 G No CF clinical isolate Not assigned (Carlier et al., 2014)
#GCF_000236215.1
 MC0-3 G No Environmental isolate III 3B #GCF_000019505.1
 AU 1054 G No CF clinical isolate PHDC #GCF_000014085.1
 C3865 G Yes CF clinical isolate ET12 This study
Burkholderia multivorans
 ATCC 17616 G No Environmental isolate #GCF_000018505.1
 CGD2 G No CGD clinical isolate (Varga et al., 2012)/ #GCF_000182275.1
 CGD1 G No CGD clinical isolate (Varga et al., 2012)/ #GCF_000182255.1
Open in a new tab

The human enzyme (termed HGO) has a crystal structure available (Titus et al., 2000) and is 52% identical at the protein level to HmgA encoded in B. cenocepacia J2315. HGO assembles as a dimer of trimers, and the active site iron ion is coordinated between subunits in the trimer. Two histidines and one glutamic acid are involved in iron binding, and they correspond to H341, E347 and H377 in the B. cenocepacia protein (Fig. 2). The G378R change occurs in this region, and this substitution could potentially disrupt iron binding and therefore enzyme function. Additionally, mutations in this region have previously been shown to inactivate HGO in the human disease alkaptonuria (Rodriguez et al., 2000).

Expression of hmgA from a non-pigmented strain results in a non-pigmented phenotype in B. cenocepacia J2315

Burkholderia cenocepacia J2315 and B. cenocepacia K56-2 both belong to the ET-12 lineage and are closely related. The hmgA gene in B. cenocepacia J2315 and K56-2 is identical except for a one base pair change (G to C) that results in the glycine (GGA) to arginine (CGA) change at residue 378 in the HmgA protein in J2315. To begin to test whether this amino acid change was responsible for the observed pigmented phenotype, we amplified the hmgA genes from B. cenocepacia J2315 (a pigmented strain that encodes an arginine at residue 378 of HmgA) and B. cenocepacia K56-2 (a non-pigmented strain that encodes a glycine at residue 378 of HmgA), referred to as JhmgA and KhmgA respectively. The amplified hmgA gene from both of these strains was then cloned into the pUCP18Tc vector and transferred to B. cenocepacia J2315 and K56-2. Burkholderia cenocepacia J2315 complemented with both its own gene (pUCP18TC-JhmgA) or the empty vector (pUCP18Tc) maintained a pigmented phenotype as measured by absorbance of the supernatant at OD480 after 24–30 h of growth (Fig. 3A). On the other hand, complementation of B. cenocepacia J2315 with KhmgA (pUCP18TC-KhmgA) resulted in a non-pigmented phenotype (Fig. 3A). Burkholderia cenocepacia K56-2 remained non-pigmented when containing any of the plasmids, but a statistically significant increase in the OD480 of the supernatant was observed when expressing JhmgA (pUCP18TC-JhmgA) in comparison to KhmgA (Fig. 3A). This minor increase in OD480 in B. cenocepacia K56-2 suggests that there may be competition for substrate between the native KHmgA and the cloned JHmgA enzymes when both are expressed. In these experiments, we did not observe any significant differences in colony-forming unit per millilitre at the 24 h time point between wild-type and complemented strains (data not shown). Additionally, we expressed both JhmgA and KhmgA in another pigmented Bcc isolate, B. cenocepacia BC7, which also has arginine at position 378 in HmgA. Burkholderia cenocepacia BC7 expressing JhmgA retained a pigmented phenotype, but consistent with what we observed with B. cenocepacia J2315, expression of KhmgA resulted in a loss of pigmentation (data not shown). These results support the hypothesis that the G378R amino acid change in HmgA encoded by B. cenocepacia J2315 and BC7 impairs enzyme activity, leading to the accumulation of visibly detectable pigment, and that an otherwise identical enzyme derived from B. cenocepacia K56-2 lacking this amino acid change is functional and eliminates visually detectable pigment production.

Fig. 3. Expression of hmgA from a non-pigmented strain results in a non-pigmented phenotype in B. cenocepacia.

Fig. 3

Open in a new tab

A. The hmgA genes from B. cenocepacia J2315 and K56-2 were amplified from genomic DNA using hmgA Fd SacI (CTAGGAGCTCATGACGCTTGACCTGTCGAAACCGGCAA) and hmgA Rv XbaI (CTAGAGATCTTCATCGTTGCTCCGGATTGA). The PCR products were cloned into TOPO pCR2.1 (Invitrogen) and then digested with SacI and XbaI. Digested inserts were ligated into similarly digested pUCP18Tc (Schweizer, 1991) and sequenced to confirm identity. pUCP18Tc and recombinant hmgA-containing plasmids were electroporated into B. cenocepacia J2315 and K56-2 using a modified version of a protocol published previously (Dubarry et al., 2010). The resultant plasmid-containing strains were grown in LB with 100 μg ml−1 tetracycline at 37°C with shaking for 24–30 h and then evaluated the level of pigmentation by assaying the OD480 of the supernatant.

B. Recombinant plasmids containing the hmgA genes from J2315 (pUCP18Tc-JhmgA), K56-2 (pUPC18Tc-KhmgA) or the vector (pUCP18Tc) were transferred to P. aeruginosa PA14 hmgA::Tn. For images of pigmented phenotypes, overnight cultures of bacteria were diluted and spotted onto agar plates, which were incubated at 37°C and visualized after 24–48 hours. Liquid cultures were incubated at 37°C in LB with 50 μg ml−1 tetracycline for plasmid-containing strains, and without for non-plasmid containing strains with shaking for 30–35 h and then evaluated for the level of pigmentation by assaying the OD480 of the supernatant.

C. Susceptibility to H2O2 of J2315 strains expressing pUCP18Tc, pUCP18Tc-KhmgA, pUCP18Tc-JhmgA was measured after exponential phase cultures were incubated for 45 min with 5 mM H2O2 and then grown out for 48 h on LB. Susceptibility was measured by calculating colony-forming units (cfu) after culture sample was incubated with 5 mM H2O2 divided by cfu of culture sample incubated in LB.

D. Susceptibility to H2O2 of PA14 WT or PA14 hmgA::Tn was measured after exponential phase cultures were incubated for 45 min with 25 mM H2O2 and then grown out for 24 h on LB. Susceptibility was measured by calculating cfu after culture sample was incubated with 25 mM H2O2 divided by cfu of culture sample incubated in LB.

Complementation of Pseudomonas aeruginosa PA14 hmgA::Tn with KHmgA but not JHmgA results in restoration of a wild-type non-pigmented phenotype

We transferred the same plasmids expressing either versions of hmgA to a Pseudomonas aeruginosa PA14 insertional mutant in hmgA, PA14 hmgA::Tn. Because of this insertion in hmgA, P. aeruginosa PA14 hmgA::Tn displays a hyperpigmented phenotype. Since this mutant has been previously characterized and has known defects in HmgA (Rodriguez-Rojas et al., 2009), we utilized it to test the functionality of JHmgA and KHmgA enzymes. Similar to what we had observed in B. cenocepacia J2315, KHmgA was able to compensate for the hmgA mutation. PA14 hmgA::Tn (pUCP18Tc-KhmgA) had a non-pigmented phenotype on agar plates and supernatants were non-pigmented after growth in Luria–Bertani (LB) for 30–35 h in LB (Fig. 3B). On the other hand, expression of JhmgA was unable to complement this phenotype (Fig. 3B). These data suggest that the KHmgA enzyme is functional and leads to an absence of pigment due to conversion of excess HGA to acetoacetic acid and fumaric acid.

Expression of KhmgA in B. cenocepacia J2315 does not alter susceptibility to H2O2

In other systems, it has been shown that pyomelanin production protects against H2O2 (Keith et al., 2007; Rodriguez-Rojas et al., 2009). We hypothesized that B. cenocepacia J2315 pUCP18Tc-KhmgA (non-pigmented) would be more sensitive to H2O2 than the isogenic pigmented strains (J2315 containing pUCP18Tc or pUCP18Tc-JhmgA). We tested B. cenocepacia J2315 expressing KhmgA or JhmgA for sensitivity to H2O2 using two different assays. Using a standard disc assay to test sensitivity of stationary phase cultures grown on agar plates, we observed no difference in the diameter of the zones of inhibition with 50, 100, 400 or 800 mM H2O2 (data not shown). Using an assay that was previously performed with P. aeruginosa PA14 and PA14 hmgA::Tn (Rodriguez-Rojas et al., 2009), we then tested whether sensitivity to H2O2 during exponential phase growth by measuring percent survival after incubation with H2O2. We confirmed that PA14 hmgA::Tn was more resistant to 25 mM H2O2 than PA14 (Fig. 3D). However, B. cenocepacia J2315 was much more sensitive to H2O2; even at 5 mM H2O2, we noted less than 10% survival of J2315 (Fig. 3C). Under these conditions, the expression of KhmgA in B. cenocepacia J2315 did not increase susceptibility to H2O2.

Conclusions

We found that a G378R amino acid substitution in HmgA correlated with pigment production. Complementation of the pigmented phenotype of B. cenocepacia J2315 with hmgA from K56-2 resulted in a non-pigmented phenotype. These results suggest that the G378R version of HmgA is not functional and we propose that this is one mechanism that allows for pigmentation in some members of the Bcc. Melanins are protective against both oxidative and non-oxidative stresses, which could contribute to increased fitness of Bcc isolates both during infection and in the environment. While we did not observe differences in susceptibility to H2O2, this does not exclude the possibility that pyomelanin production in J2315 could be providing protection against other oxidative species. Future exploration into the correlation of HmgA functionality and fitness in different niches could provide important insight into the mechanisms for Bcc survival in the presence of both host and environmental stresses.

Acknowledgments

We thank Dr. Mariette Barbier for assistance with photography and Lucy Wang (Gwinnett School of Mathematics, Science and Technology, Junior Fellowship Experience) for her assistance in the H2O2 assays. We also thank Dr. John Varga for his assistance in bioinformatics analysis. This work was supported in part by funding from the Cystic Fibrosis Foundation (GOLDBE12P0) and the National Institutes of Health (R21-AI103653) to JBG. LAG was supported in part by the National Institutes of Health through the University of Virginia Infectious Diseases Training Grant AI07406.

References

  1. Carlier A, Agnoli K, Pessi G, Suppiger A, Jenul C, Schmid N, et al. Genome sequence of Burkholderia cenocepacia H111, a cystic fibrosis airway isolate. Genome Announc. 2014;2 doi: 10.1128/genomeA.00298-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Courtney JM, Dunbar KE, McDowell A, Moore JE, Warke TJ, Stevenson M, Elborn JS. Clinical outcome of Burkholderia cepacia complex infection in cystic fibrosis adults. J Cyst Fibros. 2004;3:93–98. doi: 10.1016/j.jcf.2004.01.005. [DOI] [PubMed] [Google Scholar]
  3. Dubarry N, Du W, Lane D, Pasta F. Improved electrotransformation and decreased antibiotic resistance of the cystic fibrosis pathogen Burkholderia cenocepacia strain J2315. Appl Environ Microbiol. 2010;76:1095–1102. doi: 10.1128/AEM.02123-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Flannagan RS, Linn T, Valvano MA. A system for the construction of targeted unmarked gene deletions in the genus Burkholderia. Environ Microbiol. 2008;10:1652–1660. doi: 10.1111/j.1462-2920.2008.01576.x. [DOI] [PubMed] [Google Scholar]
  5. Greenberg DE, Marshall-Batty KR, Brinster LR, Zarember KA, Shaw PA, Mellbye BL, et al. Antisense phosphorodiamidate morpholino oligomers targeted to an essential gene inhibit Burkholderia cepacia complex. J Infect Dis. 2010;201:1822–1830. doi: 10.1086/652807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Holden MT, Seth-Smith HM, Crossman LC, Sebaihia M, Bentley SD, Cerdeno-Tarraga AM, et al. The genome of Burkholderia cenocepacia J2315, an epidemic pathogen of cystic fibrosis patients. J Bacteriol. 2009;191:261–277. doi: 10.1128/JB.01230-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Holland SM. Chronic granulomatous disease. Clin Rev Allergy Immunol. 2010;38:3–10. doi: 10.1007/s12016-009-8136-z. [DOI] [PubMed] [Google Scholar]
  8. Jacobson ES. Pathogenic roles for fungal melanins. Clin Microbiol Rev. 2000;13:708–717. doi: 10.1128/cmr.13.4.708-717.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kanehisa M, Goto S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000;28:27–30. doi: 10.1093/nar/28.1.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Keith KE, Killip L, He P, Moran GR, Valvano MA. Burkholderia cenocepacia C5424 produces a pigment with antioxidant properties using a homogentisate intermediate. J Bacteriol. 2007;189:9057–9065. doi: 10.1128/JB.00436-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Liu GY, Nizet V. Color me bad: microbial pigments as virulence factors. Trends Microbiol. 2009;17:406–413. doi: 10.1016/j.tim.2009.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Mahenthiralingam E, Urban TA, Goldberg JB. The multifarious, multireplicon Burkholderia cepacia complex. Nat Rev Microbiol. 2005;3:144–156. doi: 10.1038/nrmicro1085. [DOI] [PubMed] [Google Scholar]
  13. Nosanchuk JD, Casadevall A. Cellular charge of Cryptococcus neoformans: contributions from the capsular polysaccharide, melanin, and monoclonal antibody binding. Infect Immun. 1997;65:1836–1841. doi: 10.1128/iai.65.5.1836-1841.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Nosanchuk JD, Casadevall A. Impact of melanin on microbial virulence and clinical resistance to antimicrobial compounds. Antimicrob Agents Chemother. 2006;50:3519–3528. doi: 10.1128/AAC.00545-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Nosanchuk JD, Valadon P, Feldmesser M, Casadevall A. Melanization of Cryptococcus neoformans in murine infection. Mol Cell Biol. 1999;19:745–750. doi: 10.1128/mcb.19.1.745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Porter LA, Goldberg JB. Influence of neutrophil defects on Burkholderia cepacia complex pathogenesis. Front Cell Infect Microbiol. 2011;1:9. doi: 10.3389/fcimb.2011.00009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Rodriguez JM, Timm DE, Titus GP, Beltran-Valero De Bernabe D, Criado O, Mueller HA, et al. Structural and functional analysis of mutations in alkaptonuria. Hum Mol Genet. 2000;9:2341–2350. doi: 10.1093/oxfordjournals.hmg.a018927. [DOI] [PubMed] [Google Scholar]
  18. Rodriguez-Rojas A, Mena A, Martin S, Borrell N, Oliver A, Blazquez J. Inactivation of the hmgA gene of Pseudomonas aeruginosa leads to pyomelanin hyperproduction, stress resistance and increased persistence in chronic lung infection. Microbiology. 2009;155:1050–1057. doi: 10.1099/mic.0.024745-0. [DOI] [PubMed] [Google Scholar]
  19. Schmaler-Ripcke J, Sugareva V, Gebhardt P, Winkler R, Kniemeyer O, Heinekamp T, Brakhage AA. Production of pyomelanin, a second type of melanin, via the tyrosine degradation pathway in Aspergillus fumigatus. Appl Environ Microbiol. 2009;75:493–503. doi: 10.1128/AEM.02077-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Schweizer HP. Escherichia-Pseudomonas shuttle vectors derived from pUC18/19. Gene. 1991;97:109–121. doi: 10.1016/0378-1119(91)90016-5. [DOI] [PubMed] [Google Scholar]
  21. Sichel G, Corsaro C, Scalia M, Di Bilio AJ, Bonomo RP. In vitro scavenger activity of some flavonoids and melanins against O2-(.) Free Radic Biol Med. 1991;11:1–8. doi: 10.1016/0891-5849(91)90181-2. [DOI] [PubMed] [Google Scholar]
  22. Titus GP, Mueller HA, Burgner J, Rodriguez De Cordoba S, Penalva MA, Timm DE. Crystal structure of human homogentisate dioxygenase. Nat Struct Biol. 2000;7:542–546. doi: 10.1038/76756. [DOI] [PubMed] [Google Scholar]
  23. Valeru SP, Rompikuntal PK, Ishikawa T, Vaitkevicius K, Sjoling A, Dolganov N, et al. Role of melanin pigment in expression of Vibrio cholerae virulence factors. Infect Immun. 2009;77:935–942. doi: 10.1128/IAI.00929-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Varga JJ, Losada L, Zelazny AM, Brinkac L, Harkins D, Radune D, et al. Draft genome sequence determination for cystic fibrosis and chronic granulomatous disease Burkholderia multivorans isolates. J Bacteriol. 2012;194:6356–6357. doi: 10.1128/JB.01306-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Varga JJ, Losada L, Zelazny AM, Kim M, McCorrison J, Brinkac L, et al. Draft genome sequences of Burkholderia cenocepacia ET12 lineage strains K56-2 and BC7. Genome Announc. 2013;1 doi: 10.1128/genomeA.00841-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wang Z, Lin B, Mostaghim A, Rubin RA, Glaser ER, Mittraparp-Arthorn P, et al. Vibrio campbellii hmgA-mediated pyomelanization impairs quorum sensing, virulence, and cellular fitness. Front Microbiol. 2013;4:379. doi: 10.3389/fmicb.2013.00379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. White LP. Melanin: a naturally occurring cation exchange material. Nature. 1958;182:1427–1428. doi: 10.1038/1821427a0. [DOI] [PubMed] [Google Scholar]
  28. Winkelstein JA, Marino MC, Johnston RB, Jr, Boyle J, Curnutte J, Gallin JI, et al. Chronic granulomatous disease. Report on a national registry of 368 patients. Medicine (Baltimore) 2000;79:155–169. doi: 10.1097/00005792-200005000-00003. [DOI] [PubMed] [Google Scholar]
  29. Yabuuchi E, Ohyama A. Characterization of ‘pyomelanin’-producing strains of Pseudomonas aeruginosa. Int J Syst Bacteriol. 1972;22:53–64. [Google Scholar]
  30. Zelazny AM, Ding L, Elloumi HZ, Brinster LR, Benedetti F, Czapiga M, et al. Virulence and cellular interactions of Burkholderia multivorans in chronic granulomatous disease. Infect Immun. 2009;77:4337–4344. doi: 10.1128/IAI.00259-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES