Abstract
BMP-SMAD signalling plays a crucial role in numerous biological processes including embryonic development and iron homeostasis. Dysregulation of the iron-regulatory hormone hepcidin is associated with many clinical iron-related disorders. We hypothesised that molecules which mediate BMP-SMAD signalling play important roles in the regulation of iron homeostasis and variants in these proteins may be potential genetic modifiers of iron-related diseases. We examined the role of endofin, a SMAD anchor, and show that knockdown of endofin in liver cells inhibits basal and BMP-induced hepcidin expression along with other BMP-regulated genes, ID1 and SMAD7. We show for the first time, the in situ interaction of endofin with SMAD proteins and significantly reduced SMAD phosphorylation with endofin knockdown, suggesting that endofin modulates hepcidin through BMP-SMAD signalling. Characterisation of naturally occurring SNPs show that mutations in the conserved FYVE domain result in mislocalisation of endofin, potentially affecting downstream signalling and modulating hepcidin expression. In conclusion, we have identified a hitherto unrecognised link, endofin, between the BMP-SMAD signalling pathway, and the regulation of hepcidin expression and iron homeostasis. This study further defines the molecular network involved in iron regulation and provides potential targets for the treatment of iron-related disorders.
The transforming growth factor-β (TGFβ) family is composed of 33 structurally related growth factors including TGFβ and bone morphogenetic proteins (BMPs) which regulate a wide variety of cellular responses such as proliferation, differentiation and apoptosis1,2,3,4. The TGFβ family members bind to two distinct serine/threonine kinase receptors on cellular membranes, termed type I and type II receptors5,6. Upon ligand binding, type II receptors phosphorylate type I receptors at the glycine-serine (GS) domain resulting in phosphorylation and activation of receptor-regulated small mothers against decapentaplegic (R-SMADs)7,8. TGFβ and activin signals activate the R-SMADs: SMAD2 and SMAD3, while BMP signals activate SMAD1, SMAD5, and SMAD89,10. R-SMADs subsequently form a heterocomplex with the common mediator SMAD, SMAD4, before translocating to the nucleus to activate the transcription of various target genes11.
SMAD anchors are recently identified adaptor molecules which facilitate interactions between TGFβ receptors and SMAD proteins, enhancing signal transduction and expression of target genes12,13. TGFβ signalling is mediated by the SMAD anchor for receptor activation (SARA) while signalling in the BMP pathway is mediated by the endosome-associated FYVE-domain protein (endofin)14. Endofin, encoded by the ZFYVE16 gene, contains a conserved double zinc finger, the FYVE (Fab-1, YGL023, Vps27, and EEA1) domain14,15. The FYVE domain is a cysteine-rich Zn2+ binding domain with a basic motif that binds to phosphatidylinositol-3-phosphate (PI3P), a lipid highly enriched in early endosomes16,17. Therefore, the FYVE domain is consequently responsible for localising endofin to endosomal vesicles which is important for its function in trafficking SMADs to internalised BMP receptors in early endosomes14. Perturbing the FYVE-domain, as with the previously reported C753S mutation, mislocalises endofin and attenuates BMP signalling13,14.
Disruption of TGFβ superfamily signalling has been associated with cancer, cardiovascular, fibrotic and skeletal diseases18. BMP-SMAD signalling is also central to iron homeostasis through the regulation of hepcidin, a peptide hormone encoded by the HAMP gene, responsible for regulating serum iron levels. Most iron disorders are associated with a dysregulation of hepcidin. Iron overload resulting from hepcidin deficiency causes hyperabsorption of dietary iron and can lead to tissue and organ damage19. In contrast, excess hepcidin limits dietary iron absorption and macrophage iron recycling, restricting iron availability to erythrocyte precursors and eventually causing iron-restricted anaemia. As such, hepcidin regulation is tightly controlled at many levels. This includes BMPs which bind to trans-membrane BMP receptors, facilitated by hemojuvelin (HJV), a co-receptor that enhances BMP signalling to induce the transcription of HAMP, together with other BMP-regulated genes such as ID1 (inhibitor of DNA binding protein 1) and SMAD7 (SMAD family member 7)20,21,22.
We hypothesised that endofin plays an important role in the regulation of hepcidin as it has been shown to be important in BMP-SMAD signalling. In this study, we investigated the potential role of endofin in hepcidin regulation in the BMP-SMAD pathway. In addition, we characterised naturally-occurring SNPs affecting the conserved FYVE domain of endofin to elucidate potential effects of endofin polymorphisms on BMP signalling and hepcidin regulation. Our finding further defines the molecular network involved in iron regulation, providing potential targets for the treatment of iron-related disorders and possibly BMP-associated disorders.
Results
Endofin knockdown down-regulates basal hepcidin expression
To determine the role of endofin on hepcidin regulation, we first examined the effect of modulating endofin levels by treating the human hepatic cell line, HepG2/C3A, with either non-specific siRNA or endofin-specific siRNA. Cells were incubated with siRNAs from 24 hr to 96 hr. We observed that endofin expression, as measured by quantitative real time PCR (qPCR), was significantly decreased compared to controls (Fig. 1a). Endofin expression was significantly decreased at all time points, being at approximately 50% of control levels at 24 hr (p = 0.006), with a maximum of 70% knockdown at 72 hr (p < 0.001). Endofin expression remained effectively decreased up to 96 hr post transfection.
Following endofin knockdown, we observed a significant decrease in basal HAMP expression in C3A cells across all time points (Fig. 1b). Similar to endofin, HAMP expression was maximally reduced at 72 hr (p < 0.001), down to 10% of control levels and remained decreased at 96 hr (p < 0.001).
Analysis of BMP-regulated genes, ID1 and SMAD7, containing BMP responsive elements in their promoters, showed that basal levels were decreased following endofin knockdown, although the amount of decrease was less than that of HAMP and only statistically significant at the 72 hr (p < 0.001) and 96 hr time points (p < 0.001) (Fig. 1c,d).
BMP6 induction of hepcidin is disrupted by endofin knockdown
We next analysed the ability of BMP6 to regulate hepcidin in the absence of endofin. C3A cells were incubated with control and endofin-specific siRNA for 72 hr and subsequently treated with BMP6. Increasing amounts of BMP6 treatment at concentrations of 1, 10 or 100 ng/ml for 4 hr increased HAMP expression by approximately 10-, 60- and 100-fold respectively. Endofin expression was significantly decreased in cells treated with endofin-specific siRNA, regardless of BMP6-treatments (p < 0.001) (Fig. 2a). Despite BMP6-induction of HAMP at all concentrations, we observed up to 90% decreased expression following endofin silencing (Fig. 2b). This decrease in HAMP expression following endofin knockdown was similar to that observed in untreated C3A cells, expressing at approximately 10% of non-specific siRNA control levels.
BMP-regulated genes ID1 and SMAD7 were also inhibited following endofin knockdown and BMP6 treatment. Although, the magnitude of induction by BMP6 and inhibition following endofin knockdown was less than observed with HAMP expression (Fig. 2c,d).
Duolink Proximity Ligation Assay shows in situ interaction of SMAD1 with endofin but not SARA
To assess if endofin modulates hepcidin through the BMP-SMAD signalling pathway, we analysed SMAD1 interactions with endofin using a proximity ligation assay (PLA). PLA is a new technology which allows for in situ detection of protein-protein interactions. PLA utilises antibody recognition coupled with PLA probes which generate a localised signal in a form of spots, revealing proteins which are in close proximity (<40 nm). In this assay, we used as controls the SMAD anchor SARA and SMAD2/3, which are closely related signalling components of the TGFβ but not the BMP pathway. C3A cells were transfected with either myc-tagged endofin or myc-tagged SARA constructs for 48 hr before processing for PLA.
Through PLA, we observed endofin interaction with endogenous SMAD1 proteins, localised in cytoplasmic regions of the cell (Fig. 3). We found that endofin also interacted with SMAD2/3 although fewer signal spots were observed. We show that SARA interacts exclusively with SMAD2/3 and not SMAD1 (Fig. 3). These interactions were only observed in transfected cells indicating the specificity of the assay. Cells incubated with single antibodies showed low or no signal and were used to assess background signal (Fig. 3).
SMAD1/5/8 phosphorylation is reduced with endofin knockdown
To determine if the regulation of hepcidin expression by endofin occurs through the BMP-SMAD signalling pathway, we analysed the phosphorylation of SMAD1/5/8 proteins following endofin knockdown. C3A cells were knocked-down for endofin and treated with BMP6 (10 ng/ml) for 4 hr. In addition to protein analysis, mRNA levels of HAMP, ID1 and SMAD7 were measured by qPCR to verify the downstream effects on BMP-regulated gene transcription.
After a 72 hr treatment with endofin-specific siRNA, immunoblotting showed reduced endofin protein levels in both BMP6 treated and untreated C3A cells (Fig. 4a,b). We observed a significant increase in SMAD1/5/8 phosphorylation in cells treated with BMP6 (p < 0.001), as reported previously23. Knockdown of endofin resulted in significantly decreased SMAD1/5/8 phosphorylation compared to controls in both BMP6 treated (p = 0.022) and untreated C3A cells (p = 0.016) (Fig. 4c). Levels of endofin mRNA were decreased which corresponds to the decrease in endofin protein levels (Fig. 4d). Consistent with the reduction in SMAD1/5/8 phosphorylation, in the same cells, HAMP, ID1 and SMAD7 mRNA showed reduced basal and BMP-induced levels following endofin knockdown (Fig. 4e–g).
Polymorphisms in the FYVE domain affects proper endofin localisation
As decreased endofin expression modulated hepcidin levels, which in turn would result in increased body iron levels, we reasoned that single nucleotide polymorphisms (SNPs) which affected endofin localisation or function might have a similar effect. We identified naturally occurring endofin SNP variants through SNP database searches and analysed using the SIFT (Sorting Intolerant From Tolerant) and PolyPhen-2 (Polymorphism Phenotyping v2) protein prediction tools to determine potentially deleterious mutations and generated them through site-directed mutagenesis of HA-epitope tagged endofin constructs. These were transiently transfected into C3A cells (Fig. 5a,b).
Intracellular endofin expression was analysed by immunofluorescence and confocal microscopy to determine the consequences of SNPs on endofin localisation. We observed endogenous endofin as vesicle-like structures in the cytoplasm that resembled endosomes. Co-localisation studies with an endosomal marker, early endosome antigen 1 (EEA1), showed a degree of overlap (Fig. 5c). Transfection with wild-type HA-epitope tagged endofin constructs showed similar localisation patterns with some vesicles noted to be slightly enlarged as compared to endogenous endofin. Analysis of three endofin variants (E1431Q, T1519N and T928Yfs*8) all possessing an intact FYVE domain showed endosomal-like localisation patterns, similar to wild-type constructs. However, one non-synonymous (R766G) and two frameshift mutations (K325Qfs*4 and N729Kfs*19) with disrupted FYVE domain regions showed a diffused cytoplasmic localisation pattern. Co-localisation with the ER marker, ERp57, showed a degree of overlap (Fig. 5d). A similar ER localisation was also observed with the HA-tagged endofin-C753S mutant that also has a disrupted FYVE domain and has been shown previously to lead to incorrect localisation of the protein14,24.
Discussion
Previous studies have shown that endofin enhances BMP-SMAD signalling by anchoring SMAD proteins to BMP receptors. Here we have identified endofin as a novel signalling component required for hepcidin regulation, by mediating SMAD1/5/8 phosphorylation in the BMP-SMAD pathway. We also show that variants which affect endofin localisation may have an effect on hepcidin expression and could potentially play roles as genetic modifiers of iron overload.
Knockdown of endofin with specific siRNA results in down-regulation of basal hepcidin expression. Knockdown of endofin also leads to a down-regulation of BMP-regulated genes, ID1 and SMAD7, indicating that endofin is essential for the basal expression of genes in the BMP-SMAD pathway. Our results support a previous study where a mutant and non-functional form of endofin, the FYVE (C753S) mutant, transfected in mouse myoblast C2C12 cells was found to decrease expression of a BMP-responsive reporter gene13. Conversely, stable constructs of the wild-type form slightly enhanced reporter gene expression.
Several BMPs have been shown to induce hepcidin expression in vitro25,26,27. Only BMP6 was found to be an essential and non-redundant regulator of hepcidin and iron in vivo25. To determine if endofin regulates BMP-induced hepcidin expression, we silenced endofin and examined hepcidin expression in BMP6-treated C3A cells. Despite 100-fold induction of hepcidin with BMP6, we observed an inhibition of hepcidin expression compared to controls suggesting that endofin is important for the BMP regulation of hepcidin. The importance of endofin in modulating BMP signals was previously shown in vivo in Xenopus embryos, where endofin regulated BMP-induced mesodermal patterning, as characterised by increased expression of early mesodermal markers Xbra, Xhox3 and Xwnt8. Expression of the FYVE (C753S) mutant showed decreased expression of mesodermal markers despite stimulation with BMPs indicating that endofin is required for BMP signalling13.
SMAD anchors are known to mediate TGFβ signalling by interacting and localising SMAD proteins to TGFβ receptors. However, recent findings through co-immunoprecipitation (co-IP) show that they are dispensable for the pathway28,29. For the first time, we demonstrate an in situ interaction of endofin and SARA with SMAD1 and SMAD2/3, respectively. This validates previous reports on the role of SMAD anchors in mediating TGFβ signalling12,13,30,31. In addition, we found that endofin interacted similarly to SMAD2/3 suggesting a possible role of endofin in both the BMP and TGFβ signalling pathways. This was previously shown in the human embryonic kidney cell line, HEK293T, and other human hepatic cell lines, Hep3B and HepG232.
To determine the underlying mechanism of hepcidin regulation by endofin, we examined the effects of endofin silencing on SMAD activation. SMAD1/5/8 proteins are receptor-regulated SMADs that transduce BMP signals from membrane receptors to the nucleus and activate the expression of BMP-responsive genes. We observed that the knockdown of endofin caused a decrease in SMAD1/5/8 phosphorylation in both BMP6-treated and untreated control cells. Measurement of relative hepcidin mRNA expression correspondingly showed a down-regulation following endofin knockdown suggesting that endofin mediates SMAD1/5/8 phosphorylation which subsequently influences hepcidin expression. This is similar to previous findings where endofin facilitates expression of BMP-regulated genes through its interaction with different SMADs. Endofin was shown to enhance BMP-SMAD signalling by interacting with unphosphorylated SMAD1 and anchoring SMAD1 to BMP receptors for activation13. Endofin also enhances BMP-SMAD signalling by interacting with SMAD4, recruiting SMAD4 to activated SMADs to mediate SMAD complex formation32. These SMAD complexes then shuttle to the nucleus to induce transcription of targeted genes.
Deleterious mutations in genes encoding hepcidin or its regulators result in dysregulated production of hepcidin and cause genetic disorders of iron homeostasis. As endofin was able to modulate hepcidin expression, we carried out further studies to determine if endofin was a potential genetic modifier of iron-related disorders. Endofin variants from SNP databases such as HAPMAP, 1000 Genomes Project and NCBI dbSNP were analysed using protein prediction tools; we identified six variants that were potentially deleterious. Characterisation via indirect immunofluorescence showed that the FYVE domain of endofin was important for its localisation to endosomes. Endofin SNP variants with an intact FYVE domain showed endosomal localisation patterns similar to the wild-type and endogenous endofin protein. However, variants containing a premature stop codon or a non-synonymous mutation in the conserved FYVE domain showed a diffused localisation pattern resembling the ER. Localisation of these FYVE domain variants were consistent with a previously reported synthetic mutant FYVE (C753S) that also disrupts the FYVE domain14. As the FYVE domain is essential in recruiting SMADs to early endocytic compartments, it could potentially affect the SMAD trafficking function of endofin and disrupt hepcidin transcription15. Previous findings have associated a disrupted FYVE domain with delay in membrane trafficking, reduced SMAD activity and attenuation of BMP signalling13,14,32. It is thus possible that endofin may act as a genetic modifier in iron-related disorders such as iron overload caused by HFE C282Y, where phenotypic variance is displayed despite homozygous mutations. As such, it would be of interest to assess in vivo effects of naturally occurring endofin SNPs with other genetic mutations that cause iron-related disorders. A SNP in endofin has been previously associated with susceptibility to psoriasis, a disease where TGFβ and SMAD signalling have been implicated33,34. However, endofin SNPs have not been observed in genome wide association studies that have investigated alterations in iron parameters35,36.
Since endofin is involved in endosomal trafficking, it remains unclear if endofin specifically modulates the BMP-SMAD signalling pathway. Endofin is described in previous studies to be associated with other signalling pathways such as the mitogen-activated protein kinase (MAPK) pathway and the closely-related TGFβ-SMAD signalling pathway24,32. Endofin is a tyrosine target of EGF signalling in A431 cells37. Expression of endofin constructs with a mutated Y515 tyrosine phosphorylation site in HeLa cells enhanced ERK2 phosphorylation, suggesting that endofin plays a role in modulating the MAPK/ERK signalling pathway24. In another study, endofin was shown to affect the TGFβ-SMAD signalling pathway by interacting with TGFβ type I receptors32. Furthermore, the knockdown of endofin in Hep3B cells attenuated SMAD2-responsive gene expression32. However, the study also reported that the influence of endofin on TGFβ-SMAD signalling was specific and did not affect BMP or Wnt signalling. Future work involves further characterising the specific signalling pathways regulated by endofin.
In conclusion, we have identified endofin as an important signalling component required for basal and BMP-induced hepcidin expression. Endofin influences hepcidin expression by regulating SMAD1/5/8 phosphorylation which is central for the transcription of hepcidin (Fig. 6). Identification of the hitherto unrecognised role of endofin further elucidates the molecular network involved in hepcidin regulation which may aid in the management of iron-related disorders.
Materials and Methods
Cell Culture
HepG2/C3A hepatoma cells (cat. no. CRL-10741, ATCC, Manassas, VA, USA) were maintained in Minimum Essential Medium (MEM) containing 10% FCS.
Transfection with DNA and small interfering RNA (siRNA) constructs
DNA transfection
C3A cells were grown in 12-well cluster plates (~4 cm2) to 80–90% confluence before transfection. pDHA-Neo-Endofin plasmids, described previously14, were transfected using Lipofectamine 3000 (Life Technologies, Mulgrave, Australia) according to the manufacturer’s recommendations. Cells were incubated with the DNA-Lipofectamine complexes (100 μl per well) for 48 hours.
siRNA transfection
C3A cells were counted and grown to 30–40% confluence in 12-well cluster plates (~4 cm2) before transfection with 20 pmol of non-specific or endofin siRNA (GenePharma, Shanghai, China) in complex with Lipofectamine RNAiMAX (Life Technologies). Sequences of the siRNAs used were as follows: non-specific (si-NS) forward 5′-UUCUCCGAACGUGUCACGUTT-3′ and reverse 5′-ACGUGACACGUUCGGAGAATT-3′, endofin (si-Endofin) forward 5′-GGGCAAGACUUAGAUUACUTT-3′ and reverse 5′-AGUAAUCUAAGUCUUGCCCTT-3′. Briefly, the siRNAs were diluted in 50 μl Opti-MEM and mixed gently. Subsequently, 2 μl of Lipofectamine RNAiMAX was diluted in 50 μl Opti-MEM and mixed gently. The siRNA-Lipofectamine complexes were mixed gently and incubated at room temperature for 5–10 min. The complex (100 μl) was subsequently added to each well of cells and incubated for 72 hours before harvesting.
Real-Time PCR analysis of mRNA transcripts
Total RNA was isolated from cells using Trizol reagent (Life Technologies) according to the manufacturer’s recommendations. RNA (1 μg) was reverse transcribed into cDNA using Superscript III (Life Technologies). Reactions were performed on the Viia7 Real Time PCR System (Life Technologies) as described previously38. Primer pairs for detecting mRNA transcripts are described in Table 1. All targets were normalised to the geometric means of reference genes, ACTB and HPRT using 2−ΔCT.
Table 1. Sequence of primer pairs used for qPCR.
Gene | Primer | Sequence |
---|---|---|
ACTB (β-ACTIN) | F | CAGGCACCAGGGCGTG |
R | GCCCACATAGGAATCCTTCTGA | |
HPRT1 | F | GAAAGGGTGTTTATTCCTCAT |
R | CCCATCTCCTTCATCACAT | |
HAMP (Hepcidin) | F | CCACAACAGACGGGACAAC |
R | AAAATGCAGATGGGGAAGTG | |
ID1 | F | TGGAGCTGAACTCGGAATCCG |
R | GACACAAGATGCGATCGTCCG | |
SMAD7 | F | TCACCTTAGCCGACTCTGCG |
R | GTTTCAGCGGAGGAAGGCAC | |
ZFYVE9 (SARA) | F | CTGTGCTTCCTGCTGTAGCCTGAAA |
R | TTAGGGCTCTGGCTTGAGGCACT | |
ZFYVE16 (Endofin) | F | ATGGCTTGTAGTGCTGCGCTGT |
R | AGGCAGAAGTTGGCCTTCAGATCC |
Proximity Ligation Assays (PLA)
The mouse/rabbit red starter Duolink kit (Sigma-Aldrich) was used for this experiment. HepG2/C3A cells were seeded at 10 × 104 cells per well in a 12-well cluster plate and transfected with pDMyc-Neo-Endofin14 or pDMyc-Neo-SARA14 plasmids as described above. The cells were fixed and permeabilised as described previously39. After permeabilisation the cells were incubated in the blocking buffer (provided with the kit) for 1 hr at 37 °C in a humidified chamber. Next, cells were incubated with the primary antibodies diluted in the antibody diluents for 1 hr at room temperature. Primary antibodies used were mouse anti-Myc 9B11 (1:2000; Cell Signaling Technology), rabbit anti-SMAD1 (1:50; Life Technologies), rabbit anti-SMAD2/3 (1:800; Cell Signaling Technology), mouse anti-TfR1 (1:500; Life Technologies) and rabbit anti-TfR1 (1:100; Abcam, Cambridge, UK). Cells were then washed in Buffer A (supplied with the kit) 2 times for 5 min each and incubated with the PLA probes for one hour at 37 °C in a humidified chamber. Cells were washed 2 times for 5 min each in Buffer A before the ligation step at 37 °C for one hour in a humid chamber. Following 2 times of 2 min washes, cells were incubated with the amplification mix for 2 hr at 37 °C in a darkened humidified chamber. Cells were washed with 1 × Buffer B (supplied with the kit) 2 times for 10 minutes followed by a 1 min wash with 0.01 × Buffer B before mounting on cover slips using the mounting media supplied with the kit.
Western blotting
Cell lysates were homogenised in phosphatase inhibitor lysis buffer and western blotting was carried out as previously described40. Blots were incubated with antibodies: anti-endofin14 (1:30000), anti-phospho-SMAD1/5/8 (1:3000; Cell Signaling Technology, Danvers MA, USA), anti-HA 12CA5 hybridoma supernatant (1:2000; ATCC, Manassas, VA, USA) and anti-actin (1:20000; Sigma-Aldrich, Missouri, USA). Bands developed on film were scanned using Scanmaker 9800 XL plus (Microtek International Inc. Hsinchu, Taiwan) and subsequently quantified by densitometry using the GeneGenius Imaging System (Syngene, Cambridge, UK).
Mutagenesis
Endofin variants were identified through SNP database searches (http://www.ncbi.nlm.nih.gov/projects/SNP) and were analysed using Sorting Intolerant From Tolerant (SIFT; http://sift.jcvi.org/) and Polymorphism Phenotyping v2 (PolyPhen-2; http://genetics.bwh.harvard.edu/pph2/) programs. Six variants (rs13157990, rs61741923, rs16877836, rs35915800, rs34397330 and rs35033083) with potentially deleterious mutations, as predicted by these programs, were selected for mutagenesis. All primers designed to introduce the site-directed mutation were synthesised by Integrated DNA Technologies (IDT, Coralville, Iowa). Mutations were introduced into HA-tagged endofin constructs in pDHA14 with the primers listed in Table 2. Mutagenesis was then carried out according to Scott et al.41 with changes as noted: a PCR mixture containing 75 ng template plasmid DNA, 2 μM of each oligonucleotide, 2 mM dNTPs, 50 U KOD DNA polymerase (Merck Chemicals, Victoria, Australia) and polymerase buffer in a total volume of 50 μl. PCR was performed under the following conditions; denaturation at 95 °C for 2 min, followed by 18 cycles of denaturation at 95 °C for 20 seconds, annealing at 58 °C for 10 seconds and extension at 68 °C for 5 minutes. The endofin insert was sequenced to ensure that the generated mutation was present and no other unintentional sequence changes had been inserted during the mutagenesis procedure.
Table 2. Oligonucleotide primers used for site-directed mutagenesis.
SNP ID | Primer | Sequence |
---|---|---|
rs13157990 R766G | F | TTACTTTTACCAAACGGGGACACCATTGCCGAGCA |
R | TGCTCGGCAATGGTGTCCCCGTTTGGTAAAAGTAA | |
rs61741923 E1431Q | F | GAGAAGATTGTAAAATGTACCCAGGTGTTCTACTTTCTAAAGG |
R | CCTTTAGAAAGTAGAACACCTGGGTACATTTTACAATCTTCTC | |
rs16877836 T1519N | F | TGTGATCCATGGTGGGAACTCCAACTCTAGTTTAC |
R | GTAAACTAGAGTTGGAGTTCCCACCATGGATCACA | |
rs35915800 K325Qfs*4 | F | ATTCAAATTCAAGAGATGAAAATTTTCAAATTACCTGACTTTTCC |
R | GGAAAAGTCAGGTAATTTGAAAATTTTCATCTCTTGAATTTGAAT | |
rs34397330 N729Kfs*19 | F | CAAATGAAGATTCTGTACCTGAAAAACACTTGCAAAGAAGGCT |
R | AGCCTTCTTTGCAAGTGTTTTTCAGGTACAGAATCTTCATTTG | |
rs35033083 T928Yfs*8 | F | AGTGGAAAAGCCAAACAATGAGTACAGGAGATATTACAAGAAATG |
R | CATTTCTTGTAATATCTCCTGTACTCATTGTTTGGCTTTTCCACT |
Mutant bases are indicated in bold.
Indirect immunofluorescence microscopy
Cultured cells were grown on glass coverslips overnight and were prepared for immunofluorescence as described previously42. Primary antibodies used to assess expression were rabbit anti-endofin14 (1:500), rabbit anti-HA H6908 (1:100; Sigma-Aldrich), mouse anti-EEA1 (1:400; BD Transduction Labs, San Jose, CA, USA) and rabbit anti-ERp5743 (1:600; a gift from Prof. Stephen High, University of Manchester, Manchester, UK). Cells were mounted onto glass slides using ProLong Gold anti-fade with 4′, 6-diamidino-2-phenylindole dihydrochloride (DAPI) (Molecular Probes, Life Technologies, Mulgrave, Australia). Fluorescent images were viewed and captured using a Zeiss LSM 780 NLO inverted confocal microscope (Carl Zeiss, Oberkochen, Germany).
Statistical analysis
Statistics were generated using GraphPad Prism software v.6.0 (GraphPad Software, San Diego CA, USA). Results were expressed as the mean ± standard error. Variables were compared between groups using two way analysis of variance (2-way ANOVA). Post-hoc analysis was performed to compare the differences between groups using Tukey’s multiple comparison test. Statistical significance is indicated as follows: *indicates a p-value of < 0.05, **p < 0.01, ***p < 0.001. Graphs were prepared using Graphpad Prism 6.
Additional Information
How to cite this article: Goh, J. B. et al. Endofin, a novel BMP-SMAD regulator of the iron-regulatory hormone, hepcidin. Sci. Rep. 5, 13986; doi: 10.1038/srep13986 (2015).
Acknowledgments
We thank Cameron McDonald, Gautam Rishi and Lesa Ostini for advice and technical assistance. This work was supported in part by a Project Grant (APP1031325) from the National Health and Medical Research Council (NHMRC) of Australia to VNS. DFW was supported by the Gastroenterological Society of Australia Senior Research Fellowship. VNS is the recipient of an NHMRC Senior Research Fellowship (APP1024672).
Footnotes
Author Contributions J.G., D.F.W., W.H. and V.N.S. conceived and designed the experiments; J.G. performed the experiments; J.G., D.F.W., W.H. and V.N.S. analysed the data; J.G., D.F.W. and V.N.S. wrote the paper.
References
- Paralkar V. M., Vukicevic S. & Reddi A. H. Transforming growth factor beta type 1 binds to collagen IV of basement membrane matrix: implications for development. Dev Biol 143, 303–308 (1991). [DOI] [PubMed] [Google Scholar]
- Tian H. Y. et al. Comparative proteomic analysis of cell cycle-dependent apoptosis induced by transforming growth factor-beta. Biochim Biophys Acta 1794, 1387–1397 (2009). [DOI] [PubMed] [Google Scholar]
- Miyazono K., Kamiya Y. & Morikawa M. Bone morphogenetic protein receptors and signal transduction. J Biochem 147, 35–51 (2010). [DOI] [PubMed] [Google Scholar]
- Derynck R. & Zhang Y. E. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425, 577–584 (2003). [DOI] [PubMed] [Google Scholar]
- Rosenzweig B. L. et al. Cloning and characterization of a human type II receptor for bone morphogenetic proteins. Proc Natl Acad Sci USA 92, 7632–7636 (1995). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cheifetz S., Like B. & Massague J. Cellular distribution of type I and type II receptors for transforming growth factor-beta. J Biol Chem 261, 9972–9978 (1986). [PubMed] [Google Scholar]
- Canalis E., Economides A. N. & Gazzerro E. Bone morphogenetic proteins, their antagonists, and the skeleton. Endocrine reviews 24, 218–235 (2003). [DOI] [PubMed] [Google Scholar]
- Kim J., Johnson K., Chen H. J., Carroll S. & Laughon A. Drosophila Mad binds to DNA and directly mediates activation of vestigial by Decapentaplegic. Nature 388, 304–308 (1997). [DOI] [PubMed] [Google Scholar]
- Yamamoto N. et al. Smad1 and smad5 act downstream of intracellular signalings of BMP-2 that inhibits myogenic differentiation and induces osteoblast differentiation in C2C12 myoblasts. Biochem Biophys Res Commun 238, 574–580 (1997). [DOI] [PubMed] [Google Scholar]
- Zhang Y., Feng X., We R. & Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-beta response. Nature 383, 168–172 (1996). [DOI] [PubMed] [Google Scholar]
- Zhang Y., Musci T. & Derynck R. The tumor suppressor Smad4 DPC 4 as a central mediator of Smad function. Curr Biol 7, 270–276 (1997). [DOI] [PubMed] [Google Scholar]
- Tsukazaki T., Chiang T. A., Davison A. F., Attisano L. & Wrana J. L. SARA, a FYVE domain protein that recruits Smad2 to the TGFbeta receptor. Cell 95, 779–791 (1998). [DOI] [PubMed] [Google Scholar]
- Shi W. et al. Endofin acts as a Smad anchor for receptor activation in BMP signaling. J Cell Sci 120, 1216–1224 (2007). [DOI] [PubMed] [Google Scholar]
- Seet L. F. & Hong W. Endofin, an endosomal FYVE domain protein. J Biol Chem 276, 42445–42454 (2001). [DOI] [PubMed] [Google Scholar]
- Stenmark H., Aasland R., Toh B. H. & D’Arrigo A. Endosomal localization of the autoantigen EEA1 is mediated by a zinc-binding FYVE finger. J Biol Chem 271, 24048–24054 (1996). [DOI] [PubMed] [Google Scholar]
- Gillooly D. J., Simonsen A. & Stenmark H. Cellular functions of phosphatidylinositol 3-phosphate and FYVE domain proteins. Biochem J 355, 249–258 (2001). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mills I. G., Urbe S. & Clague M. J. Relationships between EEA1 binding partners and their role in endosome fusion. J Cell Sci 114, 1959–1965 (2001). [DOI] [PubMed] [Google Scholar]
- Ryan J. D., Ryan E., Fabre A., Lawless M. W. & Crowe J. Defective bone morphogenic protein signaling underlies hepcidin deficiency in HFE hereditary hemochromatosis. Hepatology 52, 1266–1273 (2010). [DOI] [PubMed] [Google Scholar]
- Gehrke S. G. et al. Iron stores modulate hepatic hepcidin expression by an HFE-independent pathway. Digestion 72, 25–32 (2005). [DOI] [PubMed] [Google Scholar]
- Katagiri T. et al. Identification of a BMP-responsive element in Id1, the gene for inhibition of myogenesis. Genes Cells 7, 949–960 (2002). [DOI] [PubMed] [Google Scholar]
- Benchabane H. & Wrana J. L. GATA- and Smad1-dependent enhancers in the Smad7 gene differentially interpret bone morphogenetic protein concentrations. Mol Cell Biol 23, 6646–6661 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee P. L., Beutler E., Rao S. V. & Barton J. C. Genetic abnormalities and juvenile hemochromatosis: mutations of the HJV gene encoding hemojuvelin. Blood 103, 4669–4671 (2004). [DOI] [PubMed] [Google Scholar]
- Babitt J. L. et al. Modulation of bone morphogenetic protein signaling in vivo regulates systemic iron balance. J Clin Invest 117, 1933–1939 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Toy W., Lim S. K., Loh M. C. & Lim Y. P. EGF-induced tyrosine phosphorylation of Endofin is dependent on PI3K activity and proper localization to endosomes. Cell Signal 22, 437–446 (2010). [DOI] [PubMed] [Google Scholar]
- Meynard D. et al. Lack of the bone morphogenetic protein BMP6 induces massive iron overload. Nat Genet 41, 478–481 (2009). [DOI] [PubMed] [Google Scholar]
- Andriopoulos B. Jr. et al. BMP6 is a key endogenous regulator of hepcidin expression and iron metabolism. Nat Genet 41, 482–487 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Babitt J. L. et al. Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet 38, 531–539 (2006). [DOI] [PubMed] [Google Scholar]
- Goto D. et al. Interaction between Smad anchor for receptor activation and Smad3 is not essential for TGF-beta/Smad3-mediated signaling. Biochem Biophys Res Commun 281, 1100–1105 (2001). [DOI] [PubMed] [Google Scholar]
- Bakkebo M. et al. SARA is dispensable for functional TGF-beta signaling. FEBS Lett 586, 3367–3372 (2012). [DOI] [PubMed] [Google Scholar]
- Zhang F. et al. Sustained BMP signaling in osteoblasts stimulates bone formation by promoting angiogenesis and osteoblast differentiation. J Bone Miner Res 24, 1224–1233 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miura S. et al. Hgs (Hrs), a FYVE domain protein, is involved in Smad signaling through cooperation with SARA. Mol Cell Biol 20, 9346–9355 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Y. G., Wang Z., Ma J., Zhang L. & Lu Z. Endofin, a FYVE domain protein, interacts with Smad4 and facilitates transforming growth factor-beta signaling. J Biol Chem 282, 9688–9695 (2007). [DOI] [PubMed] [Google Scholar]
- Zuo X. et al. Whole-exome SNP array identifies 15 new susceptibility loci for psoriasis. Nature communications 6, 6793 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y. et al. Transforming growth factor-beta1 mediates psoriasis-like lesions via a Smad3-dependent mechanism in mice. Clin Exp Pharmacol Physiol 41, 921–932 (2014). [DOI] [PubMed] [Google Scholar]
- Chambers J. C. et al. Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. Nat Genet 41, 1170–1172 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benyamin B. et al. Common variants in TMPRSS6 are associated with iron status and erythrocyte volume. Nat Genet 41, 1173–1175 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Y. et al. Phosphoproteomics identified Endofin, DCBLD2, and KIAA0582 as novel tyrosine phosphorylation targets of EGF signaling and Iressa in human cancer cells. Proteomics 7, 2384–2397 (2007). [DOI] [PubMed] [Google Scholar]
- McDonald C. J. et al. Increased iron stores correlate with worse disease outcomes in a mouse model of schistosomiasis infection. PLoS One 5, e9594 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rishi G., Crampton E. M., Wallace D. F. & Subramaniam V. N. In situ proximity ligation assays indicate that hemochromatosis proteins Hfe and transferrin receptor 2 (Tfr2) do not interact. PLoS One 8, e77267 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wallace D. F., McDonald C. J., Ostini L. & Subramaniam V. N. Blunted hepcidin response to inflammation in the absence of Hfe and transferrin receptor 2. Blood 117, 2960–2966 (2011). [DOI] [PubMed] [Google Scholar]
- Scott S. P., Teh A., Peng C. & Lavin M. F. One-step site-directed mutagenesis of ATM cDNA in large (20kb) plasmid constructs. Hum Mutat 20, 323 (2002). [DOI] [PubMed] [Google Scholar]
- Wallace D. F., Harris J. M. & Subramaniam V. N. Functional analysis and theoretical modeling of ferroportin reveals clustering of mutations according to phenotype. Am J Physiol Cell Physiol 298, C75–84 (2010). [DOI] [PubMed] [Google Scholar]
- Oliver J. D., van der Wal F. J., Bulleid N. J. & High S. Interaction of the thiol-dependent reductase ERp57 with nascent glycoproteins. Science 275, 86–88 (1997). [DOI] [PubMed] [Google Scholar]