YvoA and CcpA Repress the Expression of chiB in Bacillus thuringiensis

Abstract

Bacillus thuringiensis produces chitinases, which are involved in its antifungal activity and facilitate its insecticidal activity. In our recent work, we found that a 16-bp sequence, dre_chiB (AGACTTCGTGATGTCT), downstream of the minimal promoter region of the chitinase B gene (chiB) was a critical site for the inducible expression of chiB in B. thuringiensis Bti75. In this work, we show that a GntR family transcriptional regulator (named YvoA_Bt), which is homologous to YvoA of Bacillus subtilis, can specifically bind to the dre_chiB oligonucleotide sequences in vitro by using electrophoretic mobility shift assays (EMSAs) and isothermal titration calorimetry (ITC) assays. The results of quantitative real-time reverse transcription-PCR (qRT-PCR) and Western blotting indicated that deletion of yvoA caused an ∼7.5-fold increase in the expression level of chiB. Furthermore, binding of purified YvoA_Bt to its target DNA could be abolished by glucosamine-6-phosphate (GlcN-6-P). We also confirmed, in the presence of the phosphoprotein Hpr-Ser₄₅-P, that purified CcpA_Bt bound specifically to the promoter of chiB, which contains the “cre_chiB” sequence (ATAAAGCGTTTACA). According to the results of qRT-PCR and Western blotting, deletion of ccpA resulted in a 39-fold increase in the chiB expression level, and glucose no longer influenced the expression of chiB. We confirm that chiB is negatively controlled by both CcpA_Bt and YvoA_Bt in Bti75.

INTRODUCTION

Chitinases (EC 3.2.1.14), which have the ability to digest chitin into N-acetylglucosamine, are produced by a wide range of organisms and can be potentially used in industry, medicines, scientific research, and agriculture (1–3). Bacillus thuringiensis (Bt) also produces chitinases (4–6). Several studies have reported that chitinases generated by Bt are involved in its antifungal activity and can enhance the insecticidal activity of Bt strains (7–10). Many studies have reported the expression and application of chitinases in microorganisms (11–15). However, reports on the regulation mechanism of chitinase genes are scarce.

The expression of the chitinase gene is controlled by the GntR family regulator DasR in Streptomyces coelicolor (16, 17). Actually, DasR is a global regulator that is involved in GlcNAc transport and metabolism, antibiotic synthesis (18), and morphological differentiation (16). Colson et al. previously identified a 16-bp consensus sequence (AGTGGTCTAGACCACT) in the promoters of chitin and GlcNAc metabolism-related genes in Streptomycetes, which was termed a DasR-responsive element (dre) (17). YvoA, the ortholog of DasR in Bacillus subtilis, is a bacterial repressor involved in GlcNAc transport and utilization; Titgemeyer and colleagues showed previously that YvoA binds specifically to a similar 16-bp consensus sequence (ATTGGTATAGACAACT) upstream of the nagAB and nagP genes (19, 20). In our recent work, we also found a 16-bp sequence, the dre_chiB sequence (AGACTTCGTGATGTCT), downstream of the minimal promoter region of the chitinase B gene (chiB) (Fig. 1A), which is a critical site for the inducible expression of chiB in B. thuringiensis Bti75 (21). Moreover, electrophoretic mobility shift assays (EMSAs) showed that some regulatory factors bind to the dre_chiB site in strain Bti75 cultured in the absence of the inducer. Thus, we hypothesized that YvoA of Bti75 is the regulator responsible for binding to dre_chiB to control the expression of chiB.

FIG 1.

(A) Map of the genetic elements of the chiB upstream region (altered according to Fig. 4 in reference 21). The transcription start site (TSS) is indicated as +1. The locations of the dre site and cre site are labeled. Gray regions in the minimal promoter represent the −10 box and the −35 box. SD, Shine-Dalgarno sequence. (B) Synteny of the yvoA_Bt locus in Bacillus thuringiensis HD-789. Gene organization was deduced from the complete genome sequences retrieved from the NCBI database. Black rectangles upstream of the nagA ortholog represent identified dre-like sequences.

In addition, we also identified a 14-bp sequence that is similar to the catabolite response element (cre) consensus sequence inside the minimal promoter region. The cre consensus sequence is a 14-bp partially palindromic sequence that specifically interacts with CcpA (catabolite control protein A) in the metabolic process of carbon catabolite repression (CCR) (22). CCR is a general phenomenon whereby microbes adjust their expression of catabolic genes in response to the availability of rapidly metabolizable carbon sources (23–25). In low-GC Gram-positive bacteria such as B. subtilis, the key regulator of CCR is CcpA (a member of LacI/GalR family of bacterial regulatory proteins); with the help of Hpr phosphorylated at the Ser₄₆ residue (Hpr-Ser₄₆-P), CcpA can specifically bind to target promoters at cre sites (23, 26, 27). Chitinase can hydrolyze chitin into GlcNAc, which can be utilized by microorganisms as a carbon and nitrogen source; therefore, it is unsurprising that it is also regulated by CCR. Until now, there has been no detailed study of the mechanism of regulation of chitinases by CCR in Bt.

In the present study, we show that the upstream region of the Bti75 chiB gene contains dre_chiB and cre_chiB, which are similar to the cis-acting elements dre and cre in other species. In vitro experiments indicated that the transcriptional regulators YvoA_Bt and CcpA_Bt can specifically bind to dre_chiB and cre_chiB, respectively. The results of quantitative real-time reverse transcription-PCR (qRT-PCR) and Western blot analyses confirmed that chiB is negatively regulated by YvoA_Bt and CcpA_Bt in Bti75.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Bti75, which is a highly efficiently inducible chitinase-producing strain, was previously isolated and maintained in our laboratory. Bti75 and its variants were cultured at 30°C with shaking at 200 rpm. Escherichia coli DH5α, for plasmid constructions, and E. coli BL21(DE3), for protein purification, were cultured at 37°C with shaking at 200 rpm. Luria-Bertani (LB) broth was used to grow E. coli as well as Bti75 and its mutants. For chitinase gene expression assays, S minimal medium [15 mM (NH₄)₂SO₄, 80 mM K₂HPO₄, 44 mM KH₂PO₄, 3.4 mM Na-citrate, 1 mM MgSO₄ · 7H₂O (pH 7.4)] (28) supplemented with 0.5% yeast extract powder, G medium (S medium plus 0.5% glucose), and C medium (S medium plus 0.5% colloidal chitin) were used. Colloidal chitin was prepared according to a previously described method (9). For strains with antibiotic resistance, appropriate antibiotics were added to the culture medium at the following concentrations: 5 μg ml⁻¹ chloramphenicol (Cam), 50 μg ml⁻¹ erythromycin (Erm), 50 μg ml⁻¹ ampicillin (Amp), and 50 μg ml⁻¹ kanamycin (Kan). The primers used in this study are listed in Table 1. Plasmids and strains used in this study are listed in Table 2.

TABLE 1.

Primers used in this study

Primer	Sequence (5′→3′)	Function
SalI-erm-F	CTGGTCGACGCAAACTTAAGAGTGTGT	ccpA and yvoA deletion
XbaI-erm-R	CGCTCTAGAGACCTCTTTAGCTTCTTG	ccpA and yvoA deletion
KpnI-CcpAup-F	TCAGGTACCTTAAACGAAAGAGGTCGTCTCG	ccpA deletion
XbaI-CcpAup-R	CGCTCTAGATTCATCTCATCGCACACTCCTT	ccpA deletion
SalI-CcpAdown-F	TCTGTCGACCGTATCCAATTTAGAGATTCAACG	ccpA delection
PstI-CcpAdown-R	CCGCTGCAGAGGTAAGCTATATACTAGGGAGGATT	ccpA deletion
PstI-YvoAup-F	GTCTGCAGCAAGCTTTCCGAAATGTA	yvoA deletion
SalI-YvoAup-R	GCGGTCGACATTCTCAGATGGGATTTTAT	yvoA deletion
XbaI-YvoAdown-F	CGCTCTAGACAGTGGAAATGAAAATGGAT	yvoA deletion
KpnI-YvoAdown-R	AATGGTACCCCCTCGTACTTAAATAGCCT	yvoA deletion
NcoI-CcpA-F	TCGCCATGGTAATGAACGTAACAATCTATGATGTAG	ccpA cloning
XhoI-CcpA-R	CGCCTCGAGTTTCGTTGAATCTCTAAATTGGAT	ccpA cloning
NcoI-Hpr-F	CTGCCATGGTCATGGAAAAAATCTTTAAAGTAACT	hpr cloning
XhoI-Hpr-R	CATCTCGAGTTCTCCTAATCCTTCGTTTTTCAT	hpr cloning
NcoI-Hprk-F	CGGCCATGGGTATGAAATGTTTTTTTCTATT	hprK cloning
XhoI-Hprk-R	ATCTCGAGTATCTCCTGATTCCCTAACTCAATCGC	hprK cloning
NcoI-YvoA-F	GCCCCATGGTGATGAACATCGACAAG	yvoA cloning
XhoI-YvoA-R	CTGCTCGAGTTTGTTACGTGCAATATTC	yvoA cloning
EcoRI-ChiB-F	ATATGAATTCATGAGGTCTCAAAAATTCACACTG	chiB cloning
XhoI-ChiB-R	ATCTCGAGGTTTTCGCTAATGACGGCATT	chiB cloning
P16SrRNA-RT-F	GCCGTAAACGATGAGTGCTAAGTG	16S rRNA RT-PCR
P16SrRNA-RT-R	TGAGTTTCAGTCTTGCGACCGTA	16S rRNA RT-PCR
PchiB-RT-F	GCCGCTGATGAAAAGACAAGA	chiB RT-PCR
PchiB-RT-R	TTCCCAGTCTAAATCTACGCCA	chiB RT-PCR
PchiB-F	CCTTTCGTTTTCATATATAGTTTGT	PchiB cloning
PchiB-R	CTAGATAAAATGATCAGACATCACG	PchiB cloning
Pcre-F	TTTTTCAACTTAATAAAGCGTTTACACTAAATCTTACATT	Pcre-CcpA EMSA
Pcre-R	AATGTAAGATTTAGTGTAAACGCTTTATTAAGTTGAAAAA	Pcre-CcpA EMSA
Pcre-R(B)	AATGTAAGATTTAGTGTAAACGCTTTATTAAGTTGAAAAA(5′ biotin)	Pcre-CcpA EMSA
Pdre-F	GCTCCCTTGTATAGACTTCGTGATGTCTGATCATTTTATC	Pdre-YvoA EMSA
Pdre-R	GATAAAATGATCAGACATCACGAAGTCTATACAAGGGAGC	Pdre-YvoA EMSA
Pdre-R(B)	GATAAAATGATCAGACATCACGAAGTCTATACAAGGGAGC(5′ biotin)	Pdre-YvoA EMSA

TABLE 2.

Bacterial strains and plasmids used in this study

Plasmid or strain	Relevant characteristic(s)a	Source or reference
Plasmids
pET-28a(+)	Expression vector; Kanr; C/N-terminal His tag/thrombin/T7 tag, T7 lac promoter, T7 transcription start, F1 origin, lacI	Novagen
pET-CcpA	Kanr; ccpA gene cloned into pET-28a(+), His tag binding C terminus of CcpA	This study
pET-YvoA	Kanr; yvoA gene cloned into pET-28a(+), His tag binding C terminus of YvoA	This study
pET-Hpr	Kanr; hpr gene cloned into pET-28a(+), His tag binding C terminus of Hpr	This study
pET-HprK	Kanr; hprK gene cloned into pET-28a(+), His tag binding C terminus of HprK/P	This study
pET-ChiB	Kanr; chiB gene cloned into pET-28a(+), His tag binding C terminus of ChiB	This study
pKSV7	Ampr Cmr; Bacillus-E. coli shuttle vector, temp sensitive	Laboratory collection
pKSV-e	Ampr Emr Cmr; erythromycin gene of pHT315 with its promoter cloned into the pKSV7 SalI/XbaI site	This study
pKSV7-ue-CcpA	Ampr Emr Cmr; 1,115-bp upstream fragment of ccpA cloned into the pKSV7-e KpnI/XbaI site	This study
pKSV7-ued-CcpA	Ampr Emr Cmr; 1,072-bp downstream fragment of ccpA cloned into the pKSV7-ue SalI/PstI site	This study
pKSV7-ue-YvoA	Ampr Emr Cmr; 1,042-bp upstream fragment of yvoA cloned into the pKSV7-e SphI/SalI site	This study
pKSV7-ued-YvoA	Ampr Emr Cmr; 1,015-bp downstream fragment of yvoA cloned into the pKSV7-ue XbaI/KpnI site	This study
pHT315	Bacillus-E. coli shuttle vector; Ampr Emr	Pasteur Institute
Strains
E. coli DH5α	F− ϕ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK− mK+) phoA supE44 λ− thi-1 gyrA96 relA1	Laboratory collection
E. coli BL21(DE3)		Invitrogen
Bti75	Efficient chitinase-producing strain	Laboratory collection
Bti75ΔccpA	Bti75 ΔccpA	This study
Bti75ΔyvoA	Bti75 ΔyvoA	This study

^aAmp^r, ampicillin resistance; Em^r, erythromycin resistance; Cm^r, chloramphenicol resistance; Kan^r, kanamycin resistance.

Construction of ccpA and yvoA deletion mutants of Bti75.

The plasmid used to generate strain Bti75ΔyvoA was constructed as follows: oligonucleotide primers SalI-erm-F and XbaI-erm-R were used to amplify the erythromycin resistance gene, erm, from pHT315. The PCR product was digested with SalI and XbaI and ligated into temperature-sensitive vector pKSV7 treated with the same enzymes to generate vector pKSV-e with erythromycin resistance. The upstream homologous fragment of yvoA was amplified by using primers PstI-YvoAup-F and SalI-YvoAup-R, and then ligated into pKSV-e after digestion with SphI and SalI, generating plasmid pKSV-ue-YvoA. Oligonucleotide primers XbaI-YvoAdown-F and KpnI-YvoAdown-R were used to amplify the downstream homologous fragment of yvoA, which was ligated into pKSV-ue-YvoA (digested by XbaI and KpnI), generating plasmid pKSV-ued-YvoA. Plasmid pKSV-ued-CcpA was constructed similarly to pKSV-ued-YvoA, using oligonucleotide primer pair KpnI-CcpAup-F and XbaI-CcpAup-R and primer pair SalI-CcpAdown-F, PstI-CcpAdown-R. The resultant plasmids were checked by restriction enzyme digestion and DNA sequencing.

Plasmids pKSV-ued-YvoA and pKSV-ued-CcpA were transformed into Bti75 by electroporation separately (29). When the correct transformant was obtained, we inoculated a single colony into LB medium containing Erm (50 μg ml⁻¹) and cultivated it at 42°C for 36 h. The transformant was plated onto LB agar plates containing Erm or Cam and cultivated at 30°C overnight. Colonies with resistance to Erm but not to Cam were considered possible candidates for Bti75ΔyvoA or Bti75ΔccpA. The correct mutants were confirmed by PCR and DNA sequencing.

Protein expression and purification.

For the expression of YvoA_Bt, the yvoA gene was amplified by PCR using oligonucleotide primers NcoI-YvoA-F and XhoI-YvoA-R. The fragment was digested with NcoI and XhoI and ligated into similarly digested pET28a(+) (Novagen, Germany), resulting in a His₆ fusion at the C terminus of YvoA (plasmid pET-YvoA). The plasmids used to express CcpA (plasmid pET-CcpA), Hpr (histidine-containing phosphocarrier protein) (plasmid pET-Hpr), HprK/P (Hpr kinase/phosphorylase) (plasmid pET-HprK), and ChiB (plasmid pET-ChiB) were constructed similarly to plasmid pET-YvoA, using oligonucleotide primer pairs NcoI-CcpA-F and XhoI-CcpA-R, NcoI-Hpr-F and XhoI-Hpr-R, NcoI-Hprk-F and XhoI-Hprk-R, and EcoRI-ChiB-F and XhoI-ChiB-R, respectively.

Plasmid pET-YvoA was then transformed into E. coli BL21(DE3) (Invitrogen, Carlsbad, CA, USA). When cells reached an optical density at 600 nm (OD₆₀₀) of ∼0.6 to 0.9, they were induced by using 1 mM IPTG (isopropyl-β-d-thiogalactopyranoside). After ultrasonic disruption (400 W) of E. coli BL21(DE3), native YvoA_Bt was purified by using its His tag and a nickel column (GE Healthcare, Piscataway, NJ). The eluate was dialyzed in buffer containing 50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 0.5 mM EDTA, and 5% glycerol for ∼18 h. The YvoA protein was stored at −20°C in the presence of 50% glycerol. A similar strategy was used to generate the CcpA_Bt, Hpr, HprK/P, and ChiB proteins.

Phosphorylation of Hpr by HprK/P.

To check whether HprK/P purified in this study could phosphorylate Hpr or not, phosphorylation assays were performed in the presence of 20 μM Hpr and 1 μM HprK/P in phosphorylation buffer (10 mM Tris-HCl [pH 7.0], 50 mM NaCl, 1 mM MgCl₂, 0.5 mM dithiothreitol, 5% glycerol, 2 mM ATP, 20 mM fructose-1,6-bisphosphate [FBP]). The reactions were carried out at 37°C for 30 min, and the mixtures were then incubated for 5 min at 70°C to stop the reaction. Phosphorylation of Hpr was detected by both nondenaturing 12% PAGE and SDS-PAGE (30) (Fig. 2).

FIG 2.

Hpr phosphorylation by HprK/P. Hpr-His₆ (20 μM) was mixed with HprK/P-His₆ (1 μM) in the presence of 2 mM ATP or 20 mM FBP. The reaction products were analyzed by both nondenaturing 12% PAGE and SDS-PAGE. Lane 1, Hpr; lane 2, Hpr and HprK/P; lane 3, Hpr, HprK/P, ATP, and FBP; lane 4, Hpr, HprK/P, and FBP; lane 5, Hpr, HprK/P, and ATP.

EMSAs.

Protein-DNA interactions were evaluated by an electrophoretic mobility shift assay. Long DNA probes were amplified by PCR using primers and the Bti75 genome as a template. Short DNA probes were generated by annealing primers in Tris-EDTA (TE) buffer. The reaction mixture was heated to 95°C for 5 min and then kept at room temperature for 40 min. The 5′ ends of several primers were labeled with biotin (listed in Table 1). The primers used to generate the probes were as follows: PchiB-F and PchiB-R were used to amplify a 158-bp fragment (named PchiB) of the chiB promoter that contained dre_chiB and cre_chiB, and Pdre-F and Pdre-R as well as Pcre-F and Pcre-R were used to generate 40-bp DNA fragments (Pdre and Pcre) that contained dre_chiB and cre_chiB, respectively.

The concentrations of probes and proteins used in this study are indicated in the corresponding figures and the legends to these figures. The reaction mixtures were incubated for 30 min at 37°C in reaction buffer containing 10 mM Tris-HCl (pH 7.0), 50 mM NaCl, 1 mM MgCl₂, 0.5 mM dithiothreitol, 0.5 mM EDTA, and 5% glycerol. Nonspecific and specific competition assays were carried out in the presence of 0.5 μg ml⁻¹ sheared salmon sperm DNA and 100-fold, 150-fold, and 300-fold excesses of unlabeled fragments, respectively. After the reaction, the mixtures were separated with an 8% nondenaturing polyacrylamide gel in Tris-borate-EDTA (TBE) buffer. In the competition reaction, the probes were transferred onto a nylon membrane from the gels in TBE buffer. Finally, the nylon membrane was stained by using a biotin chromogenic detection kit (Thermo Fisher Scientific Inc.) to show the location of the labeled probes.

RNA extraction and quantitative real-time reverse transcription-PCR.

Bacteria were grown at 30°C in culture medium for ∼9 h to the logarithmic phase (OD₆₀₀ of ∼2.5), with shaking. Total RNA was extracted by using RNAiso Plus (TaKaRa, Dalian, China), according to the manufacturer's instructions. After the removal of genomic DNA by using RNase-free recombinant DNase I (TaKaRa), cDNA was synthesized from total RNA by using the PrimeScript RT reagent kit (Perfect Real Time; TaKaRa). Quantification of cDNA was carried out by using SYBR Premix Ex Taq (Perfect Real Time; TaKaRa), and real-time amplification of the PCR product was analyzed by using StepOne software (Applied Biosystems, Foster City, CA, USA), according to the supplier's instructions. The 16Sr RNA gene acted as the endogenous control. The relative amount of cDNA was calculated according to the 2^−ΔΔCT method (31). The sequences of the primers for qRT-PCR are presented in Table 1.

Isothermal titration calorimetry.

Isothermal titration calorimetry (ITC) measurements were carried out as described previously by Wang et al. (32). The experiments were performed on a MicroCal iTC200 isothermal titration calorimetry instrument (GE Healthcare) with a solution containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 1 mM EDTA at 16°C. A 50 μM DNA probe (Pdre) was titrated into 10 μM YvoA_Bt. Both DNA probe and protein solutions were degassed by spinning at 15,000 × g for 15 min. The titration consisted of an initial injection of 0.4 μl, followed by 26 injections of 1.5 μl every 120 s at 16°C. To determine the baseline, the DNA probe was titrated into the same buffer without the protein under the same conditions. The titration data and binding plot after baseline subtraction were analyzed by using MicroCal Origin software.

Western blot assays.

The purified ChiB protein was used for rabbit polyclonal antibody generation. Bti75 and Bti75ΔyvoA were grown in 100 ml S medium and C medium at 30°C for ∼9 h, respectively. The two bacterial strains were collected by centrifugation at 7,000 × g for 15 min at 4°C and resuspended in 5 ml lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, and 1 mM PMSF [phenylmethanesulfonyl fluoride]). The same amount of bacteria was disrupted by sonication (400 W). Thirty-five microliters of the crude proteins was resolved by SDS-PAGE and transferred onto Immobilon-P membranes (Millipore, Billerica, MA). Anti-ChiB polyclonal antibodies and horseradish peroxidase-coupled goat anti-rabbit antibodies were used to detect the expression level of chiB. ChiB expressed from Bti75 and Bti75ΔccpA was assessed similarly.

Computational prediction of CcpA- and YvoA-responsive elements in Bt.

The PREDetector software program (33) was used to predict the positions of cre-like and dre-like sequences in B. thuringiensis subsp. israelensis strain HD-789 by using a list of cre targets in B. subtilis reported previously by Fujita (22) and three dre targets in Bti75 that we found in this work. The cutoff score was set at 8.0 to predict the cre-like sequence, and the score was set at 6.0 to predict the dre-like sequence, as fewer dre targets were used to generate the matrix.

RESULTS

YvoA and CcpA are presumed regulators of the expression of chiB.

From BLASTP analysis, we found a GntR family transcriptional regulator (GenBank accession no. AFQ27885.1) in B. thuringiensis HD-789 that has 45% sequence identity and 67% similarity to the B. subtilis regulator YvoA (YvoA_Bs). Like YvoA in B. subtilis, this gene is located adjacent to nagB, which encodes the enzyme that catalyzes the deamination and isomerization of GlcNAc-6-P to Fru-6-P. Indeed, this gene is the third element of a tricistronic operon in which the first two positions are nagA (the GlcNAc-6-P deacetylase gene) and nagB (Fig. 1B). Thus, we named the gene yvoA_Bt and speculated that its product may bind to the 16-bp locus upstream of chiB as a regulator.

At the same time, using the list of cre targets in B. subtilis reported by Fujita (22), we used the PREDetector software program (33) to identify an additional 14-bp sequence, cre_chiB (ATAAAGCGTTTACA), which is similar to the cis-acting element cre, in the promoter of chiB in the genomic sequence of B. thuringiensis HD-789 (see Data Set S1 in the supplemental material). The cre_chiB element overlaps the −35 box of the chiB promoter (Fig. 1A). The catabolite control protein CcpA is a pleiotropic regulator that mediates the global transcriptional response by binding cre elements site specifically. Thus, we hypothesized that chiB might also be regulated by CcpA_Bt in Bti75.

YvoA can bind dre_chiB sequences in vitro.

In this study, YvoA_Bt of Bti75 was heterologously expressed in E. coli. To confirm the interaction between YvoA_Bt and dre_chiB, we used unlabeled and biotin-labeled DNA fragments containing the dre_chiB site for EMSAs with purified YvoA_Bt. We incubated purified YvoA_Bt with the 158-bp fragment of the chiB promoter PchiB (positions −106 to +52 relative to the transcription start site) and a 40-bp DNA fragment, Pdre (positions +9 to +48 relative to the transcription start site), which contains dre_chiB in the middle, for EMSAs. As shown in Fig. 3A, YvoA_Bt retarded the migration of PchiB in a concentration-dependent manner.

FIG 3.

EMSAs to detect binding of CcpA_Bt and YvoA_Bt to their targets. DNA fragments were detected by staining. (The concentrations of CcpA_Bt and YvoA_Bt are indicated in the labels above each panel.) (A) Analysis of YvoA_Bt binding to PchiB (158 bp). A total of 0.05 μM PchiB was mixed with various concentrations of YvoA_Bt. (B) Analysis of CcpA_Bt binding to PchiB. A total of 0.05 μM PchiB was mixed with various concentrations of CcpA_Bt. (C to E) Analysis of CcpA_Bt binding to Pcre (40 bp). (C) A total of 0.1 μM Pcre was mixed with various concentrations of CcpA_Bt. (D) A total of 0.1 μM was Pcre was mixed with various concentrations of CcpA_Bt in the presence of 4 μM Hpr. (E) A total of 0.1 μM Pcre was mixed with various concentrations of CcpA_Bt in the presence of 4 μM Hpr-Ser₄₅-P.

To further investigate the specific interaction between YvoA_Bt and dre_chiB, 0.5 ng μl⁻¹ salmon sperm DNA (nonspecific competition) and a 100-fold excess of unlabeled Pdre (specific competition) were added to the mixture for the reaction of YvoA_Bt with Pdre (biotin labeled). As shown in Fig. 4, YvoA_Bt also retarded the migration of Pdre, while salmon sperm DNA could not compete away YvoA_Bt from Pdre (biotin labeled) (Fig. 4A). On the other hand, when a 100-fold excess of unlabeled probe was present, the retarded band of biotin-labeled Pdre disappeared completely (Fig. 4C). The results from these experiments suggested that YvoA_Bt binds to the dre_chiB sequence specifically to regulate the expression of chiB.

FIG 4.

EMSAs to determine specific binding of YvoA_Bt and CcpA_Bt to dre_chiB and cre_chiB. DNA fragments were detected by using a biotin chromogenic reagent. (A and C) Nonspecific and specific competition assays with YvoA_Bt (0.5 μM) and Pdre (0.1 μM) (40 bp). (A) Lane 1, Pdre (biotin-labeled DNA [Bio]); lane 2, Pdre (Bio) and YvoA_Bt; lane 3, Pdre (Bio), YvoA_Bt, and 0.5 ng μl⁻¹ salmon sperm DNA. (C) Lane 1, Pdre (Bio); lane 2, Pdre (Bio) and YvoA_Bt; lane 3, Pdre (Bio), YvoA_Bt, and a 100-fold excess of unlabeled Pdre. (B and D) Nonspecific and specific competition assays with CcpA_Bt (0.5 μM) and Pcre (0.1 μM). (B) Lane 1, Pcre (Bio); lane 2, Pcre (Bio) and CcpA_Bt; lane 3, Pcre (Bio), CcpA_Bt, and 0.5 ng μl⁻¹ salmon sperm DNA; lanes 4 and 5, Pcre (Bio), CcpA_Bt, and 0.5 ng μl⁻¹ salmon sperm DNA plus 2 μM Hpr and 2 μM Hpr-Ser₄₅-P, respectively. (D) Lane 1, Pcre (Bio); lanes 2 and 3, Pcre (Bio), CcpA_Bt, and Hpr-Ser₄₅-P plus 150- and 300-fold excesses of unlabeled Pcre, respectively; lanes 4 and 5, Pcre (Bio), CcpA_Bt, and Hpr plus 150- and 300-fold excesses of unlabeled Pcre, respectively.

To study the interactions between YvoA_Bt and Pdre quantitatively, we also used ITC to determine their binding affinity. As shown in Fig. 5, the binding of YvoA_Bt to Pdre fitted well to a one-site binding model, with a calculated K_d (dissociation constant) value of ∼0.46 μM (Fig. 5B), which was significantly different from that of the negative control (Fig. 5A). Therefore, our results suggested that YvoA_Bt binds to Pdre specifically.

FIG 5.

YvoA_Bt DNA binding abilities measured by ITC. Shown are binding isotherms of 50 μM Pdre titrated with binding buffer (A) or binding buffer plus 10 μM YvoA_Bt (B). For panel A, no binding was detected. For panel B, the data were fitted to a one-site binding model to give a K_d of ∼0.46 μM.

Hpr can be phosphorylated efficiently by Hprk/P.

The Hpr and HprK/P proteins were cloned and purified similarly to YvoA_Bt. As shown in Fig. 2, we found that 1 μM HprK/P phosphorylated >20 μM Hpr at 37°C for 30 min in reaction buffer with ATP and FBP. Moreover, the same results were obtained by using reaction buffer with 2 mM ATP but without FBP (Fig. 2, lane 5), while HprK/P could not phosphorylate Hpr in reaction buffer without ATP (Fig. 2, lane 4).

CcpA can bind specifically to the chiB promoter with the assistance of Hpr-Ser₄₅-P.

To confirm the interaction between CcpA_Bt and cre_chiB, PchiB was tested with CcpA_Bt alone in the reaction buffer. We found that CcpA_Bt retarded the mobility of PchiB similarly to the interaction of YvoA_Bt with PchiB (Fig. 3B). However, we observed a similar phenomenon (data not shown) when we used another DNA fragment (∼150 bp) without obvious cre sites at a CcpA_Bt concentration of 0.1 μM. These results raised the possibility that the DNA retardation observed was the result of nonspecific binding of CcpA_Bt because of its intrinsic DNA binding nature.

To further investigate the specific interaction between CcpA_Bt and cre_chiB, we synthesized a 40-bp DNA fragment, Pcre (positions −53 to −14 relative to the transcription start site), of the chiB promoter, which contains cre_chiB in the middle. Only when its concentration reached 0.5 μM could CcpA_Bt obviously retard the movement of Pcre alone (Fig. 3C). Thus, we hypothesized that CcpA_Bt alone would have a higher affinity for the long DNA fragment than the short one because of its intrinsic DNA binding nature. We then tried to determine whether Hpr or Hpr-Ser₄₅-P could further stimulate CcpA_Bt binding to cre_chiB. Hpr and Hpr-Ser₄₅-P (2 μM each) were mixed in the mixture for the reaction of CcpA_Bt with Pcre. We found that Hpr did not increase the affinity of CcpA_Bt for the DNA fragments (Fig. 3D). In contrast, Hpr-Ser₄₅-P enhanced the affinity of CcpA_Bt for the DNA fragments (Fig. 3E). We also further observed that even 10 nM CcpA_Bt effectively retarded the movement of Pcre with the help of Hpr-Ser₄₅-P (data not shown), which proved that Hpr-Ser₄₅-P, rather than Hpr, significantly enhanced the affinity of CcpA_Bt for Pcre. At the same time, we confirmed that Hpr-Ser₄₅-P or HprK/P itself could not retard the movement of PchiB (data not show).

To determine whether the binding of CcpA_Bt to cre_chiB was specific or not, EMSAs were carried out in the presence of Hpr-Ser₄₅-P or Hpr with the addition of 0.5 ng μl⁻¹ salmon sperm DNA (nonspecific competition) or 150- and 300-fold excesses of the same unlabeled DNA fragment of Pcre (specific competition). As shown in Fig. 4B, salmon sperm DNA easily competed away CcpA_Bt from biotin-labeled Pcre without Hpr-Ser₄₅-P (Fig. 4B, lane 3). In contrast, CcpA_Bt bound strongly to the labeled probe in the presence of Hpr-Ser₄₅-P mixed with a nonspecific fragment (Fig. 4B, lane 4). Moreover, Hpr could not assist CcpA_Bt in binding to Pcre (Fig. 4B, lane 5). In the EMSA for specific competition, we found that when the amount of the specific fragment was increased 300-fold compared with the amount of the labeled probe, the retardation phenomenon in the presence of Hpr-Ser₄₅-P disappeared (Fig. 4D, lane 3). However, a retarded band was observed in the lane with Hpr (Fig. 4D, lane 5). Thus, according to the results of assays for specific and nonspecific competition, we confirmed that CcpA_Bt specifically binds to the cre site of the chiB promoter in Bti75 with the help of Hpr-Ser₄₅-P, but Hpr did not have this function.

Both YvoA and CcpA can repress the expression of chiB in vivo.

To study the role of YvoA_Bt and CcpA_Bt in the expression of chiB in vivo, Bti75 and Bti75ΔyvoA were cultured in S minimal medium and C medium (with colloidal chitin), respectively. As shown in Fig. 6A, we observed that the relative expression level of chiB in Bti75ΔyvoA was elevated ∼7.5-fold compared to that in Bti75 in S medium. Moreover, the relative expression level of chiB in Bti75ΔyvoA in C medium was ∼8-fold higher than that in Bti75 in S medium. At the same time, the relative expression level of chiB in Bti75 in C medium was elevated by ∼4-fold compared with that in Bti75 in S medium but was also ∼2-fold lower than that in Bti75ΔyvoA in S medium.

FIG 6.

qRT-PCR analysis of the relative transcript levels of chiB genes of different strains in different media. (A) Relative transcript levels of the chiB genes of Bti75 and Bti75ΔyvoA in S medium (S minimal medium) and C medium (S medium plus 0.5% colloidal chitin). (B) Relative transcript levels of the chiB genes of Bti75 and Bti75ΔccpA in G medium (S medium plus 0.5% glucose) and S medium.

Strains Bti75 and Bti75ΔccpA were cultured in S medium and G medium, respectively. The qRT-PCR results (Fig. 6B) showed no obvious difference in the relative expression levels of chiB in Bti75 and Bti75ΔccpA in S medium. However, in G medium, the relative expression level of chiB in Bti75 was reduced by almost 39-fold compared with that in Bti75ΔccpA. This indicated that CcpA_Bt could severely repress the expression of chiB when the medium contains rapidly metabolizable carbon sources such as glucose. Taken together, the results suggested that CcpA_Bt and YvoA_Bt act as negative regulators of chiB in Bti75.

Western blotting indicates that YvoA and CcpA repress the expression of chitinase B.

To detect the expression of chiB in Bti75 and its mutant strains at the protein level, Western blotting was performed. As shown in Fig. 7A, there was significantly more ChiB in Bti75ΔyvoA than in the parental strain in both C medium and S medium, while the amounts of ChiB in Bti75ΔyvoA in C and S media were similar (Fig. 7A, lanes 2 and 4). For Bti75, there was a clear increase in the level of ChiB in C medium compared to that in S medium (Fig. 7A, lanes 1 and 3). All these results are consistent with the qRT-PCR results for Bti75 and Bti75ΔyvoA in C and S media.

FIG 7.

Western blot analysis to determine the expression levels of chiB in Bti75 and its mutants. (A) Expression levels of the chiB genes of Bti75 and Bti75ΔyvoA in C medium and S medium. Lanes 1 and 2, Bti75 and Bti75ΔyvoA in C medium, respectively; lanes 3 and 4, Bti75 and Bti75ΔyvoA in S medium, respectively. (B) Expression levels of the chiB genes of Bti75 and Bti75ΔccpA in G medium and S medium. Lanes 1 and 2, Bti75 and Bti75ΔccpA in G medium, respectively; lanes 3 and 4, Bti75 and Bti75ΔccpA in S medium, respectively. M is the molecular mass marker, which shows molecular masses of 70 kDa and 100 kDa.

On the other hand, as shown in Fig. 7B, there were roughly equal amounts of ChiB in Bti75 and Bti75ΔccpA in C medium without glucose (lanes 3 and 4); however, in G medium, the level of the ChiB protein in Bti75 was almost undetectable (lane 1), and the amount of ChiB in Bti75ΔccpA was similar to those in Bti75 and Bti75ΔccpA in C medium (lane 2). These results were also consistent with the qRT-PCR results for Bti75 and Bti75ΔccpA in G and C media. Thus, the Western blot results suggested that YvoA_Bt and CcpA_Bt repressed the expression of chiB in Bti75.

GlcN-6-P is an effector for YvoA.

To investigate the possible effectors for YvoA_Bt, five different sugars (Glc, GlcNAc, Glc-6-P, GlcNAc-6-P, and GlcN-6-P) were incubated separately with Pdre and purified YvoA_Bt for EMSAs; the final concentration of sugar was 100 mM. The EMSA results in Fig. 8 showed that only GlcN-6-P could abolish the DNA binding capability of YvoA_Bt; the other sugars had no effect on the binding of YvoA_Bt to Pdre. This result is in agreement with data from effector analyses of YvoA in B. subtilis (19) and DasR in S. coelicolor (16).

FIG 8.

EMSAs to identify the inhibitor of binding of YvoA_Bt to dre_chiB. Pdre (0.1 μM) was electrophoresed alone (lane 1) and after incubation with 0.4 μM YvoA_Bt plus a final concentration of 100 mM Glc (lane 2), GlcNAc (lane 3), Glc-6-P (lane 4), GlcNAc-6-P (lane 5), or GlcN-6-P (lane 6).

DISCUSSION

We confirmed that chiB is negatively controlled by YvoA_Bt and CcpA_Bt in Bti75. There have been some reports about cis-acting elements and regulatory mechanisms of the genes related to chitin metabolism in Streptomyces and Bacillus. Titgemeyer and collaborators demonstrated DasR, which is a pleiotropic transcription factor, regulates chitin uptake and GlcNAc utilization (17), antibiotic synthesis (18), and morphological differentiation (16) in S. coelicolor. However, Bertram et al. found only two genes (nagA and nagP) that were directly repressed by YvoA. Thus, those authors thought that YvoA might be a less-prominent regulator than DasR and may control only the uptake and subsequent utilization of GlcNAc in B. subtilis (19). Consequently, they suggested that YvoA be renamed NagR.

In this work, we showed that chiB was negatively controlled by YvoA_Bt in Bti75, based on the combination of in silico, in vitro, and in vivo data. Our results also confirmed the speculation of Xie et al. that a sequence-specific DNA binding factor of strain Bti75 could bind to the dre sequence for the inducible expression of chiB (21). Moreover, we found that nagA and nagP of Bti75 contain a 16-bp dre-like sequence within their upstream regions that is also directly repressed by YvoA_Bt (data not shown). To identify further possible YvoA_Bt binding sites in the genome of B. thuringiensis HD-789, we used the PREDetector software program (33) to identify corresponding16-bp dre-like sequence of nagA, nagP, and chiB. The data are listed in Data Set S2 in the supplemental material. Unlike NagR in B. subtilis, the genes controlled by YvoA_Bt are not limited to nagP and the nagAB-yvoA operon. Besides chiB, the chitin binding protein gene also contains a dre-like site (AGTTGGCTAGTCATCT) within its upstream region. Furthermore, the results of in vivo and in vitro experiments indicated that the chitin binding protein gene was also negatively controlled by YvoA_Bt (data not shown). The chitin binding protein is believed to facilitate microbial attachment to chitin and act synergistically with chitinases for chitin degradation. Thus, we predicted that YvoA_Bt might be a more prominent regulator than YvoA_Bs. In addition to GlcNAc uptake and utilization, it also regulates genes involved in the chitin degradation pathway, such as the chitinase gene and the chitin binding protein gene. As to whether it can regulate other genes, further experiments are required.

Rigali et al. proved that GlcN-6-P was the inducing signal for DasR by using EMSAs (16). Resch et al. predicted that the effector of YvoA was GlcNAc-6-P, based on ITC data for B. subtilis (20). However, Bertram et al. incubated YvoA with dre_nagA in the presence of four different amino sugar compounds (GlcNAc, GlcNAc-6-P, GlcN-6-P, and GlcN) and found that only GlcN-6-P could abolish YvoA's binding to dre_nagA (19). Moreover, using DNase I footprinting, Gaugué et al. failed to detect any displacement of NagR from its dre binding sites by the amino sugar compounds that they used, whereas those authors state that under the same conditions, GlcN-6-P behaved as the inducing signal for the NagR homolog GamR (34). Recently, Fillenberg et al. produced crystallographic structures of NagR with the putative effector molecules GlcN-6-P and GlcNAc-6-P, implying that both of them are inducing signals for NagR in B. subtilis (35). However, we found that only GlcN-6-P could abolish the DNA binding capability of YvoA_Bt among the five sugar compounds by EMSAs. Since YvoA_Bt has ∼45% sequence identity to YvoA_Bs, one could speculate that different inducing signals might be used. Besides this, the different methods and technologies that we used may yield inconsistent results. Elucidation of the inducing signal for YvoA_Bt will require additional experiments.

Heravi et al. speculated that the chitinase gene (chiS) of Bacillus pumilus is under the control of CCR (36). Generally speaking, in low-GC Gram-positive bacteria such as B. subtilis, the key regulator for exerting CCR is CcpA. With the help of Hpr-Ser₄₆-P, CcpA can specifically bind to target promoters at cre sites (23, 26). The cre consensus sequence is a 14-bp cis-activating, partially palindromic sequence, TGWAARCGYTWNCW, in B. subtilis (23), which is similar to the cre sequences in other microorganisms. Moreover, CcpA may act as either a repressor or an activator, depending on the relative positions of the cre sequences in the genes (37). Hpr is a small phosphocarrier protein (∼10 kDa), which is regarded as the central component of the PTS (phosphoenol pyruvate:carbohydrate phosphotransferase system), encoded by pstH (38). It can be phosphorylated on the His₁₅ residue by enzyme I (EI) of the PTS during sugar uptake. On the other hand, Hpr-Ser₄₆-P is produced by ATP-dependent Hpr kinase/phosphatase (HprK/P) in response to high intracellular concentrations of glycolytic intermediates (26). However, Khan et al. observed that the conserved His₁₅ and Ser₄₆ residues of Hpr were shifted by one amino acid to positions 14 and 45, respectively, in B. thuringiensis subsp. israelensis (38). In this study, we also found a similar amino acid sequence of Hpr in Bti75. In addition, Reizer et al. showed that neither Hpr-His₁₅-P nor Hpr-(Ser₄₆-P)-(His₁₅-P) could bind CcpA to function in CCR (39). HprK/P is a bifunctional enzyme that presents kinase activity at high levels of ATP and FBP, whereas if the concentration of inorganic phosphate is high under starvation conditions, HprK/P will transform into a phosphorylase and dephosphorylate Hpr-Ser₄₆-P into Hpr (40).

In the present study, we found that CcpA_Bt could bind to nucleotide sequences with increasing concentrations and had a higher affinity for long nucleotide sequences than for short ones. We proved that CcpA_Bt binds nonspecifically at high concentrations. The results confirmed that only with the help of Hpr-Ser₄₅-P could CcpA_Bt bind specifically to the cre site of the chiB promoter. Our findings are consistent with the generally accepted mode of binding of CcpA to cre sites. However, there are also several reports of specific DNA binding of CcpA to target sequences without cofactors (41–45), which is different from our data. Hammar et al. proposed that a transcription factor achieves specific binding to its targets by sliding along the DNA through nonspecific binding to specific binding sites (46). This hypothesis may explain the nonspecific binding of CcpA with the nucleotide sequence in some respects.

In addition, we found that HprK/P phosphorylated Hpr efficiently in reaction buffer with 2 mM ATP in the absence of FBP, which is slightly different from data in previous reports (22, 23, 30). Thus, we predicted that ATP might be a key element for HprK/P to function. When the concentration of ATP reaches a certain threshold, HprK/P could act on Hpr. FBP may act as an auxiliary factor to lower the threshold concentration of ATP for HprK/P to function; thus, HprK/P can phosphorylate Hpr at a relatively low concentration of ATP. Of course, this hypothesis requires further experimental support.

We propose the following more detailed model for the regulation of the inducible expression of chiB in Bti75. (i) When the strain is cultured in the presence of both rapidly metabolizable carbon (such as glucose) and chitin or chitooligosaccharides that can be degraded into the inducer of YvoA, YvoA is displaced from the dre site of chiB by the inducer, while CcpA still binds to the cre site of chiB and blocks transcriptional elongation with the help of Hpr-Ser₄₅-P. (ii) When the culture contains rapidly metabolizable carbon sources but not the inducer, the expression of chiB is repressed by both CcpA_Bt and YvoA_Bt. (iii) Transcription of chiB progresses when the strain is cultured in the presence of the inducer but not rapidly metabolizable carbon sources that displace CcpA_Bt and YvoA_Bt from the promoter. (iv) When the culture lacks both rapidly metabolizable carbon sources and an inducer, CcpA_Bt dissociates from the promoter, but YvoA_Bt remains at the dre site and continues to repress the expression of chiB.

Many Bt strains can generate more than one chitinase (4–7). In our previous work, we also found another chitinase gene (chiA) in Bti75 (47). We found that there is also a 16-bp sequence (ATACATCTAGACAACT) (dre_chiA), which is similar to dre_Bacillus downstream of the core promoter region of chiA. Also, disruption of this sequence resulted in the constitutive expression of chiA, and the site also appears in Data Set S2 in the supplemental material, so we speculate that YvoA_Bt also participates in the regulation of chiA in Bti75. It is interesting to note that we did not find a cre-like sequence in the promoter of chiA according to Data Set S1 in the supplemental material. This suggests that different chitinase genes may have different regulatory mechanisms. At the same time, we also list other genes that we have proven or predicted to be regulated by YvoA_Bt to show whether these genes have demonstrated or predicted cre sites according to Data Sets S1 and S2 in the supplemental material (Table 3). We found that some genes have both dre-like and cre-like sites in their promoters. This automatically raises the question of whether YvoA_Bt and CcpA_Bt are also involved in the regulation of other genes simultaneously. A definitive answer awaits additional experimental evidence.

TABLE 3.

Genes that have dre-like and cre-like sequences in their promoters in Bti75

Gene(s)	dre-like sequence	cre-like sequencea
chiB	AGACATCACGAAGTCT	TGTAAACGCTTTAT
chiA	ATACATCTAGACAACT	−
nagP	ACACATCTATACAACT	AGAAAGCGTTTTCT
nagAB-yvoA	GCACGAGTAGTTGTCT	−
Chitin binding protein gene	AGTTGGCTAGTCATCT	−

^a−, not found.

This work demonstrates that chiB of B. thuringiensis is regulated by YvoA_Bt and CcpA_Bt. Research on the regulatory mechanism of chitinase will permit better utilization of bacterial chitinase. Liu et al. demonstrated that the chitinase produced by B. thuringiensis improved its insecticidal activity (9). Furthermore, the roles of CcpA and YvoA have been studied in some detail in B. subtilis compared to B. thuringiensis. Therefore, the regulation mechanism of CcpA_Bt and YvoA_Bt in B. thuringiensis requires further investigation.