Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2015 Aug 17;112(35):10914–10919. doi: 10.1073/pnas.1505655112

MutL traps MutS at a DNA mismatch

Ruoyi Qiu a, Miho Sakato b, Elizabeth J Sacho a, Hunter Wilkins c, Xingdong Zhang d, Paul Modrich d,e, Manju M Hingorani b, Dorothy A Erie c,f,1, Keith R Weninger a,1
PMCID: PMC4568282  PMID: 26283381

Significance

DNA mismatch repair is the process by which errors generated during DNA replication are corrected. Mutations in the proteins that initiate mismatch repair, MutS and MutL, are associated with greater than 80% of hereditary nonpolyposis colorectal cancer (HNPCC) and many sporadic cancers. The assembly of MutS and MutL at a mismatch is an essential step for initiating repair; however, the nature of these interactions is poorly understood. Here, we have discovered that MutL fundamentally changes the properties of mismatch-bound MutS by preventing it from sliding away from the mismatch, which it normally does when isolated. This finding suggests a mechanism for localizing the activity of repair proteins near the mismatch.

Keywords: DNA mismatch repair, MutS, MutL, FRET

Abstract

DNA mismatch repair (MMR) identifies and corrects errors made during replication. In all organisms except those expressing MutH, interactions between a DNA mismatch, MutS, MutL, and the replication processivity factor (β-clamp or PCNA) activate the latent MutL endonuclease to nick the error-containing daughter strand. This nick provides an entry point for downstream repair proteins. Despite the well-established significance of strand-specific nicking in MMR, the mechanism(s) by which MutS and MutL assemble on mismatch DNA to allow the subsequent activation of MutL’s endonuclease activity by β-clamp/PCNA remains elusive. In both prokaryotes and eukaryotes, MutS homologs undergo conformational changes to a mobile clamp state that can move away from the mismatch. However, the function of this MutS mobile clamp is unknown. Furthermore, whether the interaction with MutL leads to a mobile MutS–MutL complex or a mismatch-localized complex is hotly debated. We used single molecule FRET to determine that Thermus aquaticus MutL traps MutS at a DNA mismatch after recognition but before its conversion to a sliding clamp. Rather than a clamp, a conformationally dynamic protein assembly typically containing more MutL than MutS is formed at the mismatch. This complex provides a local marker where interaction with β-clamp/PCNA could distinguish parent/daughter strand identity. Our finding that MutL fundamentally changes MutS actions following mismatch detection reframes current thinking on MMR signaling processes critical for genomic stability.


The DNA mismatch repair (MMR) system employs several proteins to locate and correct DNA replication errors that escape polymerase proofreading. Mutations in these proteins contribute to MMR dysfunction that is associated with carcinogenesis, such as Lynch syndrome and other diseases associated with high mutator phenotypes (1, 2). In all organisms, MMR is initiated by binding of MutS homologs to a base–base mismatch or an insertion/deletion loop (IDL), followed by ATP-dependent recruitment of MutL homologs to begin the process of repair (3, 4). Following MutL recruitment, a key event is the introduction of a nick that directs excision and resynthesis of the nascent DNA strand containing the error (57).

In methyl-directed MMR, which occurs in Escherichia coli, the mismatch- and ATP-dependent MutS–MutL–DNA complex activates the protein MutH to nick transiently unmethylated d(GATC) sequences in the daughter strand. Notably, however, MutH is not widely conserved in prokaryotes and does not exist in eukaryotes. Recent in vitro studies of eukaryotic MMR indicate that in these MutH-free organisms, detection of a mismatch by MutS or MutSα [MutS(α)] licenses MutL(α) to interact with the processivity factor (β-clamp/PCNA), which in turn activates the latent endonuclease activity of MutL(α) to incise the daughter DNA strand on both the 3′ and 5′ sides of the error (811). The interaction between MutL and the β-clamp (or between MutLα and PCNA) provides the strand discrimination signal because the β-clamp (or PCNA) is loaded asymmetrically at the replication fork or at a nick in DNA (10, 12).

The importance of the nicking activity of MutL homologs is highlighted by the observation that mutations that impair yeast MutLα endonuclease activity cause a significant mutator phenotype and genomic instability (11, 13, 14). Despite the well-established significance of strand-specific nicking in MMR, the mechanism(s) by which MutS and MutL assemble on mismatched DNA to allow subsequent activation of MutL endonuclease activity by β-clamp/PCNA remains elusive. There is general agreement that in both prokaryotes and eukaryotes, after binding a mismatch MutS or MutSα can undergo conformational changes to a mobile clamp state that can move away from the mismatch (6, 15). What happens after this step is mired in controversy. Several disparate models for MutS(α)–MutL(α) mismatch complex formation and the subsequent signaling of repair have been proposed (e.g., see refs. 6, 7, 1521). One prominent model in the field has MutL(α) joining MutS(α) to form MutS(α)–MutL(α) sliding clamps that diffuse along the DNA to interact with the strand-discrimination signal (β-clamp/PCNA or MutH) (16). Other models include trapping of MutS(α) clamps near the mismatch by MutL(α) followed by DNA looping or, alternately, MutS(α)-induced polymerization of MutL(α) along the DNA to reach the strand-discrimination signal (6, 7, 15, 18, 22). Some degree of localization to the mismatch is suggested by in vitro studies of eukaryotic MMR proteins, indicating that although MutLα can introduce nicks across long stretches of DNA, they occur preferentially in the vicinity of the mismatch (9, 11, 12).

In this study, we have used single molecule fluorescence to demonstrate that in the case of Thermus aquaticus (a MutH-free organism), MutL traps MutS at the mismatch after its ATP-induced activation but before its conversion into a sliding clamp. The resulting MutS–MutL mismatch complex typically contains more MutL than MutS, with one or two MutS dimers and up to four MutL dimers. MutS exists in a conformationally dynamic state within these complexes, which may be relevant for subsequent steps in MMR. In contrast to a mobile MutS–MutL complex, localization of MutS–MutL at the mismatch can restrict β-clamp/PCNA-activated MutL nicking to the vicinity of the mismatch, thereby enhancing MMR efficiency and limiting excessive excision and resynthesis that can destabilize the genome.

Results and Discussion

MutL Lengthens the Dwell Time of MutS at a DNA Mismatch.

We recently used single molecule fluorescence resonance energy transfer (FRET) between donor fluorophore-labeled T. aquaticus (Taq) MutS protein and DNA with an acceptor dye located 9 bp from a T bulge to monitor the interaction of MutS with a mismatch in the presence of ADP or ATP (21). Results from that study revealed that in the presence of ATP, 20% of the mismatch-bound MutS proteins convert into sliding clamps (as reported by transition to FRET 0; Fig. 1 A and B), whereas the other 80% exhibit simple mismatch binding and dissociation with the same kinetics as seen in the presence of ADP, presumably having undergone ATP hydrolysis prior to mismatch binding (21).

Fig. 1.

Fig. 1.

