Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Sep 14.
Published in final edited form as: Int J Cancer. 2011 Dec 2;130(11):2526–2538. doi: 10.1002/ijc.26256

MiR-34a Chemo-Sensitizes Bladder Cancer Cells To Cisplatin Treatment Regardless Of P53-Rb Pathway Status

RL Vinall 1, A ZRipoll 1, S Wang 2, C-X Pan 2, RW deVere White 1,3
PMCID: PMC4568996  NIHMSID: NIHMS720480  PMID: 21702042

Abstract

MiR-34a is a downstream effector of p53 that has been shown to target several molecules associated with cell cycle and cell survival pathways. As alterations in these pathways are frequent in muscle invasive transitional cell carcinoma of the bladder (MI-TCC), for example mutation or loss of p53 and Rb, the goal of this study was to determine whether manipulation of miR-34a expression levels could abrogate the effect of these alterations and sensitize bladder cancer cells to chemotherapy. We demonstrate that transfection of T24, TCCSUP and 5637 with pre-miR-34a followed by cisplatin treatment results in a dramatic reduction in clonogenic potential and induction of senescence compared to treatment with cisplatin alone. Molecular analyses identified Cdk6 and SIRT-1 as being targeted by miR-34a in MI-TCC cells, however, inhibition of Cdk6 and SIRT-1 was not as effective as pre-miR-34a in mediating chemosensitization. Analysis of 27 pre-neoadjuvant chemotherapy patient samples revealed many of the patients who subsequently did not respond to treatment (based on surgical resection post-chemotherapy and 5 year survival data) express lower levels of miR-34a, however, a statistically significant difference between the responder and non-responder groups was not observed (p=0.1174). Analysis of 8 sets of pre- and post-neoadjuvant chemotherapy patient samples determined miR-34a expression increased post-chemotherapy in only 2 of the 8 patients. The combined data indicate that elevation of miR-34a expression levels prior to chemotherapy would be of benefit to MI-TCC patients, particularly in a setting of low miR-34a expression.

Keywords: MiR-34a, Muscle Invasive Bladder Cancer, Chemosensitivity, Cisplatin, p53, Rb

Introduction

The knowledge that only ~50% of patients with muscle invasive transitional cell carcinoma of the bladder (MI-TCC) will respond to cisplatin-based chemotherapy is a major reason many clinicians have not embraced its use in the neoadjuvant setting even though evidence based medicine clearly shows a survival benefit 1–5. Instead these patients are offered immediate cystectomy, a treatment option which has failed to meaningfully improve survival over the last 25 years 1. The current 5 year survival rate for MI-TCC is ~35%. Further understanding of the mechanisms that promote MI-TCC progression and that prevent response to chemotherapy is a critical first step for improvement in this survival rate as it will allow for both the development of new therapeutics and the identification of the individual who can benefit from neoadjuvant chemotherapy.

Multiple studies have demonstrated that perturbation of the p53-Rb signaling axis is linked to MI-TCC progression following cystectomy 2, 4–6. Components of this axis, for example p53 and p21, also play a major role in determining response to chemotherapy. While the importance of this signaling axis in mediating MI-TCC progression is undisputed, assessment of its activity is not used to guide clinical decisions due to conflicting results from clinical studies 7. Sufficient interest in p53 status as a predictor of MI-TCC recurrence allowed for the design and implementation of a prospective clinical trial in which p53 status was used to determine whether patients were treated with chemotherapy post-cystectomy versus observation (NCT00005047, 8). Maybe predictably, this study was stopped early when the results of a pre-planned interim analysis suggested the probability of seeing a significant difference was highly unlikely due to a lack of efficacy 8. Controversy over how p53 status is determined, assay cost and technical difficulties associated with the assays has also played a role in obscuring whether p53 status has prognostic value in MI-TCC 7. In contrast, miRNAs have been shown to be highly stable in blood, urine and FFPE tissue, as well as relatively easy to quantify 9–13.

MiR-34a is a known downstream effector of p53 (review; 14). In CLL patients miR-34a expression levels can predict disease progression and its expression correlates so well with p53 status that in this disease setting miR-34a can be used as a surrogate marker 15. In other cancers, miR-34a is an independent predictor of disease progression 16. MiR-34a has been shown to target several components of the p53-Rb signaling axis including Cdk6, which controls Rb phosphorylation status, and E2F3, which acts directly downstream of Rb. Clearly miR-34a has the potential to play an important role in abrogating the effects mediated by dysfunction of the p53-Rb signaling axis i.e. uncontrolled progression of the cell cycle. The ability of miR-34a to target multiple points within this important pathway indicates increased miR-34a expression should inhibit cell cycle progression regardless of which part of the p53-Rb signaling axis is dysfunctional. The fact that miR-34a has also been shown to target Bcl-2, a key mediator of survival following chemotherapy, and promote apoptosis in some cancer types adds further rationale as to why miR-34a modulation should be focused on for clinical translation.

The well established importance of the p53-Rb signaling axis in MI-TCC and the ability of miR-34a to target multiple points of this pathway as well as Bcl-2, led us to investigate whether increased miR-34a expression can sensitize bladder cancer cell lines to treatment with cisplatin. We demonstrate that transfection with pre-miR-34a increases chemo-sensitivity to cisplatin through inhibition of Cdk6 and SIRT-1, but not Bcl-2, and that the ability of miR-34a to modulate multiple targets simultaneously is likely a main reason for its efficacy. Analysis of 27 pre-chemotherapy patient samples revealed miR-34a expression is lower in many MI-TCC patients who do not respond versus respond to chemotherapy although the difference in miR-34a expression level between these 2 groups did not reach statistical significance, p=0.1174 (response status was based on surgical resection post-chemotherapy and 5 year survival data). Expression of miR-34a did not increase in 6 of 8 patients following chemotherapy. The combined data indicate manipulation of miR-34a expression has therapeutic potential for MI-TCC patients and that further pre-clinical testing is warranted in a setting of low miR-34a expression. Assessment of miR-34a expression in an increased number of MI-TCC patients will be necessary to determine whether miR-34a is a useful predictor of response to chemotherapy.

Materials and Methods

Cell Lines and Culture

T24, TCCSuP and 5637 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA). All cell lines were maintained in RPMI 1640 medium (Invitrogen/GIBCO, Carlsbad, CA) supplemented with 10% fetal bovine serum (Omega Scientific, Inc., Tarzana, CA), 2 mM L-glutamine, and 100 U/ml penicillin-100 ug/ml streptomycin at 37°C in a humidified environment of 5% CO2 in air. To develop the 5637 cells that are resistant platinum analogs, 5637 cells were cultured in RPMI 1640 with 10% fetal calf serum and 1% penicillin/streptomycin supplemented with oxaliplatin at intermittent but increasing concentrations starting at 1.5 μM. The culture medium containing oxaliplatin was changed every 72 hours. The 5637 cells that could grow at 15 μM were considered resistant 5637 cells (5637-resistant). To confirm that 5637-resistant cells originated from the parental 5637, HLA A, B and C genes of these clones were PCR-amplified and sequenced using the primers of (common forward primer; 5′-GATTCTCCCCAGACGCCGAG-3′, HLA-A reverse primer; 5′-CCTGGGCACTGTCACTGCTT-3′, HLA-B reverse primer; 5′-GGACAGCCAGACCAGCAACA-3′, HLA-C primer; 5′-TCAGAGCCCTGGCACTGTT-3′) 16. Analysis validated that the two subclones have the same HLA sequences.

Reagents

Antibodies; SIRT-1 (1:1000, B-10 SCBT, Santa Cruz, CA), E2F3 (1:1000, PG37 SCBT), Cdk6 (1:500 Ab-2 K6.9, Neomarker, Fremont, CA), Rb (1:1000, C-15, SCBT), pRb (1:1000, S780, Cell Signaling, Danvers, MA), acetylated p53 (1:500, Cell Signaling), p53 (1:1000, Ab-6, Calbiochem, Gibbstown, NJ), Bcl-2 (1:1000, 50E3, Cell Signaling), Bcl-xL (1:1000, Cell Signaling), B-actin (1:10,000, Sigma-Aldrich, St. Louis, MO). Four synthetic, chemically modified short single- or double stranded RNA oligonucleotides (pre-miR-34a, premiRNA negative control, anti-miR-34a and anti-miRNA negative control) were purchased from Applied Biosystems (Foster City, CA). Pre-miR-34a mimics the product of Dicer cleavage and thereby increases miR-34a activity. The anti-miR-34a oligonucleotide was designed to specifically bind to endogenous miR-34a, inhibiting its activity but not down-regulating its abundance. Pre-validated siRNA specific for Cdk6 and a non-silencing siRNA control were purchased from Dharmacon (Lafayette, CO).

Transfection

Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used for both siRNA and miRNA transfections as per manufacturer’s instructions.

Cell proliferation assay

Cells were plated in 96-well plates (T24; 1500 cells/well, TCCSuP; 2000 cells/well, 5637; 2000 cells/well). After being cultured for 24 hours, cells were treated with cisplatin or vehicle control. Tetrazolium-based cell proliferation assay (WST-1; Promega, Madison, WI) was performed 2 days post-treatment according to the manufacturer’s protocol.

Immunoblot Analysis

Analyses were performed as previously described17.

RNA and DNA extraction

RNA was isolated using Qiagen miRNeasy and FFPE miRNeasy kits (Qiagen, Valencia, CA). DNA was extracted using DNeasy and QIAamp DNA FFPE tissue kits (Qiagen, Valencia, CA). DNA and RNA concentration and purity was assessed using a Nanodrop 2000 spectrophotometer.

RT-PCR and qRT-PCR

RT-PCR methodology has previously been described 17. Primers; E2F3-alpha-F 5′- GGCAGCCTCCTCTACACCAC-3′, E2F3-alpha-R 5′- TGACCGCTTTCTCCTAGCTC, E2F3-beta-F 5′- GTTTCGGAAATGCCCTTACA, E2F3-beta-R 5′- CGTAGTGCAGCTCTTCCTTTG (the E2F3 primer sets were a kind gift from Dr. Maria Mudryj (UC Davis)), Bcl-2-F 5′-GTGGAGGAGCTCTTCAGGGA-3′, Bcl-2-R 5′-AGGCACCCAGGGTGATGCAA-3′. MiR-34a and U6 expression was assessed using pre-designed miR-34a and U6 TaqMan primer/probes sets in combination with the TaqMan MicroRNA Reverse Transcription and Universal PCR Master Mix (no AmpErase UNG) kits as per manufacturer’s protocol (Applied Biosystems, Foster City, CA).

Methylation Specific PCR (MSP)

Two micrograms of DNA was treated with sodium bisulfite using the EZ DNA methylation-direct kit (Zymo Research, Irvine, CA) as per manufacturer’s protocol, 2ul of eluate was used for subsequent miR-34a-specific MSP. MSP was performed using components of the EZ DNA methylation-direct kit as per manufacturer’s protocol. The oligonucleotide sequences used for miR-34a MSP were; miR-34a-F 5′-IIGGTTTTGGGTAGGTGTGTTTT-3′, miR-34a-R 5′-AATCCTCATCCCCTTCACCACCA-3′ 18.

Clonogenic Assay

Single cells (T24; 2500 cells, TCCSUP; 3500 cells, 5637; 2500 cells) were seeded into 35-mm culture dishes containing FBS media on day 0 and allowed to attach for 24 h at 37°C. After 24 hours, FBS media was replaced with CSS media and cultured for 10 days. Colonies were fixed in 1.0% crystal violet and 0.5% glacial acetic acid in ethanol, and visible colonies containing approximately 50 or more cells were counted.

Senescence assay

The Senescence Beta-Galactosidase staining kit (Cell Signaling, Danvers, MA) was used to assess cellular senescence as per manufacturer’s protocol. The percentage of senescent cells was assessed by determining the number of blue-staining cells in a minimum of 100 cells counted.

Flow Cytometry

The TACS annexin V-FITC kit (R&D Systems) was used to quantitate apoptosis as per manufacturer’s protocol. The analysis was performed using a Coulter Epics XL flow cytometer (Beckman Coulter), compensation was performed using FlowJo software (FlowJo, Ashland, OR).

Patient samples

Bladder cancer patient samples were obtained with IRB consent. Twenty-seven formalin fixed paraffin embedded (FFPE) bladder cancer patient samples were obtained from MI-TCC patients prior to treatment with neoadjuvant chemotherapy. Fifteen of these patients subsequently responded to treatment and twelve did not (based on surgical resection post-chemotherapy and 5 year survival data). Eight post-neoadjuvant chemotherapy FFPE samples from patients who did not respond to treatment were also analyzed (total of 8 matched pre- and post-neoadjuvant chemotherapy samples). For isolation of RNA, 5 × 15uM unstained sections were cut, 1 × 15uM unstained section was cut for isolation of DNA. The tumor area was outlined by a pathologist (Regina Gandour-Edwards, UC Davis) on an H&E stained section and RNA or DNA was isolated from the matching areas on the unstained sections as described above.

SSCP and sequencing

Detection of p53 mutations in exons 4 through 8 were evaluated by PCR-SSCP as previously described 19. Bi-directional sequencing was used to confirm the presence of a mutation and to identify its location.

Statistical analysis

At least three independent experiments were completed for each analysis described in this article. Data are shown as mean ± SD. Paired analysis was performed by Student’s T test, multiple group comparison was performed by one-way ANOVA followed by the Scheffe procedure for comparison of means using STATA software (College Station, TX). p < 0.05 was considered statistically significant (* signifies p < 0.05).

Results

Basal miR-34a expression levels correlate with the relative chemo-sensitivity of bladder cancer cell lines to cisplatin treatment

Three transitional cell carcinoma (TCC) cell lines, T24, TCCSuP and 5637, and 5637 that have been rendered chemoresistant to platinum analogs by long-term treatment with oxaliplatin (5637-resistant), were used for these studies. Clonogenic assay determined that TCCSUP are significantly more sensitive to cisplatin treatment compared to T24 and 5637 (Figure 1A, IC50 of ~0.2uM for TCCSuP versus IC50 of ~1.5uM and ~1.7uM for T24 and 5637 respectively 10 days post-treatment). A concentration of 0.5uM cisplatin was selected for use in all subsequent experiments. By short term proliferation assay (Figure 1B, WST-1, 3 day post-treatment) there was no obvious difference in chemosensitivity between the 3 cell lines. These data, and the much lower IC50 values observed in the clonogenic versus WST-1 assays, indicate the effects of cisplatin treatment are most potent after several rounds of cell division. Increased miR-34a expression levels correlated with increased chemo-sensitivity; TCCSUP expressed ~5-fold higher levels of miR-34a compared to T24 and 5637 (Figure 1C). The fact that p53 has been demonstrated to directly control miR-34a expression in other cell lines and that TCCSUP, but not T24 and 5637, express wildtype p53, indicates p53 may play a role in modulating basal miR-34a expression in these cell lines (Figure 1E). Methylation specific PCR (MSP) determined that the p53 binding site in the miR-34a 3′ UTR is methylated in T24 and 5637 and unmethylated in TCCSUP (Figure 1D), providing further evidence of a link between p53 and basal miR-34a levels in TCC cells. The 5637-resistant subline (cisplatin IC50 = 22.22uM) expressed ~3-fold lower miR-34a compared to the parental 5637-sensitive subline (Figure 1F). This result further validates a connection between miR-34a expression level and chemosensitivity.

Figure 1. Basal miR-34a expression levels correlate with the relative chemo-sensitivity of bladder cancer cell lines to cisplatin treatment.

Figure 1

Open in a new tab

As expected comparison of clonogenic assay (d10 post-treatment) versus WST-1 assay (d3 post-treatment) determined that the effect of cisplatin treatment is most potent after several rounds of cell division; the IC50 values for cisplatin were 3 to 35-fold lower by clonogenic assay compared to WST-1 assay (A and B). Cisplatin concentrations of 0.5uM and 5uM were used for all subsequent long term and short term assays respectively. TCCSUP, the most chemosensitive of the 3 TCC cell lines, expressed the highest endogenous levels of miR-34a (C), a fact that is likely due to methylation of the miR-34a promoter in T24 and 5637, but not in TCCSUP (D) and to TCCSUP expressing wildtype p53 (E). All 3 TCC sublines harbor mutations in the p53-Rb signaling axis; both T24 and 5637 harbor p53 mutations, TCCSUP and 5637 harbor Rb mutations (E). The 5637-resistant subline expressed ~3-fold lower miR-34a compared to the parental 5637-sensitive subline (F). This result further validates a connection between miR-34a expression level and chemosensitivity in TCC cells. (* P < 0.05)

Transfection of TCC cell lines with pre-miR-34a prior to cisplatin treatment causes a dramatic reduction in clonogenic potential and induction of senescence but has minimal or no effect on apoptosis

Transfection of the T24 and 5637 cell lines with pre-miR-34a prior to cisplatin treatment caused a ~50–60% reduction in clonogenic potential compared to a ~5–15% reduction when T24 and 5637 were treated with cisplatin and a pre-miR vehicle control (Figure 2A). Transfection of TCCSUP, which are much more sensitive to cisplatin treatment, with pre-miR-34a prior to cisplatin treatment caused an 80% reduction in clonogenic potential compared to a ~50% reduction with cisplatin and pre-miR vehicle. These data clearly demonstrate that miR-34a can chemo-sensitize TCC cell lines to cisplatin and the high levels of inhibition achieved indicate modulation of miR-34a expression could be important clinically. Transfection of T24 with pre-miR-34a prior to cisplatin treatment also caused a dramatic increase in cellular senescence, ~75% senescent cells compared to 0% with cisplatin and pre-miR vehicle (Figure 2B and C). Appropriate morphological changes were also apparent (Figure 2C). Assessment of apoptosis using Annexin V/PI flow cytometric analysis (Figure 1D) determined transfection of T24 with pre-miR-34a prior to cisplatin treatment causes a significant, but small, increase in apoptosis when compared to cisplatin and pre-miR vehicle. In TCCSUP and 5637, transfection with pre-miR-34a prior to treatment with cisplatin caused no change in apoptosis levels compared to treatment with cisplatin and pre-miR vehicle (Figure 1D).

Figure 2. Increased miR-34a expression chemosensitizes TCC cells to cisplatin treatment by reducing clonogenic potential and inducing senescence.

Figure 2

Open in a new tab

Transfection of the T24 and 5637 cell lines with pre-miR-34a prior to cisplatin treatment caused a dramatic reduction in clonogenic potential in all 3 TCC cell lines, and a dramatic increase in cellular senescence in T24, the most chemoresistant of the 3 TCC cell lines (B and C). Morphological changes were also apparent (C). Little or no increase in apoptosis was observed in any of the TCC cell lines transfected with pre-miR-34a prior to cisplatin treatment relative to cisplatin treatment alone (D). (* P < 0.05)

MiR-34a targets Cdk6 and SIRT-1 in TCC cell lines

Several studies have documented miR-34a is able to target SIRT-1, Cdk4/6, E2F3 and Bcl-2 in various assorted cell lines. Numerous other targets have also been described. We chose to focus on SIRT-1, Cdk6, E2F3 and Bcl-2 due to the importance of the p53-Rb signaling axis in MI-TCC and the important role played by Bcl-2 in mediating cell survival following chemotherapy (Figure 3A). Our data demonstrate that miR-34a is able to consistently target both SIRT-1 and Cdk6 in all 3 TCC cell lines (Figure 3B). In T24, which are effectively p53 null but express wildtype Rb, increased miR-34a expression results in down-regulation of Cdk6 and, as would be expected, a concomitant decrease in Rb phosphorylation and decrease in E2F3 levels. MiR-34a did not target Bcl-2 in T24, or any of the 3 TCC cell lines (Figure 3B and C), and increased miR-34a appears to be associated with increased Bcl-xL expression (Figure 3B). It is of note that increased expression of Bcl-xL has been linked to increased chemo-resistance and its increased expression may help explain why little or no increase in apoptosis was observed when cells were transfected with pre-miR-34a (Figure 2D). In TCCSUP, which express wildtype p53 but harbor an Rb mutation, miR-34a-mediated downregulation of Cdk6 causes decreased Rb phosphorylation but does not appear to significantly influence E2F3 levels. This suggests miR-34a does not target directly E2F3 in TCCSUP. In 5637, which harbor both p53 and Rb mutations, transfection with pre-miR-34a causes increased phosphorylation of Rb and subsequently increased E2F3 expression regardless of the fact that Cdk6 expression is decreased, again suggesting E2F3 is not targeted. The lack of effect of miR-34a on E2F3 expression in 5637 compared to T24 may explain why a smaller decrease in clonogenic potential was observed in 5637 versus T24 (Figure 2A). It is important to note that regardless of the effect of pre-miR-34a on Rb/E2F3 expression, a significant inhibition of clonogenic potential occurred in all the cell lines. This is likely due to the ability of miR-34a to target SIRT-1 as well as other molecules not assessed here, and this finding underscores the huge benefit of being able to use miRNA to target multiple molecules simultaneously. In 5637, miR-34-mediated downregulation of SIRT-1, a deacetylase, causes increased acetylation of p53. This effect was also observed in TCCSUP. While p53 is mutated in 5637 meaning increased p53 acetylation is unlikely to mediate increased chemosensitivity, increased acetylation of other molecules not assessed here could play a role in mediating the functional effects of decreased SIRT-1 expression. For example, inhibition of SIRT-1 has been demonstrated to lead to increased acetylation and expression of SFRP1, a tumor suppressor gene, in MCF7 and cause decreased cell proliferation 21.

Figure 3. MiR-34a targets Cdk6 and SIRT-1 in TCC cell lines.

Figure 3

Open in a new tab

We chose to focus on targets of miR-34a that are associated with the p53-Rb signaling axis (A) as this pathway is frequently perturbed in MI-TCC and several of these perturbations have been linked to chemoresistance. Pre-miR-34a consistently targeted both SIRT-1 and Cdk6 in all 3 TCC cell lines (B). In T24, miR-34a-mediated targeting of Cdk6 resulted in decreased phosphorylation of Rb. E2F3 expression also decreased, although whether this was due to direct targeting by miR-34a or simply to decreased Rb phosphorylation is unclear. E2F3 mRNA and protein expression did not decrease in TCCSUP or 5637, both of which harbor Rb mutations (B and C). MiR-34a did not target Bcl-2 mRNA or protein expression in any of the 3 TCC cell lines (B and C), and increased miR-34a appeared to be associated with increased Bcl-xL expression.

Inhibition of miR-34a causes chemo-resistance and upregulation of Cdk6 and SIRT-1 expression

Transfection of TCCSUP, the most chemo-sensitive of the 3 TCC cell lines, with anti-miR-34a prior to treatment with cisplatin caused an increase in clonogenic potential (Figure 4A) and increased Cdk6 and SIRT-1 expression (Figure 4B) confirming miR-34a expression and chemosensitivity are linked and that both Cdk6 and SIRT-1 are important downstream effectors of miR-34a in TCC cells. As expected, increased Cdk6 expression resulted in increased phosphorylation of Rb (Figure 4B).

Figure 4. Decreased miR-34a expression causes chemo-resistance, inhibition of individual effectors of miR-34a has only a minor impact on chemosensitization.

Figure 4

Open in a new tab

Transfection of TCCSUP, the most chemo-sensitive of the 3 TCC cell lines, with anti-miR-34a prior to treatment with cisplatin caused an increase in clonogenic potential (A) and increased Cdk6 and SIRT-1 expression (B), furthering validating a connection between miR-34a and chemosensitivity and establishing Cdk6 and SIRT-1 as important downstream effectors of miR-34a in TCC cells. Down-regulation of Cdk6 (C and D) or SIRT-1 (E), both proven targets of miR-34a in TCC cells, using siRNA (Cdk6 siRNA, 50nM) or pharmacological inhibitors (BML-210, (SIRT-1 inhibitor), 10uM) did not confer the same level of chemo-sensitization as transfection with pre-miR-34a. Combined inhibition of Cdk6 and SIRT-1 further sensitized T24 to cisplatin (F, ~40% reduction in clonogenic potential) but was still less effective than transfection with pre-miR-34a (Figure 2A, ~50–60% reduction in clonogenic potential). (* P < 0.05)

Down-regulation of Cdk6 or SIRT-1 expression is not as effective in inducing chemo-sensitivity as transfection with pre-miR-34a

Down-regulation of Cdk6 or SIRT-1, both proven targets of miR-34a in TCC cells, using siRNA (Cdk6 siRNA) or pharmacological inhibitors (BML-210, SIRT-1) did not confer the same level of chemo-sensitization as transfection with pre-miR-34a. Transfection of Cdk6-specific siRNA followed by cisplatin treatment caused a ~20% decrease in clonogenic potential and ~15% induction of senescence compared to the ~10% and 0% changes observed in the control siRNA/cisplatin groups (Figure 4C and D). In comparison, transfection with pre-miR-34a followed by treatment with cisplatin caused a 50% decrease in clonogenic potential (Figure 2A) and an 80% increase in senescence (Figure 2B) relative to the ~20% and 0% changes observed in the control miR/cisplatin groups. Likewise, treatment with BLM-210, a SIRT-1 inhibitor, followed by cisplatin treatment caused only a ~25% decrease in clonogenic potential relative to a ~15% decrease in the control/cisplatin group (Figure 4E and F). The combined data again point to the ability of miR-34a to target multiple molecules within the same signaling pathway and in other pathways as being critical for its efficacy. Combined inhibition of Cdk6 and SIRT-1 prior to treatment with cisplatin resulted in a ~40% reduction in the clonogenic potential of T24 cells. In comparison, transfection with miR-34a prior to cisplatin treatment resulted in a ~50–60% inhibition. While the combined inhibition of Cdk6 and SIRT-1 does cause a small decrease in clonogenic potential relative to inhibition of Cdk6 or SIRT-1 alone, the data demonstrate that forced expression of miR-34a is still more effective in mediating chemosensitization of T24 cells to cisplatin.

Chemotherapy causes increased expression of miR-34a regardless of p53 status in TCC cell lines

Unexpectedly, cisplatin caused increased miR-34a expression in all 3 TCC cell lines including T24 which are effectively p53 null and 5637 which harbor mutant p53 (Figure 5A–E). As baseline expression of miR-34a did correlate with p53 status in untreated cells (Figure 1C), these data suggest that components of p53-independent stress response pathways can also influence miR-34a expression levels in TCC cells.

Figure 5. Chemotherapy causes increased expression of miR-34a regardless of p53 status in TCC cell lines.

Figure 5

Open in a new tab

Unexpectedly, cisplatin caused increased miR-34a expression in all 3 TCC cell lines including T24 which are effectively p53 null and 5637 which harbor mutant p53 (A-E). (* P < 0.05)

Analysis of miR-34a expression in MI-TCC samples from patients who respond versus do not respond to chemotherapy

Analysis of miR-34a expression levels in archival tumor samples that had been obtained with IRB consent from TCC patients prior to treatment (27 patients, 15 of whom subsequently responded to treatment (responders) versus 12 who did not (non-responders), response based on surgical resection post-chemotherapy and 5 year survival data, Figure 6A) determined that many of the non-responders express low levels of miR-34a, however, the difference between responders and non-responders was not statistically significant, p=0.1174 (Figure 6B). Similar rates of p53 mutation were observed in the responder and non-responder groups (60% versus 58%, Figure 6A). This is of note as whether p53 status can predict for chemosensitivity in TCC patient remains controversial based on conflicting reports from clinical studies (24–28). While we show overall p53 status does not correlate with response to chemotherapy in the 27 patients analyzed, the high frequency of p53 exon 6 mutations in the non-responder group suggests that focus on the predictive ability of certain p53 mutations may be warranted. Methylation of the miR-34a promoter was also more frequent in the responder group (Figure 6A), however, miR-34a expression levels did not correlate with p53 status (Figure 6C). These data support our in vitro finding that miR-34a levels do not always correlate with p53 expression levels and mutation status (Figure 5). Analysis of 8 matched pre- and post-neoadjuvant chemotherapy samples from patients who did not respond to chemotherapy revealed that in most cases miR-34a expression levels do not change dramatically following chemotherapy treatment (Figure 6E), miR-34a expression did not increase in 6 of the 8 samples.

Figure 6. Analysis of miR-34a expression in MI-TCC samples from patients who respond versus do not respond to chemotherapy.

Figure 6

Open in a new tab

Analysis of miR-34a expression levels in archival tumor samples that had been obtained from TCC patients prior to treatment (27 patients, 15 of whom subsequently responded to treatment (responders) versus 12 who did not (non-responders), response based on surgical resection post-chemotherapy and 5 year survival data, (A)) determined that many of the non-responders express low levels of miR-34a, however, the difference between responders and non-responder groups was not statistically significant, p=0.1174 (B). Similar rates of p53 mutation were observed in the responder and non-responder groups (60% versus 58%, (A)). Methylation miR-34a promoter was more frequent in the responder group (A), however, miR-34a expression levels did not correlate with p53 status (C). Analysis of 8 matched pre- and post-neoadjuvant chemotherapy samples from patients who did not respond to chemotherapy revealed that in most cases miR-34a expression levels do not change dramatically following chemotherapy treatment, an increase in miR-34a was observed in only 2 of 8 patients (D).

Discussion

The critical finding here is that increased miR-34a expression chemo-sensitizes TCC cells to treatment with cisplatin regardless of which part of the p53-Rb signaling axis is dysfunctional. Our data suggest this is due to the ability of miR-34a to simultaneously target multiple components of this signaling axis. Abrogating the effects of dysregulation of the p53-Rb signaling axis is of particular importance in TCC because amplification, mutation or loss of its components is a frequent occurrence in TCC patients and results in uncontrolled cell proliferation and disease progression.

Multiple studies have demonstrated that simultaneous targeting multiple components of the same signaling pathway has greater efficacy compared to targeting individual components by mediating a more complete inhibition of signaling (review; 20). Our data support this; inhibition of Cdk6 and SIRT-1, both of which are shown to be reproducibly and significantly down-regulated by pre-miR-34a in all 3 TCC lines and are established miR-34a targets, caused significantly less chemo-sensitization compared to pre-miR-34a treatment. Undoubtedly inhibition of Cdk6 and SIRT-1 plays an important role in mediating pre-miR-34a induced chemo-sensitivity. Cdk6, in complex with Cdk4 and cyclin D1, is a key regulator of Rb activity and thereby G1/S transition. Amplification of Cdk6 has not been reported in TCC patients, however, alterations in the molecules that directly modulate Cdk6 expression e.g. p16 and p21, as well as cyclin D1 amplification are frequently observed and have been linked to TCC progression in patient studies 21, 22. SIRT-1 is a deacetylase whose targets including p53, FOXO, SFRP1 and PGC1 21, 25, 26. While SIRT-1 expression levels have not been previously determined in bladder cancer patients, SIRT-1 is overexpressed in breast cancer patients and increased expression is linked to resistance to apoptosis 23. Our data indicate it is the ability of miR-34a to simultaneously target both these components, as well as others, that make it so effective at inducing chemosensitivity. Besides causing a more complete inhibition of signaling, another clear benefit of simultaneous targeting is that miR-34a can cause chemo-sensitization regardless of which part of the p53-Rb signaling axis is dysfunctional. This is important clinically as like our TCC cell lines, dysfunction of the p53-Rb signaling axis in TCC patients is mediated by a multitude of different mutations as well as gene loss and/or amplification (review; 24).

It is of note that Bcl-2, a well established target of miR-34a in CLL 15, was not targeted by miR-34a in TCC cell lines. MiR-34a treatment also caused increased expression of Bcl-xL in TCC cells, a molecule that is well known to be associated with increased chemo-resistance (review; 25). To our knowledge this finding has not been previously reported in other cell types and the mechanism by which miR-34a could increase Bcl-xL expression in TCC cells remains unclear underscoring the need to validate predicted targets in each tumor type. The lack of Bcl-2 targeting, combined with increased Bcl-xL expression, fits with our observation that miR-34a caused little or no increase in TCC cell apoptosis, and provides rationale for combining pre-miR-34a treatment with blockade of the Bcl-2/Bcl-xL pathway. This strategy should result in further chemo-sensitization by targeting both cell proliferation and cell survival pathways. While miR-34a did not cause increased apoptosis of TCC cells, it did induce a dramatic increase in cellular senescence and it is likely this is the mechanism by which miR-34a-mediated chemo-sensitization occurs in TCC cells. A link between senescence and increased chemo-sensitivity in both in vitro and clinical studies has been reported by several groups for other tumor types 26, 27. Our data indicate miR-34a-mediated targeting of Cdk6 is partially responsible for induction of senescence but that other, as yet unidentified, miR-34a targets in TCC cells also play a role.

Whether E2F3, another established target of miR-34a in other cell types 28, 29, is a direct target of miR-34a in TCC cells remains unclear. Decreased E2F3 expression in T24 cells could be an indirect effect caused by miR-34a-mediated inhibition of Cdk6 and subsequent decreased Rb phosphorylation. Transfection with pre-miR-34a caused only a minor decrease in E2F3 levels in TCCSUP which express mutant Rb, and E2F3 protein levels actually increased in 5637. As Rb mutations are frequent in TCC patients 30, targeting of E2F3, in addition to other components of the p53-Rb signaling axis, is obviously desirable. Reporter gene assay will be necessary to fully validate which molecules are direct targets of miR-34a in TCC cells. It is intriguing that many other studies have also found miRNAs have different repertoires of targets depending on both cell type and cell context 31–33. The mechanism by which target specificity is controlled remains unknown.

An unexpected finding was cisplatin treatment increased endogenous miR-34a expression regardless of p53 status in all 3 TCC cell lines. As T24 are effectively p53 null and 5637 express mutant p53 this result suggests factors other than p53 can control miR-34a expression in TCC cells. Our TCC patient data support discordance between p53 activity and induction of miR-34a expression; expression of miR-34a did not correlate with either p53 mutation status or methylation status of the p53 binding site in the miR-34a promoter in TCC patients. ELK1, an ETS family member, is the only other factor that has been documented to control miR-34a expression 34. Further analysis of the miR-34a promoter will be necessary to determine which other, as yet unidentified, transcription factors are important in controlling miR-34a expression in TCC cells.

Analysis of miR-34a expression in TCC patient samples taken prior to chemotherapy revealed many patients express low levels of miR-34a and that lower miR-34a expression may be associated with subsequent non-response to chemotherapy (p=0.1174). We observed that treatment with neoadjuvant chemotherapy did not increase miR-34a expression in the majority of patients for who pre- versus post-chemotherapy samples were available. Combined with our in vitro data which clearly show increased miR-34a expression mediates chemosensitization, this finding indicates forced expression of miR-34a in combination with neoadjuvant chemotherapy may offer clinical benefit. Manipulation of miRNA expression in vivo is still in its infancy (review; 35). LNA anti-miRNAs have been shown to target miR-122 in non-human primates and result in a dose dependent lowering of plasma cholesterol 36. Miravirsen, a LNA anti-miRNA based therapy for treatment of hepatitis C is currently being tested in Phase II clinical trial (NCT01200420). Systemic delivery of miRNA mimics has also been demonstrated in mouse models using viral vectors and liposomes 35. The ability to use transurethral delivery to administer these treatments to TCC patients could help maximize their efficacy and minimize side effects.

Our data indicate promoter methylation may contribute to decreased expression of miR-34a in MI-TCC patients but it is clear that other mechanisms must also play a role. Future studies will determine whether loss of heterozygosity (LOH) occurs in TCC patients and is responsible for decreased miR-34a expression. MiR-34a is located on 1p36.2. Loss of heterozygosity (LOH) of 1p has been reported in transitional cell carcinoma of the bladder (TCC); SNP analysis of 36 primary TCC tumors determined 60% allelic imbalance for 1p 37. Loss of 1p has also been associated with TCC disease progression 38. A specific loss at 1p36.2, the region where the miR-34a gene is located has not been reported in TCC and further genetic analyses will be necessary to determine whether loss of 1p36.2 does occur. Based on current literature, loss of 1p36.2 has not been reported in the majority of cancers in which reduced miR-34a expression levels are correlated with cancer incidence and/or progression, for example CLL and lung cancer. Instead, in these cancers miR-34a levels correlate with miR-34a promoter methylation and p53 mutation status 16, 43–45. Loss of 1p36 does correlate with incidence of neuroblastoma and reduced miR-34a expression 39. It is noteworthy that p53 mutations were not detected in any of the 57 patient samples analyzed in the neuroblastoma study indicating that miR-34a genetic loss and p53 mutation may be mutually exclusive.

Our future studies will focus on testing the ability of pre-miR-34a to increase chemo-sensitivity in additional pre-clinical models of TCC, and analysis of miR-34a expression an increased number of MI-TCC patients to determine whether miR-34a is both a useful predictor of response to chemotherapy and therapeutic target. With the current success rate of chemotherapy at ~50% and the 5 year survival rate for MI-TCC being ~35% clearly such studies are warranted.

Novelty Statement

A link between miR-34a expression and chemosensitivity has not previously been reported in bladder cancer cells, and only one other study (Weeraratne et al., 2011 has reported a link between miR-34a expression and chemosensitivity in any cancer type. In addition, miR-34a expression levels in bladder cancer patients have not previously been documented.

Impact Statement

The current 5 year survival rate for muscle invasive transitional cell carcinoma of the bladder (MI-TCC) patients is ~35% 1. While several clinical trials have demonstrated neo-adjuvant chemotherapy can improve survival, enthusiasm for this treatment option has been dampened by a ~50% response rate 1–5 and only ~11% of MI-TCC patients receive neo-adjuvant chemotherapy 3. In this study, we demonstrate that elevating miR-34a expression levels chemosensitizes MI-TCC cell lines to treatment with cisplatin, and that chemosensitization occurs regardless of p53-Rb pathway dysfunction. This is important because MI-TCC patients frequently harbor defects in one or more components of the p53-Rb signaling axis, and several studies have shown a link between p53-Rb pathway dysfunction and poor patient outcome 2, 4–6. If translated into the clinic, this research finding could improve MI-TCC survival rates by increasing patient response rate to neo-adjuvant chemotherapy and encouraging its increased usage.

Acknowledgments

The authors thank Dr. Regina Gandour-Edwards (Pathology, UC Davis) for assistance in identifying tumor tissue in patient TCC sections that were used for subsequent RNA and DNA extraction, William Holland (Hematology/Oncology, UC Davis) for assistance with SSCP analysis of patient samples, and Dr. Maria Mudryj (Medical Microbiology and Immunology, UC Davis) for kindly providing validated E2F3 primer sets.

Abbreviations

MI-TCC

muscle invasive transitional cell carcinoma of the bladder

qRT-PCR

quantitative real time polymerase chain reaction

FFPE

formalin fixed paraffin embedded

TCC

transitional cell carcinoma

CLL

chronic lymphcytic leukemia

MSP

methylation specific polymerase chain reaction

References

  • 1.Herr HW, Dotan Z, Donat SM, Bajorin DF. Defining optimal therapy for muscle invasive bladder cancer. The Journal of urology. 2007;177:437–43. doi: 10.1016/j.juro.2006.09.027. [DOI] [PubMed] [Google Scholar]
  • 2.Baffa R, Letko J, McClung C, LeNoir J, Vecchione A, Gomella LG. Molecular genetics of bladder cancer: targets for diagnosis and therapy. J Exp Clin Cancer Res. 2006;25:145–60. [PubMed] [Google Scholar]
  • 3.Miles BJ, Fairey AS, Eliasziw M, Estey EP, Venner P, Finch D, Trpkov K, Eigl BJ. Referral and treatment rates of neoadjuvant chemotherapy in muscle-invasive bladder cancer before and after publication of a clinical practice guideline. Can Urol Assoc J. 4:263–7. doi: 10.5489/cuaj09134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Raghavan D. Molecular targeting and pharmacogenomics in the management of advanced bladder cancer. Cancer. 2003;97:2083–9. doi: 10.1002/cncr.11281. [DOI] [PubMed] [Google Scholar]
  • 5.Shariat SF, Bolenz C, Karakiewicz PI, Fradet Y, Ashfaq R, Bastian PJ, Nielsen ME, Capitanio U, Jeldres C, Rigaud J, Muller SC, Lerner SP, et al. p53 expression in patients with advanced urothelial cancer of the urinary bladder. BJU Int. 105:489–95. doi: 10.1111/j.1464-410X.2009.08742.x. [DOI] [PubMed] [Google Scholar]
  • 6.Shariat SF, Lotan Y, Karakiewicz PI, Ashfaq R, Isbarn H, Fradet Y, Bastian PJ, Nielsen ME, Capitanio U, Jeldres C, Montorsi F, Muller SC, et al. p53 predictive value for pT1–2 N0 disease at radical cystectomy. J Urol. 2009;182:907–13. doi: 10.1016/j.juro.2009.05.024. [DOI] [PubMed] [Google Scholar]
  • 7.Malats N, Bustos A, Nascimento CM, Fernandez F, Rivas M, Puente D, Kogevinas M, Real FX. P53 as a prognostic marker for bladder cancer: a meta-analysis and review. Lancet Oncol. 2005;6:678–86. doi: 10.1016/S1470-2045(05)70315-6. [DOI] [PubMed] [Google Scholar]
  • 8.Stadler WMLS, Groshen S, Stein JP, Skinner DG, Raghavan D, Steinberg GD, Wood D, Klotz LH, Hall MC, Cote R. Randomized trial of p53 targeted adjuvant therapy for patients (pts) with organ- confined node-negative urothelial bladder cancer (UBC) J Clin Oncol (ASCO Meeting Abstracts) 2009;27:5017. [Google Scholar]
  • 9.Jay C, Nemunaitis J, Chen P, Fulgham P, Tong AW. miRNA profiling for diagnosis and prognosis of human cancer. DNA and cell biology. 2007;26:293–300. doi: 10.1089/dna.2006.0554. [DOI] [PubMed] [Google Scholar]
  • 10.Nelson PT, Baldwin DA, Scearce LM, Oberholtzer JC, Tobias JW, Mourelatos Z. Microarray-based, high-throughput gene expression profiling of microRNAs. Nature methods. 2004;1:155–61. doi: 10.1038/nmeth717. [DOI] [PubMed] [Google Scholar]
  • 11.Nuovo GJ. situ detection of precursor and mature microRNAs in paraffin embedded, formalin fixed tissues and cell preparations. Vol. 44. Methods; San Diego, Calif: 2008. pp. 39–46. [DOI] [PubMed] [Google Scholar]
  • 12.Li J, Smyth P, Flavin R, Cahill S, Denning K, Aherne S, Guenther SM, O’Leary JJ, Sheils O. Comparison of miRNA expression patterns using total RNA extracted from matched samples of formalin-fixed paraffin-embedded (FFPE) cells and snap frozen cells. BMC biotechnology. 2007;7:36. doi: 10.1186/1472-6750-7-36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, et al. MicroRNA expression profiles classify human cancers. Nature. 2005;435:834–8. doi: 10.1038/nature03702. [DOI] [PubMed] [Google Scholar]
  • 14.Hermeking H. The miR-34 family in cancer and apoptosis. Cell Death Differ. 17:193–9. doi: 10.1038/cdd.2009.56. [DOI] [PubMed] [Google Scholar]
  • 15.Merkel O, Asslaber D, Pinon JD, Egle A, Greil R. Interdependent regulation of p53 and miR-34a in chronic lymphocytic leukemia. Cell Cycle. 9:2764–8. [PubMed] [Google Scholar]
  • 16.Johnson DR, Biedermann BC, Mook-Kanamori B. Rapid cloning of HLA class I cDNAs by locus specific PCR. J Immunol Methods. 2000;233:119–29. doi: 10.1016/s0022-1759(99)00121-0. [DOI] [PubMed] [Google Scholar]
  • 17.Vinall RL, Tepper CG, Shi XB, Xue LA, Gandour-Edwards R, de Vere White RW. The R273H p53 mutation can facilitate the androgen-independent growth of LNCaP by a mechanism that involves H2 relaxin and its cognate receptor LGR7. Oncogene. 2006;25:2082–93. doi: 10.1038/sj.onc.1209246. [DOI] [PubMed] [Google Scholar]
  • 18.Lodygin D, Tarasov V, Epanchintsev A, Berking C, Knyazeva T, Korner H, Knyazev P, Diebold J, Hermeking H. Inactivation of miR-34a by aberrant CpG methylation in multiple types of cancer. Cell Cycle. 2008;7:2591–600. doi: 10.4161/cc.7.16.6533. [DOI] [PubMed] [Google Scholar]
  • 19.Takahashi T, Munakata M, Ohtsuka Y, Nisihara H, Nasuhara Y, Kamachi-Satoh A, Dosaka-Akita H, Homma Y, Kawakami Y. Expression and alteration of ras and p53 proteins in patients with lung carcinoma accompanied by idiopathic pulmonary fibrosis. Cancer. 2002;95:624–33. doi: 10.1002/cncr.10708. [DOI] [PubMed] [Google Scholar]
  • 20.Rodon J, Perez J, Kurzrock R. Combining targeted therapies: practical issues to consider at the bench and bedside. Oncologist. 15:37–50. doi: 10.1634/theoncologist.2009-0117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shariat SF, Tokunaga H, Zhou J, Kim J, Ayala GE, Benedict WF, Lerner SP. p53, p21, pRB, and p16 expression predict clinical outcome in cystectomy with bladder cancer. J Clin Oncol. 2004;22:1014–24. doi: 10.1200/JCO.2004.03.118. [DOI] [PubMed] [Google Scholar]
  • 22.Shariat SF, Ashfaq R, Sagalowsky AI, Lotan Y. Correlation of cyclin D1 and E1 expression with bladder cancer presence, invasion, progression, and metastasis. Hum Pathol. 2006;37:1568–76. doi: 10.1016/j.humpath.2006.05.017. [DOI] [PubMed] [Google Scholar]
  • 23.Kim JE, Lou Z, Chen J. Interactions between DBC1 and SIRT 1 are deregulated in breast cancer cells. Cell Cycle. 2009;8:3784–5. doi: 10.4161/cc.8.22.10055. [DOI] [PubMed] [Google Scholar]
  • 24.Castillo-Martin M, Domingo-Domenech J, Karni-Schmidt O, Matos T, Cordon-Cardo C. Molecular pathways of urothelial development and bladder tumorigenesis. Urol Oncol. 28:401–8. doi: 10.1016/j.urolonc.2009.04.019. [DOI] [PubMed] [Google Scholar]
  • 25.Kang MH, Reynolds CP. Bcl-2 inhibitors: targeting mitochondrial apoptotic pathways in cancer therapy. Clin Cancer Res. 2009;15:1126–32. doi: 10.1158/1078-0432.CCR-08-0144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chan JM, Ho SH, Tai IT. Secreted protein acidic and rich in cysteine-induced cellular senescence in colorectal cancers in response to irinotecan is mediated by P53. Carcinogenesis. 31:812–9. doi: 10.1093/carcin/bgq034. [DOI] [PubMed] [Google Scholar]
  • 27.Prabhudesai SG, Rekhraj S, Roberts G, Darzi AW, Ziprin P. Apoptosis and chemo-resistance in colorectal cancer. J Surg Oncol. 2007;96:77–88. doi: 10.1002/jso.20785. [DOI] [PubMed] [Google Scholar]
  • 28.Welch C, Chen Y, Stallings RL. MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2007;26:5017–22. doi: 10.1038/sj.onc.1210293. [DOI] [PubMed] [Google Scholar]
  • 29.Xie SY, Li YJ, Wang PY, Jiao F, Zhang S, Zhang WJ. miRNA-regulated expression of oncogenes and tumor suppressor genes in the cisplatin-inhibited growth of K562 cells. Oncol Rep. 23:1693–700. doi: 10.3892/or_00000813. [DOI] [PubMed] [Google Scholar]
  • 30.Ziebold U, Lee EY, Bronson RT, Lees JA. E2F3 loss has opposing effects on different pRB-deficient tumors, resulting in suppression of pituitary tumors but metastasis of medullary thyroid carcinomas. Mol Cell Biol. 2003;23:6542–52. doi: 10.1128/MCB.23.18.6542-6552.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rao DS, O’Connell RM, Chaudhuri AA, Garcia-Flores Y, Geiger TL, Baltimore D. MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 33:48–59. doi: 10.1016/j.immuni.2010.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Inui M, Martello G, Piccolo S. MicroRNA control of signal transduction. Nat Rev Mol Cell Biol. 11:252–63. doi: 10.1038/nrm2868. [DOI] [PubMed] [Google Scholar]
  • 33.Frenzel A, Lovén L, Henriksson M. Targeting MYC-Regulated miRNAs to Combat Cancer. Genes & Cancer. 2010;1:660–7. doi: 10.1177/1947601910377488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Christoffersen NR, Shalgi R, Frankel LB, Leucci E, Lees M, Klausen M, Pilpel Y, Nielsen FC, Oren M, Lund AH. p53-independent upregulation of miR-34a during oncogene-induced senescence represses MYC. Cell Death Differ. 17:236–45. doi: 10.1038/cdd.2009.109. [DOI] [PubMed] [Google Scholar]
  • 35.Garzon R, Marcucci G, Croce CM. Targeting microRNAs in cancer: rationale, strategies and challenges. Nat Rev Drug Discov. 9:775–89. doi: 10.1038/nrd3179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Elmen J, Lindow M, Schutz S, Lawrence M, Petri A, Obad S, Lindholm M, Hedtjarn M, Hansen HF, Berger U, Gullans S, Kearney P, et al. LNA-mediated microRNA silencing in non-human primates. Nature. 2008;452:896–9. doi: 10.1038/nature06783. [DOI] [PubMed] [Google Scholar]
  • 37.Hoque MO, Lee CC, Cairns P, Schoenberg M, Sidransky D. Genome-wide genetic characterization of bladder cancer: a comparison of high-density single-nucleotide polymorphism arrays and PCR-based microsatellite analysis. Cancer Res. 2003;63:2216–22. [PubMed] [Google Scholar]
  • 38.Yu DS, Hsieh DS, Chang SY. Detection of chromosomal alterations in bladder cancer by comparative genomic hybridization. BJU Int. 2001;87:889–93. doi: 10.1046/j.1464-410x.2001.02175.x. [DOI] [PubMed] [Google Scholar]
  • 39.Feinberg-Gorenshtein G, Avigad S, Jeison M, Halevy-Berco G, Mardoukh J, Luria D, Ash S, Steinberg R, Weizman A, Yaniv I. Reduced levels of miR-34a in neuroblastoma are not caused by mutations in the TP53 binding site. Genes Chromosomes Cancer. 2009;48:539–43. doi: 10.1002/gcc.20662. [DOI] [PubMed] [Google Scholar]

RESOURCES