Abstract
Premise of the study:
Microsatellite loci were isolated in Hypolepis punctata (Dennstaedtiaceae) to further study the reproductive ecology of this species.
Methods and Results:
We developed 16 microsatellite loci from one sample of H. punctata using an enriched genomic library. These loci were characterized in 28 individuals. The number of alleles per locus ranged from two to 10, and the expected heterozygosity ranged from 0.036 to 0.845.
Conclusions:
The results indicate that the microsatellite markers can facilitate further studies on inferring the phylogeography and population genetics of H. punctata and related species.
Keywords: Dennstaedtiaceae, Hypolepis punctata, microsatellite, phylogeography, population genetics
Hypolepis punctata (Thunb.) Mett. ex Kuhn (Dennstaedtiaceae), i.e., downy ground fern, is a green, densely hairy, and glandulous fern that is widely distributed in tropical and subtropical regions in Asia and the Pacific (Brownsey, 1987). This plant is used in Chinese traditional medicine and contains pterosin, which has a cytotoxic effect on cancer cells (Lai, 2003). However, this species is often confused with H. polypodioides (Blume) Hook. and H. resistens (Kunze) Hook. (Xing and Wang, 2013), and using chloroplast markers (rbcL, matK, trnL-F, and psbA-trnH) is ineffective in improving identification accuracy (Shang et al., unpublished data). Moreover, H. punctata is an ideal species for studying mating system and sexual resource allocation because it exhibits high spore production and cloning habit. In addition, the wide distribution of this species may provide insight into the long-distance dispersal of homosporous ferns. Nuclear microsatellite markers are known as versatile molecular tools for ferns to solve the problem of inferring phylogeography or population genetics (Jiménez et al., 2008). In this study, we report on the development of 16 microsatellite markers for H. punctata to contribute to reproductive ecology and species differentiation research in the genus Hypolepis Bernh.
METHODS AND RESULTS
Total genomic DNA was extracted from the silica gel–dried leaves of an individual H. punctata specimen (voucher no.: JSL-WLSQ522; Appendix 1) collected from Wuling Mountain in Sangzhi County, Hunan Province, China, using a Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China).
A microsatellite-enriched library was built following the method presented by Glenn and Schable (2005) with slight modifications. Genomic DNA was digested with RsaI and XmnI (New England Biolabs, Ipswich, Massachusetts, USA) at 37°C overnight and subsequently ligated to the double-stranded adapter (forward 5′-GTTTAAGGCCTAGCTAGCAGAATC-3′, reverse 5′-pGATTCTGCTAGCTAGGCCTTAAACAAA-3′). The ligated DNA was randomly linked to one of the two single-stranded biotinylated microsatellite probes (5′-(CA) 15-Biotin, 5′-(GA) 15-Biotin). The hybridized DNA was then captured by streptavidin-coated paramagnetic beads (Dynabeads M-280 Streptavidin; Dynal Biotech, Oslo, Norway) and gathered using a magnetic particle-collecting unit (DynaMag-2 Magnet 12321D; Invitrogen, Waltham, Massachusetts, USA). The enriched DNA was amplified using the forward adapter as the primer. The product was then purified, ligated into the pGEM-T Easy Vector System (Promega Corporation, Madison, Wisconsin, USA), and cloned in Chemically Competent TOP10 E. coli cells (Tiangen Biotech). A total of 135 clones were selected and sequenced, in which 107 (∼80%) contained simple sequence repeats. Among these, 83 had suitable lengths for primer design using Premier 5.0 (PREMIER Biosoft International, Palo Alto, California, USA). PCR amplifications were performed in 15-μL total volume with ∼70 ng of genomic DNA, 10 μM of each primer, and 1× PCR mix (Tiangen Biotech). The PCR program consisted of 5 min of initial denaturation at 95°C, followed by 10 cycles of pre-PCR processing that involved 30 s of denaturation at 94°C, 30 s of annealing at 60°C, and 30 s of primer extension reaction at 72°C. The annealing temperature was reduced by 1°C per cycle. PCR amplification was continued for 25 more cycles at a constant annealing temperature of 50°C, and a final extension was performed at 72°C for 10 min. Finally, 16 pairs of primers (Table 1) were selected because they showed the clear bands of a single locus after agarose gel electrophoresis. The forward primer was labeled using one of the fluorescent dyes (FAM, TAMRA, or HEX) to detect polymorphism on an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, California, USA).
Table 1.
Characteristics of 16 microsatellite loci developed in Hypolepis punctata.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | GenBank accession no. |
| SHH02 | F: GTTGTCGTAATCCGCAAAGTGG | (TC)19 | 292–294 | KR270806 |
| R: CAGATATGAGCGTCATTATCTCGGT | ||||
| SHH13 | F: CATGGATTTGTTCTCCCTATCTGC | (GA)39 | 362–378 | KR270807 |
| R: TGGCCTTTGGGGAACCTTAGTA | ||||
| SHH17 | F: CAGCAGCAGAGGAACCTGACA | (CT)15 | 445–447 | KR270808 |
| R: ATTGCGAACCACCCATTGAC | ||||
| SHH19 | F: TTGATGCCTCCATGACTATGCT | (CA)24 | 264–288 | KR270809 |
| R: TCACCTGTCCTCCCTAACTTCT | ||||
| SHH23 | F: CGGAGCGGAAAGGTAGAACA | (AC)6AT(AC)3 | 235–245 | KR270810 |
| R: TTTTGCCACTATTGCTGATGAA | ||||
| SHH33 | F: TCTCCCTCCCTCGATCTCCTT | (CT)17 | 246–258 | KR270811 |
| R: ATGTGGTGCTTCTAGCTGCTGAC | ||||
| SHH34 | F: AACCGTAACAGACGTGCAAACC | (CT)20(CA)9 | 441–453 | KR270812 |
| R: TGTGAGAAGCAGCAAGTCCAAA | ||||
| SHH44 | F: TGGTATCATAGGCCATTTTGTCC | (CT)17(CA)13 | 172–196 | KR270813 |
| R: TAGAGGAGGGAGATGCATTGAGA | ||||
| SHH46 | F: GGAATAAACCATGTAGGCAAGAGC | (GA)13 | 121–123 | KR270814 |
| R: CCAACGAGCCATGTGGACAA | ||||
| SHH51 | F: TAGCAGTAAATAGTTTGTTACGTGCCC | (CA)6AA(CA)3 | 246–249 | KR270815 |
| R: CCATCCGTTGTTGCCCCAT | ||||
| SHH55 | F: GGAATCGCCAAGGAGATAATAA | (AG)12 | 413–422 | KR270816 |
| R: CCCTCTTTTCTCAATCTATGTCCC | ||||
| SHH56 | F: AGAAGATGCTTGTCATAAGTAGGG | (CT)20 | 421–438 | KR270817 |
| R: AATGCTCAAGTCAAAAGTGCC | ||||
| SHH65 | F: TCGATAGTGTTCGCGGGTAA | (CT)23(CA)11 | 271–283 | KR270818 |
| R: GGGCATGGTGGTGACAAAGT | ||||
| SHH71 | F: TTTCGTCTAAATCATGCTCTTTCC | (CT)16 | 293–301 | KR270819 |
| R: GCCTGTCTCGCTACCCGTAT | ||||
| SHH77 | F: GATGAATAAAAGAACTTAAACCAAC | (CA)10 | 439–451 | KR270820 |
| R: AGCAAGAAAGGGAGAACGAG | ||||
| SHH78 | F: ACAGTGATGGAAGGCTGAAAGTC | (CT)10 | 238–242 | KR270821 |
To test marker efficiency, we used 28 individuals of H. punctata from three different populations (five individuals from Wuling Mountain [voucher: JSL-WLSQ522]; 16 from Nanling Mountain [voucher: YYH13169]; and seven from Bawangling Mountain, Hainan Island, China [voucher: SG2984]; Appendix 1). Samples were collected from different individuals, with a minimum interval of 100 m between them, to avoid sampling the same clone. The numbers of alleles per locus, observed heterozygosity, and expected heterozygosity were estimated using CERVUS 3.0 (Kalinowski et al., 2007). In addition, cross-amplifications were performed to test the transferability of the marker to five other Hypolepis species (two individuals of H. polypodioides [vouchers: SG765, SG767], one individual of H. resistens [voucher: SG2900], one individual of H. tenuifolia (G. Forst.) Bernh. [voucher: HN31], two individuals of H. pallida (Blume) Hook. [vouchers: YYH11628, YYH11629], and one individual of H. brooksiae Alderw. [voucher: SIWS19]; Appendix 1).
The number of alleles per locus ranged from two to 10, with an average of 4.75 (Table 2). Meanwhile, 14 of the loci presented a significant bias between the observed and expected heterozygosities, which might indicate selfing in these populations (Table 2). Furthermore, at least six loci were interspecifically amplifiable in each of the other five species. In particular, all 16 loci were amplifiable for H. polypodioides (Table 3).
Table 2.
Genetic properties of the 16 newly developed microsatellites of Hypolepis punctata.
| Total (n = 28) | Hainan (n = 7) | Wuling (n = 5) | Nanling (n = 16) | |||||||||
| Locus | A | Ho | He | A | Ho | He | A | Ho | He | A | Ho | He |
| SHH02 | 2 | 0.036 | 0.036 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.063 | 0.063 |
| SHH13 | 10 | 0.143 | 0.843 | 3 | 0.143 | 0.385 | 3 | 0.200 | 0.644 | 9 | 0.125 | 0.815 |
| SHH17 | 3 | 0.071 | 0.491 | 2 | 0.000 | 0.264 | 2 | 0.200 | 0.556 | 3 | 0.063 | 0.179 |
| SHH19 | 6 | 0.143 | 0.805 | 3 | 0.143 | 0.648 | 3 | 0.200 | 0.733 | 4 | 0.125 | 0.667 |
| SHH23 | 3 | 0.143 | 0.137 | 1 | 0.000 | 0.000 | 2 | 0.400 | 0.356 | 3 | 0.125 | 0.123 |
| SHH33 | 7 | 0.179 | 0.760 | 4 | 0.286 | 0.396 | 2 | 0.000 | 0.533 | 4 | 0.188 | 0.692 |
| SHH34 | 6 | 0.143 | 0.732 | 2 | 0.000 | 0.440 | 3 | 0.400 | 0.644 | 3 | 0.125 | 0.573 |
| SHH44 | 5 | 0.143 | 0.759 | 2 | 0.143 | 0.495 | 2 | 0.200 | 0.556 | 4 | 0.125 | 0.718 |
| SHH46 | 2 | 0.143 | 0.468 | 2 | 0.143 | 0.143 | 2 | 0.200 | 0.556 | 3 | 0.188 | 0.534 |
| SHH51 | 3 | 0.071 | 0.390 | 2 | 0.143 | 0.143 | 1 | 0.000 | 0.000 | 2 | 0.063 | 0.063 |
| SHH55 | 5 | 0.143 | 0.606 | 4 | 0.143 | 0.495 | 2 | 0.200 | 0.200 | 2 | 0.125 | 0.444 |
| SHH56 | 8 | 0.143 | 0.845 | 6 | 0.000 | 0.879 | 4 | 0.400 | 0.711 | 5 | 0.125 | 0.810 |
| SHH65 | 6 | 0.143 | 0.779 | 2 | 0.143 | 0.143 | 2 | 0.200 | 0.200 | 4 | 0.125 | 0.756 |
| SHH71 | 4 | 0.071 | 0.538 | 3 | 0.143 | 0.275 | 2 | 0.200 | 0.200 | 3 | 0.000 | 0.331 |
| SHH77 | 4 | 0.071 | 0.610 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.125 | 0.486 |
| SHH78 | 2 | 0.036 | 0.363 | 2 | 0.143 | 0.143 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
Note: A = number of sampled alleles; He = expected heterozygosity; Ho = observed heterozygosity.
Table 3.
Cross-amplification length (in base pairs) of 16 microsatellite loci from Hypolepis punctata in other Hypolepis species.
| Locus | H. polypodioides (n = 2) | H. resistens (n = 1) | H. tenuifolia (n = 1) | H. pallida (n = 2) | H. brooksiae (n = 1) |
| SHH02 | 292 | 292 | 278–292 | — | 292 |
| SHH13 | 366–368 | 382 | 382 | 372 | — |
| SHH17 | 443 | — | — | 485 | 447–449 |
| SHH19 | 264–272 | 290 | — | — | — |
| SHH23 | 235–243 | 233–235 | 225 | 227–239 | 239 |
| SHH33 | 248 | 276 | — | — | — |
| SHH34 | 449 | 457 | — | — | — |
| SHH44 | 150 | — | 140 | 152 | — |
| SHH46 | 121 | 111–113 | 149 | 115 | 121–123 |
| SHH51 | 246 | 287 | — | — | — |
| SHH55 | 416 | — | — | — | 421–423 |
| SHH56 | 431–433 | — | 425 | 417 | 429–431 |
| SHH65 | 273–281 | — | — | 277 | 281–283 |
| SHH71 | 293 | — | — | — | 293 |
| SHH77 | 443 | 449 | — | — | 445 |
| SHH78 | 238 | — | — | — | 240 |
Note: — = failed amplification; n = number of individuals sampled.
CONCLUSIONS
A total of 16 polymorphic microsatellite loci were newly developed and characterized for H. punctata. These polymorphic microsatellite loci may provide good references for analyzing mating systems and population structures, identifying clones, estimating gene flow, and identifying related species. This research will considerably improve knowledge on the life history of ferns. In addition, the high transferability of these loci to other species from the genus Hypolepis is essential for future research on hybridization or speciation.
Appendix 1.
Voucher and locality information of all Hypolepis samples used in this study.a
| Species | Voucher no. | Locality | Geographic coordinates |
| H. punctata (Thunb.) Mett. ex Kuhn | JSL-WLSQ522 | Wuling Mountain, Hunan, China | 29°18′31″N, 110°6′52″E |
| YYH13169 | Nanling Mountain, Guangdong, China | 24°43′24″N, 114°15′46″E | |
| SG2984 | Bawangling Mountain, Hainan, China | 19°5′49″N, 109°13′32″E | |
| H. polypodioides (Blume) Hook. | SG765, SG767 | Fanjingshan Mountain, Guizhou, China | 27°55′44″N, 108°41′17″E |
| H. resistens (Kunze) Hook. | SG2900 | Bawangling Mountain, Hainan, China | 19°5′28″N, 109°10′59″E |
| H. tenuifolia (G. Forst.) Bernh. | HN31 | Wuzhishan Mountain, Hainan, China | 18°55′1″N, 109°42′13″E |
| H. pallida (Blume) Hook. | YYH11628, YYH11629 | Nantou County, Taiwan, China | NA |
| H. brooksiae Alderw. | SIWS19 | Celebes Island, Indonesia | NA |
Note: NA = not available.
aSpecimens are deposited at the Shanghai Chenshan Botanical Garden Herbarium (CSH), except for voucher SIWS19, which is deposited at the Chinese National Herbarium, Institute of Botany, Chinese Academy of Sciences (PE).
LITERATURE CITED
- Brownsey P. J. 1987. A review of the fern genus Hypolepis (Dennstaedtiaceae) in the Malesian and Pacific regions. Blumea 32: 227–276. [Google Scholar]
- Glenn T. C., Schable N. A. 2005. Isolating microsatellite DNA loci. Methods in Enzymology 395: 202–222. [DOI] [PubMed] [Google Scholar]
- Jiménez A., Quintanilla L. G., Pajarón S., Pangua E. 2008. Reproductive and competitive interactions among gametophytes of the allotetraploid fern Dryopteris corleyi and its two diploid parents. Annals of Botany 102: 353–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kalinowski S. T., Taper M. L., Marshall T. C. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16: 1099–1106. [DOI] [PubMed] [Google Scholar]
- Lai K.2003. Studies on the cytotoxic principles from Hypolepis punctata. Master’s thesis, Taipei Medical University, Taipei, Taiwan.
- Xing F., Wang F. 2013. Hypolepis. In Z. Wu, P. H. Raven, and D. Hong [eds.], Flora of China, Vols. 2–3, 152–154. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