MutL extends the bound time of MutS at a DNA mismatch with ATP. (A) Experimental scheme: 2 mM ATP, 10 nM Alexa 555–MutS (donor), Cy5–T-bulge DNA (acceptor), and 200 nM unlabeled MutL (when present). Example time traces of donor and acceptor emission under 532-nm illumination and calculated FRET in the absence (B) and presence (C) of MutL. The dashed lines denote dwell times at the mismatch for these events. Histograms of total mismatch dwell times for hundreds of individual MutS-mismatch binding events with exactly one donor and one acceptor in the absence (D) or presence (E) of MutL were fit (red lines) with indicated rates for a two-step transition (SI Materials and Methods). Similar measurements of GT mismatched DNA in the absence (F) or presence (G) of MutL. In B (and Fig. 4B) the sliding clamp state (indicated) characterized by FRET = 0 is verified by (i) acceptor emission under red laser illumination at the end of the data acquisition, and (ii) the duration of the FRET = 0 state is shorter than typical donor bleaching but is consistent with expected dwell time of a sliding clamp MutS on unblocked DNA (as described in detail in ref. 21.) In H, MutS sliding clamp formation correlates inversely with MutL concentration. In buffer with 2 mM ATP, about 80% of the MutS binding events are identical to those with 2 mM ADP (i.e., FRET value of 0.68, lifetime of 2.7 s and direct dissociation from the mismatch without sliding). In the remaining 20% binding events, FRET transitions were observed with or without MutL. Of these FRET transitioning events, 80% resulted in MutS conversion to sliding clamps in the absence of MutL (∼15% of total MutS binding events). As MutL concentration was raised, the fraction of transitioning FRET events in which MutS converted to sliding clamps decreased dramatically. With 200 nM MutL in the reaction, only about 15% of the dynamic FRET events resulted in sliding clamps (∼3% of total MutS binding events). These populations were not affected by preexisting nicks in DNA, because the results were the same for substrates with more (1× ligase-treated DNA; circle) or fewer nicks (3× ligase-treated DNA; triangle). See more details in Fig. S3 and SI Materials and Methods. (IK) Ensemble studies confirm MutL-induced stabilization of ATP-bound MutS at a mismatch. FRET between Alexa 555–MutS and Cy5–T bulge was used to monitor the effects of ATP and MutL on MutS interactions with mismatched DNA. (I) Stopped-flow trace showing increase in FRET as Alexa 555–MutS (0.13 μM) binds Cy5–T bulge at 0.6 s−1 at 40 °C (apparent kon = 4.6 × 106 M−1⋅s−1); this rate constant is consistent with previous bulk kinetic measurements of 3–6 × 106 M−1⋅s−1 using 5-carboxytetramethylrhodamine (TAMRA) or 2-aminopurine labeled DNA (28, 38). (J) Stopped flow traces of Alexa 555–MutS and Cy5–T bulge mixed with excess unlabeled trap T-bulge DNA show slow FRET decrease, indicating release of MutS from the mismatch at 0.01 s−1 in the absence of ATP (comparable to the previously reported rate of 0.05 s−1 with TAMRA-labeled DNA) (28), irrespective of MutL (light green, pink traces). ATP binding to MutS stimulates its release from the mismatch as a sliding clamp at a ∼20-fold faster rate of 0.2 s−1 (dark green trace), similar to that reported from single molecule measurements with the same assay system (21) and ensemble measurements with TAMRA-labeled DNA (28). But addition of MutL stabilizes the complex such that only a fraction of ATP-bound MutS (∼1/3) is released as a sliding clamp at 0.2 s−1, whereas most of it is retained at the T-bulge and dissociates 10-fold slower at 0.02 s−1 (purple trace). (K) The same experiment performed in the absence of trap DNA (i.e., free MutS can rebind Cy5–T bulge) confirms that MutL stabilizes the MutS–ATP–T-bulge complex, as there is no net decrease in FRET over time (purple trace) in contrast with ATP-induced sliding of MutS off the mismatch at 0.3 s−1 in the absence of MutL (dark green trace; the amplitude change is smaller than in the reaction with trap DNA (J) due to a fraction of MutS rebinding Cy5–T bulge following ATP hydrolysis).

In this study, we examined the effects of MutL on MutS–DNA interactions under different nucleotide conditions. Addition of MutL does not alter the behavior of MutS on mismatched DNA in the presence of ADP, nor of the 80% of MutS in the presence of ATP that behaves the same as with ADP (Fig. S1). In contrast, MutL dramatically alters the behavior of 20% of MutS in the presence of ATP (Fig. 1C), which is the same fraction of MutS that forms ATP-bound sliding clamps in the absence of MutL (21). Decreasing MutL concentration decreases the fraction of MutS proteins that show these altered properties, confirming a MutL-specific effect (Fig. 1H). For this subset, (i) MutL increases the residence time of MutS at the mismatch by ∼10-fold, from ∼5 s to 40 s (Fig. 1 D and E); (ii) MutS rarely exhibits a FRET of 0 before dissociation (or photobleaching), indicating that the MutL-stabilized MutS-mismatch complexes do not form sliding clamps that move away from the mismatch before dissociation (Fig. 1C); and (iii) MutL alters the conformations and dynamics of MutS at the mismatch (discussed later). Notably, experiments with DNA containing a GT mismatch demonstrate that MutL also increases the overall lifetime of ATP-bound MutS at a GT mismatch by ∼10-fold (Fig. 1 F and G), from tens of seconds to hundreds of seconds, indicating that these findings are not limited to a T bulge (SI Materials and Methods and Fig. S1 AD for details on the MutS–GT DNA complex and SI Materials and Methods and Fig. S1E for additional controls). Finally, consistent with these single molecule results, stopped-flow ensemble experiments monitoring FRET between MutS and T-bulge DNA at 40 °C also show that MutL increases the residence time of ATP-bound MutS at a mismatch by ∼10-fold (Fig. 1 IK and SI Materials and Methods).

Fig. S1.

Fig. S1.

(AD) Dynamics of MutS binding to GT mismatch. Single molecule FRET measurements of Alexa 555–MutS and Cy5-labeled DNA containing a GT mismatch showed results comparable to T-bulge DNA. Without any nucleotide (A) or with 2 mM ADP (B), MutS yields a stable FRET signal on binding to GT. With 2 mM ATP (C), 76% of binding events are similar to the ADP conditions, and 24% of the binding events result in sliding clamps after a two-step transition at the mismatch (only transitioning events are shown in C). In all conditions, the binding events can be divided into two subsets, one with higher FRET and one with lower FRET. The two subsets have similar population and lifetimes, hence we suggest that the different FRET values are due to dye labeling on different subunits of the MutS homodimer, which has an asymmetric conformation when bound to a mismatch. When MutL is added to the reaction, MutS is trapped at the GT mismatch (Fig. 1 F and G) and fast conformational transitions are observed, as with T bulge, for FRET between MutS donor and DNA acceptor (D, Top) and between donor and acceptor dyes on MutS dimers (D, Bottom). Note, both traces in D are limited by photobleaching of the acceptor. (E) Control experiments with MutS binding to surface immobilized Cy5-labeled 550 bp homoduplex DNA. Very brief binding events (∼50 ms) between Alexa 555–MutS and Cy5–homoduplex were observed (Top row). A total of 75% of the events exhibited zero FRET and 25% had high FRET (Middle Left row). The zero FRET events possibly represent MutS binding to the duplex or to the free end, whereas the high FRET events represent MutS binding directly to Cy5 on DNA. The short lifetime of these interactions distinguish them from MutS binding to mismatches (Middle Right row), which is usually 40 times longer. Addition of 200 nM MutL does not alter the interaction between MutS and homoduplex DNA (Bottom row). (F) MutL does not affect MutS-mismatch interactions in the presence of ADP and does not affect non-FRET transitioning interactions in the presence of ATP. Experiments using surface immobilized Cy5-labeled T-bulge DNA, 10 nM Alexa 555-labeled MutS, and 2 mM ADP result in brief binding events (Top row, columns 1 and 2) both in the absence (Left column) or presence of 200 nM MutL (second column). The FRET values (Middle row, 0.68 vs. 0.67, columns 1 and 2) and lifetimes (Bottom row, 2.68 s vs. 2.68 s, columns 1 and 2) are nearly identical in both cases and similar to previous measurements (21). In 2 mM ATP buffers (columns 3 and 4) 80% of events without MutL (column 3) and 75% of events with MutL (column 4) did not have transitions in FRET. Those events had FRET values and kinetics similar to ADP experiments.

MutL Prevents Loading of Multiple MutS on End-Blocked, Mismatch-Containing DNA.

Previous studies, including ours, have shown that ATP-dependent conversion of MutS into a sliding clamp frees up the mismatch site and allows loading of multiple MutS proteins, which get trapped on end-blocked DNA (5, 17, 20, 21). The observation that MutL stabilizes MutS at a mismatch predicts that MutS loading onto end-blocked DNA should be reduced in the presence of MutL. Monitoring the photobleaching of fluorescently labeled MutS on an end-blocked T-bulge substrate in the presence of ATP reveals that without MutL, up to eight MutS dimers can be loaded per DNA with lifetimes greater than 600 s (Fig. 2 AC) (20, 21). In contrast, addition of MutL greatly reduces accumulation of MutS sliding clamps, such that most DNAs are bound by only one or two MutS dimers (Fig. 2 D and E). In addition, in the absence of MutL, zero FRET (Fig. 2B) indicates MutS sliding clamps move away from the mismatch, whereas with MutL present, nonzero FRET (Fig. 2D) indicates at least one MutS remains near the mismatch. These results taken together with the FRET data described above (Fig. 1) indicate that MutL traps one or two MutS dimers at or near the mismatch.

Fig. 2.

Fig. 2.

MutL suppresses multiple MutS loading in the presence of ATP on end-blocked T-bulge DNA. (A) Experimental scheme as in Fig 1, except with antidigoxin end-blocked DNA. The proteins, 10 nM Alexa 555–MutS (75% label efficiency) and 200 nM MutL, were incubated for 15 min and rinsed. Example time traces of donor and acceptor emission with laser illumination indicated at the Top in the absence (B) and presence (D) of MutL. Red illumination was used first to locate Cy5–T-bulge DNA followed by green illumination to excite Alexa 555–MutS. Photobleaching steps were counted to determine MutS occupancy. Multiple MutS loading occurs without MutL in solution (C) and is suppressed with addition of MutL (E). Note, the FRET value 0 in B indicates MutS is in a sliding clamp form, having left the mismatch, whereas nonzero FRET in D indicates MutS is at (or near) the DNA mismatch.

Stoichiometry of MutS–MutL Mismatch DNA Complexes.

Because the dynamic experiments (as in Fig. 1) are limited to concentrations of ∼10 nM fluorescent protein, to examine the stoichiometries of MutS–MutL-mismatch complexes in more detail, we (i) incubated Alexa 647-tagged MutS (10 nM or 100 nM) and Alexa 555-tagged MutL (200 nM) with biotinylated T-bulge–DNA at room temperature and 40 °C, (ii) crosslinked the complexes with glutaraldehyde, (iii) captured the crosslinked complexes on a streptavidin surface, and (iv) used single-molecule fluorescence photobleaching to determine the number of Alexa 647-tagged MutS and Alexa 555-tagged MutL proteins in each complex (Fig. 3 and Fig. S2 AD). In all cases, formation of complexes containing MutL required the presence of mismatched DNA, ATP, and MutS (Fig. S2 EG), and we observed no significant population of excessively large assemblies. Most complexes contain one to two MutS dimers and two to three MutL dimers (Fig. 3D and Fig. S2). This number of MutS dimers is consistent with the number of dimers that we observe in our dynamic experiments with labeled MutS and unlabeled MutL (Fig. 2 D and E). In addition, the total number of proteins in the complex is similar to the number of proteins in complexes of yeast MutSα–MutLα detected by surface plasmon resonance (23). The observed excess of MutL over MutS contrasts with the proposed 1:1 stoichiometry in MutS–MutL sliding clamps (16, 24), but agrees with in vivo studies in E. coli and yeast, where repair foci contain more MutL than MutS proteins (18, 22), and with early DNA footprinting studies indicating complexes containing multiple MutS and MutL proteins at the mismatch (3, 25). Consistent with the latter observation, additional crosslinking experiments using unlabeled MutL, Alexa 555-tagged MutS and the Cy5–T-bulge–DNA revealed FRET in all complexes, confirming their presence near the mismatch, consistent with our dynamic experiments with uncrosslinked proteins (Fig. 2D). Rather than a sliding MutS–MutL clamp model, our findings suggest a model in which MutL flanks MutS at the mismatch, as first suggested by Modrich and coworkers (6, 7) and more recently by other investigators (18, 22).

Fig. 3.

Fig. 3.

Stoichiometry of MutS/MutL/T-bulge DNA complexes. (A) Experimental scheme: 10 nM Alexa 647–MutS, 200 nM Alexa 555–MutL, 5 nM biotinylated T-bulge DNA, and 2 mM ATP mixed to form complexes, followed by crosslinking, biotin-capture on the surface, and photobleaching-step counting. Photobleaching steps indicate that the distribution of MutS (B) and MutL (C) is maximal at 2 MutL and 1 MutS within a complex (D). The large dots in B and C are predicted dye distributions for each complex, given 50% labeling efficiencies of MutS and MutL in this experiment (SI Materials and Methods). Note, the number of MutS agrees in measurements with and without crosslinking (compare Figs. 2E and 3B). Atomic force microscope (AFM) imaging of crosslinked complexes yielded volumes consistent with these results (Fig. S2D and SI Materials and Methods).

Fig. S2.

Fig. S2.

Crosslinking-capture experiments at 40 °C (A and C) and with higher MutS concentration (B and C). (D) AFM measurements are in agreement with stoichiometry data that the MutS–MutL complex size does not exceed five of each dimer. As described in SI Materials and Methods, the expected dye distributions were modeled to estimate the number of MutS and MutL dimers present in the mismatch-bound complexes. At 10 nM MutS, the majority of complexes contain one or two MutS dimers and two or three MutL dimers (Fig. 3). As shown in B, increasing the concentration of MutS to 100 nM increases the number of MutS on T bulge by about two- to fourfold but the number of MutL increases only slightly. Essentially, increasing MutS concentration increases the fraction of complexes with 1:1 ratio of the two proteins but does not significantly increase the total number of proteins therein (2 MutS–2 MutL complexes are predominant). (EG) Controls for the crosslinking-capture experiments. By varying fluorophore labeling strategies (i.e., labeling any two of the three components: DNA, MutS, and MutL), we probed colocalization of MutS and DNA, MutL and DNA, and MutS and MutL under different experimental conditions. The data indicate that ternary complex formation is greatly dependent on the presence of ATP and mismatches in DNA. Note, in E, higher colocalization of MutS with the T bulge in the presence of MutL (45% vs. 15%) is consistent with MutL stabilizing MutS at the mismatch.

Intermediate Steps During Assembly of MutS–MutL Complexes.

Having characterized the composition of the MutS–MutL complexes at a mismatch, we next sought to elucidate the mechanism of complex formation. To this end, we examined the impact of MutL on the kinetics of MutS mismatch recognition and its subsequent conformational changes in solution, in real time (Fig. 4A). Our previous experiments (21) showed that conversion of MutS into a sliding clamp involves at least two steps wherein MutS first binds to the mismatch (resulting in FRET of 0.65) and then undergoes a conformational change (resulting in FRET 0.45) before forming a clamp that diffuses away from the mismatch (resulting in FRET 0) and slides off the free DNA end (resulting in loss of the donor signal) (Figs. 1B and 4B).

Fig. 4.

Fig. 4.

MutL alters the kinetics of MutS mismatch recognition and subsequent conformational changes. (A) Experimental scheme: 2 mM ATP, 10 nM Alexa 555–MutS, Cy5–T-bulge DNA, and 200 nM unlabeled MutL (when present). Example time traces of donor and acceptor emission and calculated FRET in the absence (B) and presence (E) of MutL for events with transitions. FRET histograms for binding events with exactly one donor and one acceptor and with FRET transitions reveal three states in the absence of MutL (C) with dwell time distributions fit (red line) by a two-step model for the first state (D, Top show rates 1.1 ± 0.67 s−1 and 0.45 ± 0.02 s−1, where ± indicates SE of two independent replicates) and a one-step model for the middle state and last state (D, Middle and Lower). In the presence of MutL, FRET histograms for the first state (F, Top) reveal a narrow peak, but the dwell time distributions (G, Top) still require a fit (red line) with two steps (rates 0.56 ± 0.14 s−1 and 0.20 ± 0.05 s−1, where ± indicates SE of two independent replicates). Histograms of the subsequent FRET states show two nonzero peaks (F, Lower), and the dwell time distributions fit well (red line) with a one-step model (G, Middle and Lower). Numbers within panels report rates obtained from the fits. (H) A model derived from the results (MutL: yellow/tan; MutS: green/blue). The proposed FRET states, MutS nucleotide states (D, ADP and T, ATP Above MutS) as well as MutS and DNA conformations are indicated. Later nucleotide states of MutS that are not yet precisely determined are marked by gray shading.

As expected, MutL does not alter the FRET of the initial MutS mismatch recognition complex (0.65); however, it dramatically changes subsequent conformational transitions. The dwell-time distributions of the first FRET state (0.65) in the presence or absence of MutL exhibit clear rise and decay (Fig. 4 D and G), indicating two rate-limiting steps between FRET 0.65 and the next FRET state (26, 27) and therefore the existence of two states with a FRET of 0.65 (which we designate 0.65 and 0.65*) (Fig. 4H). Fitting these data (SI Materials and Methods) (Fig. 4 D and G, red lines) yields similar rates in the absence of MutL (1.1 ± 0.67 s−1 and 0.45 ± 0.02 s−1) and in its presence (0.56 ± 0.14 s−1 and 0.20 ± 0.05 s−1). Given that the rates of both transitions are slower than the estimated rate of ATP-induced ADP dissociation measured in ensemble studies (28), we propose that the first step (0.65→0.65*) requires ADP release followed by rapid ATP binding (106 M−1⋅s−1 and >103 s−1 at 2 mM ATP) (28, 29), and the second step (to FRET 0.45 without MutL; Fig. 4 C and D) is a conformational change of the doubly ATP-liganded state (Fig. 4H), consistent with previous suggestions (15, 17). Notably, although MutL does not dramatically impact the FRET levels or kinetics of the initial MutS conformational change (0.65→0.65*), it alters the subsequent conformation, which exhibits FRET 0.45 without MutL but FRET 0.3 with MutL. These results indicate that MutL interacts with MutS after the ADP–ATP exchange, as suggested by previous studies (15, 17), but before MutS transitions to FRET 0.45, demonstrating that MutL binding to MutS immediately after its ATP binding-induced conformational change traps it at the mismatch (Fig. 4H). This latter finding provides an explanation for the observation that yMutLα can interact with an ATPase-site mutant of yMutSα that does not form a sliding clamp (30). Interestingly, a recent study monitoring DNA bending with small angle X-ray scattering in solution (31), suggests that, for E. coli proteins, MutL interacts with MutS after an ATP-dependent conformational change from a bent DNA state to an unbent DNA state. If E. coli and Taq MMR follow the same pathway (discussed later in Conclusions), then extrapolating this result suggests that our FRET 0.45 state (between protein and DNA) involves unbent DNA (Fig. 4H) (32, 33).

In the absence of MutL, MutS in the 0.45 FRET state transitions to a sliding clamp with FRET of 0 and ultimately slides off the free DNA end (no donor fluorescence) (Fig. 4B). In contrast, in the presence of MutL, MutS remains at the mismatch and fluctuates rapidly between FRET of 0.3 and 0.6 before eventually dissociating directly from the mismatch (or photobleaching) without transitioning to 0 FRET (Figs. 1C and 4E). The narrowness of the FRET 0.3 and 0.6 histograms (Fig. 4F) confirms that MutL-stabilized MutS remains at or very near the mismatched base, because movement of MutS even a few nucleotides from the mismatch would broaden the FRET distributions. In addition, we only observe these two interconverting states (FRET 0.3 and 0.6) in the presence of MutL (Fig. 4 F vs. C), strongly suggesting that MutL is present and is influencing the conformation of MutS. To understand the nature of the rapid transitions, we also monitored intraprotein FRET between donor and acceptor fluorophore-tagged mismatch binding domains I of MutS dimers bound to unlabeled DNA (Fig. S3 AD). The data show that these domains alternate between two conformational states with the same kinetics as the FRET transitions seen between MutS and the DNA (Fig. 4F). Taken together, these results indicate that MutL traps MutS at (or very near) the mismatch site, but that MutS mismatch binding domains remain mobile. It is notable that MutS domains I switch between conformationally mobile and static states depending on its ligand-bound form (e.g., mobile in free MutS, static in mismatch-bound MutS and then mobile again in ATP-, mismatch- and MutL-bound MutS) (21). A specific role for MutS domain I dynamics in signaling downstream events after mismatch recognition remains to be determined.

Fig. S3.

Fig. S3.

(AD) MutS mismatch binding domains (containing the M88C labeling site) remain conformationally dynamic in the MutS–MutL mismatch complex. (A) Experimental scheme: 2 mM ATP, 10 nM Alexa 555 + Alexa 647-labeled MutS dimer, unlabeled T-bulge DNA, and 200 nM unlabeled MutL. (B) Example time traces of donor and acceptor emission under 532-nm illumination and calculated FRET for events showing dynamic FRET changes with MutS containing exactly one donor and one acceptor. (C) Histograms of the FRET values have two peaks, and the dwell times of these two FRET states (D) match the dwell times of FRET transitions between Alexa 555–MutS and Cy5–T-bulge DNA (Fig. 4G) in the presence of MutL. (EH) Change in quantum yield of Cy5 on DNA potentially caused by MutL binding to adjacent nicks. Cy5 is located 13 bases from the 3′ end of the oligo used to insert a mismatch into the 550-bp substrate. MutL can potentially bind to an unligated nick and affect the quantum yield of Cy5 nearby. In the presence of 200 nM MutL (no MutS) and 2 mM ATP, 80% of the DNA treated three times with ligase shows stable fluorescence intensity (shot noise limited) under 632-nm excitation (E). Unligated DNA shows large intensity fluctuations under the same conditions (>50% of theoretical shot noise, F). The table in G lists the fraction of molecules with stable intensity for DNAs processed through different cycles of ligase treatment and purification. The Cy5–GT substrate listed in the table was purified to separate fully ligated from partially ligated samples by high performance liquid chromatography (HPLC) using a Gen-Pak Fax column (4.6 × 100 mm; Waters) (SI Materials and Methods). (H) DNA denaturing PAGE (Left) confirms that multiple ligase treatments increase the yield of fully ligated DNA (Left, Cy5–T bulge, fluorescence scan of gel), which correlates with the increasing Cy5 emission stability in the presence of MutL. H, Right is a denaturing agarose analysis of the Cy5–GT DNA substrate following HPLC purification.

SI Materials and Methods

MutS Protein.

T. aquaticus (Taq) MutS with mutations C42A and M88C was expressed and purified as described previously (21, 29). Briefly, MutS was expressed in E. coli BL21(DE3) and purified by Q-Sepharose chromatography followed by ammonium sulfate precipitation. M88C was labeled with Alexa 555– and/or Alexa 647–maleimide with efficiencies ranging from 50% to 75%. DNA mismatch binding and ATPase activities of dye-labeled MutS C42A/M88C were verified as comparable to native protein, as reported previously (21).

MutL Protein.

Taq MutL was cloned using T. aquaticus genomic DNA prepared from strain YT-1 (ATCC). The sequence matched that deposited by Yamamoto et al. (GenBank ID: U50453.1). The 10His-tag MutL (pET16b) was expressed in E. coli BL21(DE3) cells and purified by Histrap FF crude column chromatography followed by Factor Xa protease treatment to remove the tag and then Histrap FF crude and Hitrap ANX ion-exchange column chromatography. Untagged MutL (pET11a) was also expressed in E. coli BL21(DE3) cells and purified by ammonium sulfate fractionation followed by Hitrap heparin HP and Superdex 200 gel filtration column chromatography. The 6His-tag MutL (pET17b; gift from Peggy Hsieh, NIH, Bethesda, MD) was expressed similarly and purified by Ni-NTA affinity chromatography. Different protein preparations yielded comparable results in smFRET experiments.

Taq MutL has three native cysteines (cys 457, 482, and 488). The standard labeling protocol with maleimide Alexa Fluor dyes results in less than 2% labeled protein. Hence, another cysteine was inserted between the 6His-tag and the MutL start site (Quickchange 5′ primer: CAT CAT CAT CAT CAC AGC TGC GGC CTG GTG CCG CGC G) such that the N-terminal sequence changed from M G S S H H H H H H S S G L V P R G S H to M G S S H H H H H H S C G L V P R G S H. This new version of MutL containing four cysteines labeled 50–100% per monomer.

DNA Substrates.

The 550-bp DNA substrate with a biotinylated end, a centrally located mismatch, and a digoxin-labeled opposite end was similar to the one described previously (21). An important change is that an insert shorter by six bases was used to avoid an unintended overhanging flap in the previous substrate (21). The sequences of the oligos (Integrated DNA Technologies) currently used as inserts are: Cy5–T bulge (/5Phos/TCA GCA ATC TCT CAG CCA G/iCy5/GC CTC AGC TGG CC), Cy5–GT (/5Phos/TCA GCA ATC CTC AG/iCy5/C CAG GCC TCG GCT GGC C), and Cy5–GC (/5Phos/TCA GCA ATC CTC AGC CAG /iCy5/GCC TCA GCT GGC C). Ligation efficiency of the mismatch containing oligo in the 550-bp substrate was improved after testing various approaches and using denaturing gel electrophoresis to assess product quality and quantity. Ligated Cy5–550 bp GT-containing DNA substrates were purified and isolated from PCR and reannealed products by high performance liquid chromatography using a Gen-Pak Fax column (4.6 × 100 mm; Waters). For the T-bulge substrate, using E. coli ligase rather than T7 ligase (both from New England Biolabs), incubation at 16 °C over 20 h, and repeated ligase treatments and cleanup using a PCR purification kit (Qiagen) between ligase applications, yielded the best results (Fig. S3 EH).

For the AFM experiment in Fig. S2, an unlabeled 99-bp substrate was prepared by annealing oligos (IDT) with the same sequence flanking the central T bulge as in the 550-bp substrate. For ensemble kinetics studies, a 69-bp Cy5-labeled substrate was prepared by annealing oligos (IDT) with the same sequence flanking the T bulge as in the 550-bp substrate; template strand: 5′-CTCTAGAGGATCCGCTGAGGCCAGCTGAGGCCTGGCTGAGGATTGCTGAGGAATTCACTGGCCGTCGTC -3′; T-bulge strand: 5′-GACGACGGCCAGTGAATTCCTCAGCAATCTCTCAGCCAG/iCy5/GCCTCAGCTGGCCTCAGCGGATCCTCTAGAG -3′.

Ensemble Kinetic Measurements and Data Analysis.

Mismatch binding and release kinetics were measured on a stopped-flow instrument (KinTek) at 40 °C by monitoring FRET between Alexa 555–MutS (C42A/M88C) and Cy5 located 9 bases from the T bulge in 69-bp duplex DNA. In binding experiments, Alexa 555–MutS was mixed with Cy5–T bulge in buffer (20 mM Hepes-NaOH, pH 7.5, 5 mM MgCl2, 50 mM NaCl, 1 mM DTT) and the change in Cy5 fluorescence measured over time (λEX = 555 nm, λEM > 660 nm). Final reactant concentrations were 0.13 μM Alexa 555–MutS and 0.04 μM Cy5–T bulge. In release experiments, Alexa 555–MutS, preincubated with Cy5–T bulge in the absence or presence of unlabeled, untagged MutL, was mixed with excess trap DNA (unlabeled 37-bp duplex containing a T bulge at the center) in the absence or presence of ATP. Final reactant concentrations were 0.05 μM Alexa 555–MutS, 0.1 μM Cy5–T bulge, 0.25 μM MutL (when present), 0.5 mM ATP (when present) and 2 μM trap DNA (when present). Three or more kinetic traces of 1,000 data points each were averaged for all experiments. After subtraction of background signals from Alexa 555–MutS (with or without ATP and/or MutL) and from Cy5–T bulge, the traces were normalized against signal at time 0. The data were fit to single or double exponential functions for estimation of rate constants.

smFRET Measurements and Data Analysis.

Biotinylated DNA was immobilized on the streptavidin/lipid passivated surface of a quartz slide as part of a flow chamber as described previously (21). Samples were imaged in a home-built prism-based, total internal reflection single molecule fluorescence microscope (previously described) (37) with the key optical elements being a water immersion 60×, 1.2 N.A. objective (Olympus), a Dualview optical splitter for FRET spectroscopy using a dichroic (645DCXR; Chroma) and band pass filters for the donor channel (HQ585/70 m) and acceptor channel (HQ700/75 m) (both from Chroma), and an emCCD for detection (Cascade 512B from Photometrics). For all experiments except the stoichiometry by photobleaching (Fig. 3), illumination started with 1 s of 635 nm laser light to excite acceptors on DNA, followed by 1–5 min of 532 nm laser light to excite donors and FRET, and finished with 5 s of 635 nm laser light to assess photobleached state of the acceptor. For the stoichiometry studies, illumination started with an extended 632-nm phase until all Alexa 647 had bleached and then switched to extended 532-nm illumination until all Alexa 555 bleached.

Background subtracted intensity vs. time traces for both donor (Id) and the acceptor (Ia) optical channels were extracted from the movies at locations identified as single molecules by intensity level, diffraction limited shape, and step photobleaching behaviors. Calibration movies using beads fixed on the surface inside a flow chamber that emit fluorescence into both optical channels were used to construct a map between donor and acceptor channels when extracting dual donor and acceptor intensity traces from individual molecular complexes. When FRET was evaluated, we calculated apparent FRET efficiency (E) as E = Ia/(Ia + Id) without gamma corrections. Dwell times for kinetic analysis were extracted from FRET efficiency traces by manual identification. Histograms of dwell times were fit to single exponential decays or k1*k2*(exp(−k1*t) – exp(−k2*t))/(k2 – k1) to account for a two-step process. These fits were insensitive to the specific bin size ranging from 0.1 to 0.3 s or to omitting/including the first time bin (shortest events, those at our camera frame rate).

In experiments measuring total dwell time with MutL present, for both T bulge and GT (Fig. 1), we ensured detection of the beginning of a binding event by recording data during flow application of MutS and MutL in solution. These experiments used 0.5-s time binning and lower laser power to minimize photobleaching during long binding events. In contrast, all other experiments used 0.1-s bins.

Control Experiments to Examine MutL–DNA Nonspecific Interactions.

Experiments examining the effect of MutL on MutS-mismatched DNA complexes require extensive controls because MutL homologs from human, yeast, and E. coli are known to have nonspecific DNA binding properties including homoduplex DNA binding and end binding (39). Ensemble fluorescence anisotropy reported nonspecific MutL binding to homoduplex DNA that was linearly dependent on MutL concentration, although single molecule fluorescence colocalization studies of 10 nM fluorescently labeled MutL in solution did not identify substantial binding to immobilized DNA substrates. Our earlier publication included an unintended flap near the Cy5 dye label (21). In this paper, we corrected the substrate to eliminate the flap, but incomplete ligase activity left variable fractions of DNA with a nick located 13 bases from the Cy5 (detected by denaturing PAGE; Fig. S3). Single molecule analysis of MutL-dependent changes in Cy5 quantum yield under red illumination on surface-immobilized DNA indicated that the protein binds the nick near the dye (Fig. S3). Specifically, we measured MutS binding events that converted to ATP-induced sliding clamps with two different T-bulge DNA samples, either treated with ligase once or thrice (each time followed by DNA purification). The 3× ligase-treated sample had fewer nicks (diagnosed by denaturing PAGE) and correspondingly fewer events with fluctuating Cy5 emission upon addition of MutL. Notably, despite differences in the levels of remnant nicks, both samples showed similar efficiency of MutS conversion to sliding clamps at all concentrations of MutL tested (Fig. 1H). This result rules out the possibility that MutL nick binding prevents formation of MutS sliding clamps.

MutL/MutS Complex Stoichiometry Measurements.

To measure the stoichiometry of MutS–MutL complexes on mismatched DNA, we stabilized protein/DNA complexes by crosslinking and then counted single fluorophore photobleaching after pulling down individual complexes. The experiments were performed with 10 nM Alexa 647–MutS and 200 nM Alexa 555–MutL (the same concentrations used in the dynamic experiments shown in Fig. 1), and with 100 nM Alexa 647–MutS and 200 nM Alexa 555–MutL. Exciting the donor in complexes containing both donor MutL and acceptor MutS generated FRET, confirming intimate contact between the proteins. FRET arising from multiple donors and acceptors in complexes complicates analysis of photobleaching steps; hence, we first excited acceptors until they photobleached to count the number of MutS and then switched illumination to excite donors until they photobleached to count the number of MutL.

We prepared 10-μL reactions in crosslinking buffer (20 mM Hepes-NaOH, pH 7.8, 100 mM NaOAc, 5 mM MgCl2) that contained 5 nM biotinylated mismatched DNA, 10 nM or 100 nM Alexa 647–MutS, 200 nM Alexa 555–MutL, and 2 mM ATP (as indicated in Fig. 3). The reactions were incubated at 25 °C or 40 °C for 10 min followed by addition of 1 μL reaction buffer containing 8.5% gluteraldehyde (wt/wt). Subsequent addition of 500 μL of 20 mM Tris⋅HCl pH 7.8, 100 mM NaOAc, 5 mM MgCl2 after 1 min quenched the crosslinking reaction (the reaction contains 0.9 μmoles of gluteraldehyde and the quencher contains 10 μmoles of Tris-associated primary amine). A total of 20∼50 μL of the this quenched, crosslinked sample was injected into flow chambers on quartz slides coated with streptavidin islands and lipid passivation (described above) for 5 min to allow pull-down of complexes via biotinylated DNA. Excess sample was washed out with image buffer containing oxygen scavenger (as above) for fluorophore counting on the TIRF microscope.

The presence of more MutS in crosslinked complexes at higher MutS concentration in solution during incubation (Fig. 3 BD vs. Fig. S2B or Fig. S2 A vs. C) may reflect the MutS dimer–tetramer equilibrium. With MutS at 100 nM and MutL at 200 nM, we found significantly smaller complexes on a 50-bp DNA with the T bulge located 10 bases from the end (21) than on the 550-base DNA with a centrally located T bulge. Lower protein occupancy on the shorter substrate suggests that the final MutS–MutL complex requires more DNA flanking the mismatch than present in the 50-bp substrate.

Dye labeling efficiency of MutS and MutL proteins used in the crosslinking-capture study was about 50%. This labeling efficiency results in one dye per dimer on average, and we labeled the plot axes in Fig. 3 BD and Fig. S2 accordingly. Statistical modeling allowed us to estimate the population of MutS and MutL dimers present in the complexes. Given 50% labeling, the expected dye number distributions for complexes with one, two, three, or four dimers were generated using the Poisson distribution. The experimentally measured distributions were fit to a sum of these four model distributions with amplitude coefficients as fit parameters. The dots shown on histograms in Fig. 3 B and C and Fig. S2B are the result of these fits. Fractional populations fitting to one, two, three, and four MutS dimers were 89%, 0%, 8%, and 2% for Fig. 3B, and 19%, 17%, 30%, and 33% for Fig. S2B. Fractional populations fitting to one, two, three, and four MutL dimers were 11%, 45%, 44%, and 0% for Fig. 3C and 0%, 50%, 5%, and 45% for Fig. S2B.

AFM Studies of MutL/MutS Complexes.

For AFM imaging, 100 nM MutS, 200 nM MutL, 2 mM ATP, and 500 nM T-bulge DNA (if present) were mixed in crosslinking buffer and incubated for 10 min at 25 °C before crosslinking as for the smFRET pull-down experiments described above. The sample was diluted and 20 μL was deposited onto freshly cleaved ruby mica (Spruce Pine Mica Company), rinsed immediately with nanopure water, excess water was blotted from the surface, and the surface was dried by a stream of nitrogen.

AFM images were captured in air using a Nanoscope IIIa (Digital Instruments) microscope in tapping mode. Pointprobe Plus tapping mode silicon probes (Nanosensors) with resonance frequencies of ∼170 kHz were used for imaging. Images were collected at a speed of 2–3 Hz with an image size of 1 mm at 512 × 512 pixel resolution. Images were analyzed using Nanoscope III v5.12r3 software and Image SxM v 1.96–3, and volume analysis was performed as described previously (40).

Conclusions

In summary, by directly monitoring assembly of individual MutS–MutL complexes at DNA mismatches, we have observed initial events in the repair mechanism following mismatch recognition. The observation that MutL can trap MutS at the mismatch before it forms a sliding clamp raises the question of what function might be served by sliding clamps. It may be the means by which MutS clears the mismatch site if MutL does not arrive in a timely manner to initiate repair. Our study also does not rule out the possibility that mobile MutS–MutL signaling complexes may form and complement the functions of stationary MutS–MutL mismatch complexes in DNA repair, e.g., for long-range search of a strand-discrimination signal when one is not available near the mismatch (5, 16). In MutH-dependent methyl-directed MMR (as in E. coli), localized assembly of MutS–MutL at the mismatch alone cannot account for orientation-dependent loading of the appropriate 5′-to-3′ or 3′-to-5′ excision system at the nick made by MutH at a d(GATC) site (34), because the mismatch can be up to a kilobase from the break (35) and the helicase loading process must involve signaling along the helix contour. The apparent requirement for mobile MutS–MutL complexes in methyl-directed repair may reflect fundamental differences from MutH-independent repair, such as in Taq and eukaryotes. In particular, early steps in methyl-directed repair are β/PCNA clamp-independent and the MutL homolog lacks endonuclease activity (34), whereas, in MutH-independent repair, MutL has latent endonuclease activity that is activated by β/PCNA at an early step. In the latter system, interactions between β/PCNA clamps, which are loaded onto primer-template DNA junctions in a specific orientation, and MutS–MutL complexes trapped at the mismatch site could direct MutL nicking activity to the nascent strand in the vicinity of the mismatch. This constraint would in turn limit the extent of strand excision and resynthesis and increase the efficiency of DNA mismatch repair (9, 11, 14, 36).

Materials and Methods

Taq MutS was expressed in E. coli, purified, and dye labeled at the M88C position as described (21). Taq MutL was cloned from Taq strain YT-1 (ATCC) genomic DNA into expression vectors either with or without His-tags, expressed in E. coli and purified by affinity, ion-exchange, and gel-filtration chromatography. A cysteine was inserted between the 6His-tag and MutL sequence for labeling, when indicated. The 550-bp DNA substrates are similar to those described previously (21), except an unintended internal flap overhang was corrected. Lipid passivated, streptavidin surfaces were used to immobilize biotinylated/digoxin-labeled DNA substrates, which could be blocked at the nonsurface tethered end by antidigoxin binding as described previously (21). smFRET was measured in a prism-type total internal reflection fluorescence microscope with a dualview image splitter before an emCCD and analyzed as described previously (21, 37). Experiments to determine complex stoichiometry were performed by mixing biotinylated DNA, ATP, MutS, and MutL in solution 10 min before adding glutaraldehyde to 0.8% final concentration for 1 min, diluting 46-fold with Tris buffer (20 mM Tris⋅HCl, 100 mM NaOAc, 5 mM MgCl2 pH 7.8) to quench crosslinking, flowing over an imaging surface coated with streptavidin islands and lipid bilayer passivation. This surface captured complexes via biotinylated DNA for single molecule fluorescence imaging and photobleaching step counting. All imaging was performed in imaging buffer (20 mM Tris⋅acetic acid, pH 7.8, 100 mM NaOAc, 5 mM MgCl2, 2% glucose (wt/wt) with oxygen scavenging/triplet state quenching additives, 100 units/mL glucose oxidase, 1,000 units/mL catalase, 0.05 mg/mL cyclooctatetraene, and 14 mM 2-mercaptoethanol). Additional details are available in SI Materials and Methods.

Note Added in Proof.

A recently published study demonstrated that addition of E. coli MutL greatly reduces the rate at which MutS slides off mismatched DNA, consistent with our findings (41).

Acknowledgments

We thank Anushi Sharma for helpful discussions. This work is funded by American Cancer Society Research Scholar Grant RSG-10-048 (to K.R.W.), NIH Grants GM079480 and GM080294 (to D.A.E.) and GM109832 (to D.A.E. and K.R.W.), and GM045190 (to P.M.), and National Science Foundation Grant MCB 1022203 (to M.M.H.). P.M. is an Investigator of the Howard Hughes Medical Institute.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission. J.A.T. is a guest editor invited by the Editorial Board.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1505655112/-/DCSupplemental.

References

  • 1.Martín-López JV, Fishel R. The mechanism of mismatch repair and the functional analysis of mismatch repair defects in Lynch syndrome. Fam Cancer. 2013;12(2):159–168. doi: 10.1007/s10689-013-9635-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Rasmussen LJ, et al. Pathological assessment of mismatch repair gene variants in Lynch syndrome: Past, present, and future. Hum Mutat. 2012;33(12):1617–1625. doi: 10.1002/humu.22168. [DOI] [PubMed] [Google Scholar]
  • 3.Grilley M, Welsh KM, Su SS, Modrich P. Isolation and characterization of the Escherichia coli mutL gene product. J Biol Chem. 1989;264(2):1000–1004. [PubMed] [Google Scholar]
  • 4.Habraken Y, Sung P, Prakash L, Prakash S. ATP-dependent assembly of a ternary complex consisting of a DNA mismatch and the yeast MSH2-MSH6 and MLH1-PMS1 protein complexes. J Biol Chem. 1998;273(16):9837–9841. doi: 10.1074/jbc.273.16.9837. [DOI] [PubMed] [Google Scholar]
  • 5.Erie DA, Weninger KR. Single molecule studies of DNA mismatch repair. DNA Repair (Amst) 2014;20:71–81. doi: 10.1016/j.dnarep.2014.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Iyer RR, Pluciennik A, Burdett V, Modrich PL. DNA mismatch repair: Functions and mechanisms. Chem Rev. 2006;106(2):302–323. doi: 10.1021/cr0404794. [DOI] [PubMed] [Google Scholar]
  • 7.Modrich P. DNA mismatch correction. Annu Rev Biochem. 1987;56:435–466. doi: 10.1146/annurev.bi.56.070187.002251. [DOI] [PubMed] [Google Scholar]
  • 8.Hsieh P, Yamane K. DNA mismatch repair: Molecular mechanism, cancer, and ageing. Mech Ageing Dev. 2008;129(7-8):391–407. doi: 10.1016/j.mad.2008.02.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kadyrov FA, Dzantiev L, Constantin N, Modrich P. Endonucleolytic function of MutLalpha in human mismatch repair. Cell. 2006;126(2):297–308. doi: 10.1016/j.cell.2006.05.039. [DOI] [PubMed] [Google Scholar]
  • 10.Pluciennik A, et al. PCNA function in the activation and strand direction of MutLα endonuclease in mismatch repair. Proc Natl Acad Sci USA. 2010;107(37):16066–16071. doi: 10.1073/pnas.1010662107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kadyrov FA, et al. Saccharomyces cerevisiae MutLalpha is a mismatch repair endonuclease. J Biol Chem. 2007;282(51):37181–37190. doi: 10.1074/jbc.M707617200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pluciennik A, et al. Extrahelical (CAG)/(CTG) triplet repeat elements support proliferating cell nuclear antigen loading and MutLα endonuclease activation. Proc Natl Acad Sci USA. 2013;110(30):12277–12282. doi: 10.1073/pnas.1311325110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Deschênes SM, et al. The E705K mutation in hPMS2 exerts recessive, not dominant, effects on mismatch repair. Cancer Lett. 2007;249(2):148–156. doi: 10.1016/j.canlet.2006.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pillon MC, et al. Structure of the endonuclease domain of MutL: Unlicensed to cut. Mol Cell. 2010;39(1):145–151. doi: 10.1016/j.molcel.2010.06.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kunkel TA, Erie DA. DNA mismatch repair. Annu Rev Biochem. 2005;74:681–710. doi: 10.1146/annurev.biochem.74.082803.133243. [DOI] [PubMed] [Google Scholar]
  • 16.Gorman J, et al. Single-molecule imaging reveals target-search mechanisms during DNA mismatch repair. Proc Natl Acad Sci USA. 2012;109(45):E3074–E3083. doi: 10.1073/pnas.1211364109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gradia S, et al. hMSH2-hMSH6 forms a hydrolysis-independent sliding clamp on mismatched DNA. Mol Cell. 1999;3(2):255–261. doi: 10.1016/s1097-2765(00)80316-0. [DOI] [PubMed] [Google Scholar]
  • 18.Hombauer H, Campbell CS, Smith CE, Desai A, Kolodner RD. Visualization of eukaryotic DNA mismatch repair reveals distinct recognition and repair intermediates. Cell. 2011;147(5):1040–1053. doi: 10.1016/j.cell.2011.10.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Iaccarino I, Marra G, Dufner P, Jiricny J. Mutation in the magnesium binding site of hMSH6 disables the hMutSalpha sliding clamp from translocating along DNA. J Biol Chem. 2000;275(3):2080–2086. doi: 10.1074/jbc.275.3.2080. [DOI] [PubMed] [Google Scholar]
  • 20.Jeong C, et al. MutS switches between two fundamentally distinct clamps during mismatch repair. Nat Struct Mol Biol. 2011;18(3):379–385. doi: 10.1038/nsmb.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Qiu R, et al. Large conformational changes in MutS during DNA scanning, mismatch recognition and repair signalling. EMBO J. 2012;31(11):2528–2540. doi: 10.1038/emboj.2012.95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Elez M, Radman M, Matic I. Stoichiometry of MutS and MutL at unrepaired mismatches in vivo suggests a mechanism of repair. Nucleic Acids Res. 2012;40(9):3929–3938. doi: 10.1093/nar/gkr1298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Srivatsan A, Bowen N, Kolodner RD. Mispair-specific recruitment of the Mlh1-Pms1 complex identifies repair substrates of the Saccharomyces cerevisiae Msh2-Msh3 complex. J Biol Chem. 2014;289(13):9352–9364. doi: 10.1074/jbc.M114.552190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Acharya S, Foster PL, Brooks P, Fishel R. The coordinated functions of the E. coli MutS and MutL proteins in mismatch repair. Mol Cell. 2003;12(1):233–246. doi: 10.1016/s1097-2765(03)00219-3. [DOI] [PubMed] [Google Scholar]
  • 25.Schofield MJ, Nayak S, Scott TH, Du C, Hsieh P. Interaction of Escherichia coli MutS and MutL at a DNA mismatch. J Biol Chem. 2001;276(30):28291–28299. doi: 10.1074/jbc.M103148200. [DOI] [PubMed] [Google Scholar]
  • 26.Floyd DL, Harrison SC, van Oijen AM. Analysis of kinetic intermediates in single-particle dwell-time distributions. Biophys J. 2010;99(2):360–366. doi: 10.1016/j.bpj.2010.04.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yildiz A, et al. Myosin V walks hand-over-hand: Single fluorophore imaging with 1.5-nm localization. Science. 2003;300(5628):2061–2065. doi: 10.1126/science.1084398. [DOI] [PubMed] [Google Scholar]
  • 28.Sharma A, Doucette C, Biro FN, Hingorani MM. Slow conformational changes in MutS and DNA direct ordered transitions between mismatch search, recognition and signaling of DNA repair. J Mol Biol. 2013;425(22):4192–4205. doi: 10.1016/j.jmb.2013.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Antony E, Hingorani MM. Asymmetric ATP binding and hydrolysis activity of the Thermus aquaticus MutS dimer is key to modulation of its interactions with mismatched DNA. Biochemistry. 2004;43(41):13115–13128. doi: 10.1021/bi049010t. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hess MT, Gupta RD, Kolodner RD. Dominant Saccharomyces cerevisiae msh6 mutations cause increased mispair binding and decreased dissociation from mispairs by Msh2-Msh6 in the presence of ATP. J Biol Chem. 2002;277(28):25545–25553. doi: 10.1074/jbc.M202282200. [DOI] [PubMed] [Google Scholar]
  • 31.Hura GL, et al. DNA conformations in mismatch repair probed in solution by X-ray scattering from gold nanocrystals. Proc Natl Acad Sci USA. 2013;110(43):17308–17313. doi: 10.1073/pnas.1308595110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.DeRocco VC, Sass LE, Qiu R, Weninger KR, Erie DA. Dynamics of MutS-mismatched DNA complexes are predictive of their repair phenotypes. Biochemistry. 2014;53(12):2043–2052. doi: 10.1021/bi401429b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wang H, et al. DNA bending and unbending by MutS govern mismatch recognition and specificity. Proc Natl Acad Sci USA. 2003;100(25):14822–14827. doi: 10.1073/pnas.2433654100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pluciennik A, Burdett V, Lukianova O, O’Donnell M, Modrich P. Involvement of the beta clamp in methyl-directed mismatch repair in vitro. J Biol Chem. 2009;284(47):32782–32791. doi: 10.1074/jbc.M109.054528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Dao V, Modrich P. Mismatch-, MutS-, MutL-, and helicase II-dependent unwinding from the single-strand break of an incised heteroduplex. J Biol Chem. 1998;273(15):9202–9207. doi: 10.1074/jbc.273.15.9202. [DOI] [PubMed] [Google Scholar]
  • 36.Pillon MC, Miller JH, Guarné A. The endonuclease domain of MutL interacts with the β sliding clamp. DNA Repair (Amst) 2011;10(1):87–93. doi: 10.1016/j.dnarep.2010.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sass LE, Lanyi C, Weninger K, Erie DA. Single-molecule FRET TACKLE reveals highly dynamic mismatched DNA-MutS complexes. Biochemistry. 2010;49(14):3174–3190. doi: 10.1021/bi901871u. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Jacobs-Palmer E, Hingorani MM. The effects of nucleotides on MutS-DNA binding kinetics clarify the role of MutS ATPase activity in mismatch repair. J Mol Biol. 2007;366(4):1087–1098. doi: 10.1016/j.jmb.2006.11.092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mendillo ML, Mazur DJ, Kolodner RD. Analysis of the interaction between the Saccharomyces cerevisiae MSH2-MSH6 and MLH1-PMS1 complexes with DNA using a reversible DNA end-blocking system. J Biol Chem. 2005;280(23):22245–22257. doi: 10.1074/jbc.M407545200. [DOI] [PubMed] [Google Scholar]
  • 40.Yang Y, Wang H, Erie DA. Quantitative characterization of biomolecular assemblies and interactions using atomic force microscopy. Methods. 2003;29(2):175–187. doi: 10.1016/s1046-2023(02)00308-0. [DOI] [PubMed] [Google Scholar]
  • 41.Groothuizen FS, et al. MutS/MutL crystal structure reveals that MutS sliding clamp loads MutL onto DNA. Elife 2015 doi: 10.7554/eLife.06744. , 10.7554/eLife.06744. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES