Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2015 Aug 12;89(20):10668–10679. doi: 10.1128/JVI.01667-15

Replication-Competent Controlled Herpes Simplex Virus

David C Bloom a, Joyce Feller a, Peterjon McAnany a, Nuria Vilaboa b,c, Richard Voellmy d,e,
Editor: R M Longnecker
PMCID: PMC4580158  PMID: 26269179

ABSTRACT

We present the development and characterization of a replication-competent controlled herpes simplex virus 1 (HSV-1). Replication-essential ICP4 and ICP8 genes of HSV-1 wild-type strain 17syn+ were brought under the control of a dually responsive gene switch. The gene switch comprises (i) a transactivator that is activated by a narrow class of antiprogestins, including mifepristone and ulipristal, and whose expression is mediated by a promoter cassette that comprises an HSP70B promoter and a transactivator-responsive promoter and (ii) transactivator-responsive promoters that drive the ICP4 and ICP8 genes. Single-step growth experiments in different cell lines demonstrated that replication of the recombinant virus, HSV-GS3, is strictly dependent on an activating treatment consisting of administration of a supraphysiological heat dose in the presence of an antiprogestin. The replication-competent controlled virus replicates with an efficiency approaching that of the wild-type virus from which it was derived. Essentially no replication occurs in the absence of activating treatment or if HSV-GS3-infected cells are exposed only to heat or antiprogestin. These findings were corroborated by measurements of amounts of viral DNA and transcripts of the regulated ICP4 gene and the glycoprotein C (gC) late gene, which was not regulated. Similar findings were made in experiments with a mouse footpad infection model.

IMPORTANCE The alphaherpesviruses have long been considered vectors for recombinant vaccines and oncolytic therapies. The traditional approach uses vector backbones containing attenuating mutations that restrict replication to ensure safety. The shortcoming of this approach is that the attenuating mutations tend to limit both the immune presentation and oncolytic properties of these vectors. HSV-GS3 represents a novel type of vector that, when activated, replicates with the efficiency of a nonattenuated virus and whose safety is derived from deliberate, stringent regulation of multiple replication-essential genes. By directing activating heat to the region of virus administration, replication is strictly confined to infected cells within this region. The requirement for antiprogestin provides an additional level of safety, ensuring that virus replication cannot be triggered inadvertently. Replication-competent controlled vectors such as HSV-GS3 may have the potential to be superior to conventional attenuated HSV vaccine and oncolytic vectors without sacrificing safety.

INTRODUCTION

Viruses or viral vectors administered to human or animal subjects for purposes of vaccination or therapies such as oncolytic therapies must be reasonably safe. At a minimum this means that they must be essentially incapable of causing the disease or condition they would normally cause. This safety is typically achieved by attenuation, which involves the genetic disablement of functions essentially connected to replication of a virus or viral vector. Attenuation may be obtained by adaptation in cell culture or by more purposeful mutagenesis. In the case of an oncolytic virus, reduced replication capability would be expected to be directly reflected in lower oncolytic activity. For vaccine viruses, attenuation is expected to dampen activation of the innate immune system that is important to promote strong and lasting B and T cell responses (1, 2). For obvious reasons it is not possible to evaluate the difference in immune responses elicited by a wild-type virus and an attenuated version thereof. However, a number of studies compared immune responses to matching pairs of attenuated viruses that maintained some of their replication ability and the corresponding nonreplicating viruses (36). Viruses that retained some of their replication ability were found to induce more potent and more complete immune responses than the nonreplicating viruses. Based on these results, one may reasonably extrapolate that viruses that retain their full replication ability, e.g., wild-type viruses, would be even more potent immunogens. If this hypothesis were correct, immunogenicity of a virus could be optimized, without compromising the safety of an immunized subject, by subjecting the replication ability of the virus to a control mechanism that can be activated to induce unimpaired replication of the virus in a chosen location and for a desired time and that safely represses replication in the absence of activation (see reference 7 for a broader presentation of this novel immunization concept). The present paper reports on our attempts to generate such replication-competent controlled viruses and the characterization of their regulated replication in vitro and in vivo in the mouse model.

It is well known that, upon topical administration, viruses tend to distribute throughout the host organism (see, e.g., reference 8). Hence, restriction of the proliferation of a replication-competent controlled virus to the chosen inoculation region is critical to avoid disease and/or viremia. To achieve this type of control, a gene switch that can be activated in a reversible fashion by a targetable physical stimulus but is essentially inactive in the absence of activation will be needed. A gene switch activated by a small-molecule regulator (SMR) is not indicated because it would not be possible to confine the regulator to the inoculation region. Targetable physical stimuli include different types of radiation, such as visible light, infrared (IR), UV, ultrasound, microwave, and electromagnetic radiation, and heat/cold. Obviously, the gene switch would have to be triggered at levels of locally administered radiation or of heat/cold which are readily tolerated by the host but are well beyond levels to which the host is naturally exposed. Based on available knowledge (9, 10), a promoter of a heat shock gene such as that of the human HSP70B (HSPA7) gene appeared to be the most suitable gene switch of this type (11, 12). The HSP70B promoter is activated in a reversible fashion by heat or other proteotoxic stress. It is essentially silent at host body temperature and is at most weakly activated during pyrexia. Targeted heat can be delivered by focused ultrasound, IR, or microwave irradiation or by contact with a heated body/liquid for a short period of time. The last method of heating may be most practical (technically simple and inexpensive) for gene activation near the body surface (e.g., in an immunization setting). It is noted that activation is mediated by heat doses that are readily supported (e.g., 44 to 45°C/10 min) but are sufficiently elevated to virtually preclude accidental activation.

While the HSP70B promoter will function essentially as an on/off switch of controlled gene activity, it cannot be guaranteed that there may be circumstances, such as possibly pyrexia/hyperpyrexia as mentioned before, ischemic events, ingestion of heavy metals and other toxicants, certain pharmacological interventions, and strenuous exercise (1320), under which the promoter may become at least weakly active. Therefore, it may be prudent to subject replication of a controlled virus to dual regulation. One or more replication-essential genes may be placed under the control of both an HSP70B promoter and an SMR-activated gene switch (Fig. 1A). A somewhat less desirable solution would be to subject a first replication-essential gene to the control of the HSP70B promoter and a second to the control of a constitutively expressed (or auto-activated) SMR-activated gene switch. Gene switches of the type outlined in Fig. 1A were described previously (21). They consist of (i) an SMR-activated transactivator that is expressed from a promoter cassette that is activated both by heat and the transactivator and (ii) a transactivator-responsive promoter for driving a target gene. Upon transient or stable introduction into cells in vitro or in vivo, such a gene switch activates its target gene subsequent to heat treatment of the cells in the presence of the SMR. Once the gene switch is activated, expression of the target gene continues, unless the SMR is removed (or, in vivo, administration is discontinued). It is noted that HSP promoters are inactivated within hours of heat activation, a kinetic feature that limits their usefulness. The dually responsive gene switch of Fig. 1A extends the duration of heat-activated target gene expression, which may be an important feature if a combination of early and late viral genes or a gene whose continuous activity is required is to be regulated. The gene switch is not appreciably activated by either heat treatment or the SMR alone. Versions of the gene switch employing different SMR-activated transactivators are available (2123).

FIG 1.

FIG 1

Dually responsive gene switch and the construction of replication-competent controlled viruses. (A) Scheme illustrating the operation of a gene switch coactivated by heat and an SMR. (B) Outline showing the changes made to the HSV-1 17syn+ genome to generate recombinant HSV-GS1. (C) Scheme to generate HSV-GS3. eHSF1, endogenous heat shock transcription factor; TRP, transactivator-responsive promoter; TA, transactivator; VG, replication-essential viral gene; SMR, small-molecule regulator; TRL and TRS, long and short terminal repeats, respectively; UL and US, long and short unique regions, respectively; IRL and IRS, long and short internal repeats, respectively.

It is presumed that gene switches of the type shown in Fig. 1A can only regulate genes of viruses such as herpesviruses that use the host machinery for transcription of their genes. Transcription from the HSP70B promoter is mediated by host cell transcription factor HSF1 that is normally present in an inactive form but is transiently activated when the cell receives a triggering heat dose (9, 10). A herpes simplex virus (HSV), i.e., an HSV-1 wild-type strain, was chosen as the backbone for constructing replication-competent controlled viruses for several reasons. The virus has a double-stranded DNA genome of >150 kbp that tolerates large insertions, supports stable expression of passenger genes, and can be manipulated readily (2427). High titers are reached in vitro. Furthermore, the virus is replicated by a high-fidelity polymerase, is not integrated in the host genome, infects a broad range of host cells, and causes efficient lysis. Latent infection of sensory nerve cells is not considered a problem and may well be an asset in situations in which induction of effector memory T cells is desired (28). Moreover, the virus is widespread in the human population, with a seroprevalence that increases in an age-dependent manner and reaches >70% in 70-year-olds in the United States. While 90% of seropositive individuals are asymptomatic, the remaining 10% largely experience periodic clinical lesions referred to as “cold sores.” Serious complications such as infectious blindness are rare, and HSV encephalitis occurs only under exceptional circumstances. The virus responds to drugs such as acyclovir. Several studies have examined the effects of preexisting immunity to HSV (2937). Most studies reported little or only minor effects on immune responses to HSV-delivered antigens or on the efficacy of oncolytic HSV (2934, 37). The results of the two studies that reported substantial reductions of immune responses (35, 36) may be particular to the unusual models employed. All studies concluded that vaccine/immunization uses of HSV are possible in the presence of preexisting immunity.

MATERIALS AND METHODS

Chemicals.

Progestins and mifepristone were obtained from Sigma-Aldrich Co. Ulipristal acetate was from D-Innovation Pharmaceutical Co., Chengdu, Sichuan, People's Republic of China. Telapristone was provided by the Eunice Kennedy Shriver National Institute of Child Health and Human Development. Compound PF-02367982 was obtained from Pfizer Global Research and Development, Sandwich, United Kingdom. Stock solutions of medroxyprogesterone 17-acetate, megestrol acetate, norgestimate, and PF-02367982 were prepared in dimethyl sulfoxide (DMSO). All other progestins and antiprogestins were initially dissolved in ethanol (EtOH).

Cells, plasmids, and viruses.

Rabbit skin (RS) cells were a gift from E. Wagner and were propagated in minimal essential medium Eagle (MEME) supplemented with 5% calf serum, 292 mg/ml l-glutamine, 250 U of penicillin/ml, and 250 μg of streptomycin/ml (Life Technologies). HeLa-derived J55 cells (21), Vero cells (procured from the American Type Culture Collection [ATCC]), Vero-derived E5 cells (38) (obtained from N. DeLuca), and the human squamous cell carcinoma line SCC-15 (procured from the ATCC) were grown in Dulbecco's modified Eagle's medium with 10% fetal calf serum and 250 U of penicillin/ml and 250 μg of streptomycin/ml. All cells were cultured at 37°C under 5% CO2.

HSV-1 strain 17syn+ and deletion strain KD6 (39) were obtained from J. Stevens. It is noted that stocks of KD6, HSV-GS1, and HSV-GS3 were prepared using E5 cells. For HSV-GS3, medium was supplemented with 10 nM mifepristone, and infected cultures were subjected to daily heat treatment at 43.5°C for 30 min for three successive days.

Virus construction.

All viruses were constructed using wild-type HSV-1 strain 17syn+ as the backbone. This strain is fully virulent and well characterized, and the complete genomic sequence is available. The generation of the viral recombinants was performed by homologous recombination of engineered plasmids along with purified virion DNA in RS cells transfected by the calcium phosphate precipitation method, as previously described (27). All plasmids used to engineer the insertions of the transactivator cassette or the GAL4-responsive promoters comprised HSV-1 sequences cloned from strain 17syn+. Plasmid IN994 was created as follows: an HSV-1 upstream recombination arm was generated by amplification of HSV-1 (17syn+) DNA (from bp 95,441 to 96,090) with DB112 and DB113 (Table 1 gives primer sequences). The product was digested with SacI and inserted into the SacI restriction site of pBluescript to create pUP. An HSV-1 downstream recombination arm was generated using primers DB115-KpnI and DB120-KpnI to amplify HSV-1 (17syn+) DNA sequence between bp 96,092 and 96,538. The PCR product was digested with KpnI and cloned into KpnI-digested pUP to create pIN994, which recombines with HSV-1 at the UL43/44 intergenic region.

TABLE 1.

Primers and probes

Primer and/or probe function and name or target gene Typea Sequence (5′–3′)
Primers for construction
    DB112 F GAGCTCATCACCGCAGGCGAGTCTCTT
    DB113 R GAGCTCGGTCTTCGGGACTAATGCCTT
    DB115-KpnI F GGGGTACCGGTTTTG TTTTGTGTG AC
    DB120-KpnI R GGGGTACCGGTGTGTGATGATTTCGC
    TA.2803-2823.fwd F TCGACAACTCCGAGTTTCAGC
    BGHpA.rev R CTCCTCGCGGCCGCATCGATCCATAGAGCCCACCGCATCC
    HSV1.131428-131404 F CTCCTCAAGCTTCTCGAGCACACGGAGCGCGGCTGCCGACACG
    HSV1.130859-130880 R CTCCTCGGTACCCCATGGAGGCCAGCAGAGCCAGC
    HSV1.132271-132250 F CTCCTCGCGGCCGCACTAGTTCCGCGTGTCCCTTTCCGATGC
    HSV1.131779-131800 R CTCCTCCTCGAGAAGCTTATGCATGAGCTCGACGTCTCGGCGGTAATGAGATACGAGC
    HSV1.61841-61865 F CTCCTCAGAACCCAGGACCAGGGCCACGTTGG
    HSV1.62053-62027 R CTCCTCATGGAGACAAAGCCCAAGACGGCAACC
    HSV1.62173-62203 F CTCCTCGGAGACCGGGGTTGGGGAATGAATCCCTCC
    HSV1.62395-62366 R CTCCTCGCGGGGCGTGGGAGGGGCTGGGGCGGACC
    HSV1.58409-58444 F CTCCTCTTTATTTTACACACATTCCCCGCCCCGCCCTAGGTT
    HSV1.62186-62150 R CTCCTCAACCCCGGTCTCCAACCCTCCCCTTGACCGTCGCCG
Primers and probes for qPCR
    HSV DNA Pol F AGAGGGACATCCAGGACTTTGT
R CAGGCGCTTGTTGGTGTAC
P ACCGCCGAACTGAGCA
    ICP4 F CACGGGCCGCTTCAC
R GCGATAGCGCGCGTAGA
P CCGACGCGACCTCC
    gC F CCTCCACGCCCAAAAGC
R GGTGGTGTTGTTCTTGGGTTTG
P CCCCACGTCCACCCC
    Mouse APRT F CTCAAGAAATCTAACCCCTGACTCA
R GCGGGACAGGCTGAGA
P CCCCACAC ACACCTC
a

F, forward primer; R, reverse primer; P, probe.

Replication-competent controlled virus HSV-GS1.

A first recombination plasmid, pIN:TA1, was constructed by inserting a transactivator (TA) cassette containing a GLP65 gene under the control of a promoter cassette that combined a human HSP70B promoter and a GAL4-responsive promoter (21) into the multiple cloning site of plasmid pIN994, between flanking sequences of the HSV-1 UL43 and UL44 genes. The TA cassette was isolated from plasmid HSP70/GAL4-GLP65 (21) and was cloned by three-piece ligation to minimize the region that was amplified by PCR. For the left insert, HSP70/GAL4-GLP65 was digested with BamHI and BstX1, and the resulting 2,875-bp band was gel purified. This fragment contains the HSP70/GAL4 promoter cassette as well as the GAL4 DNA-binding domain, the progesterone receptor ligand-binding domain, and part of the P65 activation domain of GLP65. The right insert was generated by amplifying a portion of pHSP70/GAL4-GLP65 with primers TA.2803-2823.fwd and BGHpA.rev. The PCR product was digested (within the primer regions) with BstX1 and NotI, and the resultant 676-bp fragment was gel purified. This fragment contained the 3′ end of the P65 activation domain and the bovine growth hormone (BGH) 3′ nontranslated region. For the vector, pIN994 was digested with BamHI and NotI, and the resulting 4,099-bp fragment was gel purified and shrimp alkaline phosphatase (SAP) treated. The two inserts were then simultaneously ligated into the vector to create pIN:TA1. One microgram of pIN:TA1 was cotransfected with 2 μg of purified HSV-1 (17syn+) virion DNA into RS cells by calcium phosphate precipitation. The resulting pool of viruses was screened for recombinants by the picking of plaques, amplification of these plaques on 96-well plates of RS cells, and dot blot hybridization with a 32P-labeled DNA probe prepared by labeling a TA fragment by random-hexamer priming. A positive well was replaqued and reprobed five times and verified to contain the TA cassette by PCR and sequence analysis. This intermediate recombinant was designated HSV-17GS43. A second recombination plasmid, pBS-KS:GAL4-ICP4, was constructed that contained a GAL4-responsive promoter inserted in place of the native ICP4 promoter by cloning it in between the HSV-1 ICP4 recombination arms of plasmid pBS-KS:ICP4Δpromoter. The GAL4-responsive promoter was excised from plasmid pGene/v5-HisA (Invitrogen Corp.) with AatII and HindIII, and the resulting 473-bp fragment was gel purified. For the vector, pBS-KS:ICP4Δpromoter was digested with AatII and HindIII, and the resulting 3,962-bp fragment was gel purified and SAP treated. Ligation of these two fragments placed the GAL4 promoter in front of the ICP4 transcriptional start site. Subsequent to transformation, a colony was expanded, test digested, and verified by sequencing. One microgram of pBS-KS:GAL4-ICP4 was cotransfected with 4 μg of purified HSV-17GS43 virion DNA into cells of the ICP4-complementing cell line E5 by calcium phosphate precipitation. The resulting pool of viruses was screened for recombinants by the picking of plaques, amplification of these plaques on 96-well plates of E5 cells, and dot blot hybridization with a 32P-labeled DNA probe prepared by labeling the GAL4-responsive promoter fragment by random-hexamer priming. A positive well was replaqued and reprobed seven times and verified to contain the GAL4-responsive promoter in both copies of the short repeat sequences by PCR and sequence analysis. This recombinant was designated HSV-GS1. To obtain pBS-KS:ΔSacI, the SacI site was deleted from the polylinker of plasmid vector pBluescript-KS+ by digesting the plasmid with SacI. The resulting 2,954-bp fragment was gel purified, treated with T4 DNA polymerase to produce blunt ends, recircularized, and self-ligated. Recombination plasmid BS-KS:ICP4Δpromoter was constructed as follows: to generate a first insert, cosmid COS48 (a gift of L. Feldman) was subjected to PCR with the primers HSV1.131428-131404 and HSV1.130859-130880. The primers, respectively, placed HindIII and XhoI sites on the 5′ end of the region and NcoI and KpnI sites on the 3′ end. The 600-bp primary PCR product was digested with HindIII and KpnI, and the resulting 587-bp fragment was gel purified. Vector pBS-KS:ΔSacI was digested with HindIII and KpnI, and the resulting 2,914-bp fragment was gel purified and SAP treated. Ligation placed the first insert into the vector's polylinker, creating pBS-KS:ICP4-3′ end. To generate a second insert, cosmid COS48 was subjected to PCR with the primers HSV1.132271-132250 and HSV1.131779-131800. These primers, respectively, placed NotI and SpeI sites on the 5′ end of the region and AatII, SacI, NsiI, HindIII and XhoI sites on the 3′ end. The 549-bp primary PCR product was digested with NotI and XhoI, and the resulting 530-bp band was gel purified. This fragment also contained the 45-bp OriS hairpin. Plasmid BS-KS:ICP4-3′ end was digested with NotI and XhoI, and the resulting 3,446-bp band was gel purified and SAP treated. Ligation generated pBS-KS:ICP4Δpromoter. The inserts in pBS-KS:ICP4Δpromoter were verified by sequence analysis.

Replication-competent controlled virus HSV-GS3.

HSV-GS1 was used as the backbone for the construction of the recombinant HSV-GS3. To construct the ICP8 recombination plasmid pBS-KS:GAL4-ICP8, a GAL4-responsive promoter was excised from the plasmid pGene/v5-HisA with AatII and HindIII, and the resulting 473-bp fragment was gel purified. For the vector, pBS-KS:ICP8Δpromoter was digested with AatII and HindIII, and the resulting 4,588-bp fragment was gel purified and SAP treated. Ligation of the latter two DNA fragments placed the GAL4-responsive promoter cassette in front of the ICP8 transcriptional start site. Subsequent to transformation, a colony was expanded, test digested, and verified by sequencing. One microgram of pBS-KS:GAL4-ICP8 was cotransfected with 10 μg of purified HSV-GS1 virion DNA into E5 cells by calcium phosphate precipitation. Subsequent to the addition of mifepristone to the medium, the transfected cells were exposed to 43.5°C for 30 min and then incubated at 37°C. Subsequently, on days 2 and 3, the cells were again incubated at 43.5°C for 30 min and then returned to 37°C. Plaques were picked and amplified on 96-well plates of E5 cells in medium supplemented with mifepristone. One hour after infection, the plates were incubated at 43.5°C for 30 min and then further incubated at 37°C. Subsequently, on days 2 and 3, the plates were also shifted to 43.5°C for 30 min and then returned to 37°C. After the wells showed 90 to 100% cytopathic effect, the plates were dot blotted, and the dot blot membrane was hybridized with a 32P-labeled DNA probe prepared by labeling the HSV-1 ICP8 promoter fragment that was deleted. A faintly positive well was replaqued and reprobed eight times and verified to have lost the ICP8 promoter and to contain the GAL4-responsive promoter in its place by PCR and sequence analysis. This recombinant was designated HSV-GS3. The recombination plasmid pBS-KS:ICP8Δpromoter was constructed using essentially the same strategy as that described above for the creation of pBS-KS:ICP4Δpromoter: a first insert was PCR amplified from HSV-1 17syn+ virion DNA using the primers HSV1.61841-61865 and HSV1.62053-62027 and subcloned to yield intermediate vector pBS-KS:ICP8-3′ end. A second insert was similarly obtained using primers HSV1.62173-62203 and HSV1.62395-62366 and was subcloned into pBS-KS:ICP8-3′ end to yield pBS-KS:ICP8Δpromoter.

Construction of expression plasmid pICP8.

A 3,777-bp fragment containing the entire ICP8 coding sequence and the native promoter of the ICP8 gene was PCR amplified from HSV-1 17syn+ virion DNA using primers HSV1.58409-58444 and HSV1.62186-62150 and subcloned into pBS-KS:ΔSacI. The plasmid insert was verified by sequence analysis.

Gene switch activation in J55 cells.

Cells were seeded in 24-well plates at 4 × 104 cells per well. One day later compounds or vehicle was added to the cultures, and the plates were either exposed to heat of 43°C for 2 h (by immersion in a temperature-controlled water bath) or continued at 37°C for the same time. The plates were then incubated at 37°C for an additional 24 h, after which time cultures were harvested. Firefly luciferase activities were determined using a luciferase assay system (Promega), and protein amounts in extracts were determined using a Bio-Rad protein assay kit (Bio-Rad Laboratories). Activity values were calculated as relative light units (RLU) per microgram of protein and are presented herein as relative values.

Single-step growth experiments.

Confluent monolayers of target cells were infected with virus at a multiplicity of infection (MOI) of 3. Virus was allowed to adsorb for 1 h at 37°C; then the inoculum was removed, and the cells were overlaid with complete medium. Mifepristone treatment (10 nM) was initiated at the time of the initial infection. Heat treatment was performed either immediately after infection or 4 h later by floating the sealed dishes in a 43.5°C water bath for 30 min. The dishes were then incubated for 72 h at 37°C. At 0, 4 or 8, 12 or 16, and 24 or 28 h postinfection, two dishes were removed, and the cells were scraped into medium for harvesting and subjected to two freeze-thaw cycles. Infectious virus was then determined by titrating the lysate of each dish in triplicate on 24-well plates of confluent E5 cells. Plaques were visualized after 2 days by staining with crystal violet. For titration of HSV-GS3, E5 cells in 24-well plates were transfected 24 h prior to infection with expression plasmid pICP8 using Lipofectamine 2000 (Life Technologies). Plaques were visualized 2 days after infection using an antibody plaque assay, essentially as previously described (41). Briefly, medium was removed, and the monolayers were fixed with cold 100% methanol for 20 min at 20°C. The monolayers were then washed with phosphate-buffered saline (PBS) and, subsequent to addition of 100 μl of a 1/1,000 dilution of a polyclonal anti-HSV antiserum (rabbit anti-HSV horseradish peroxidase [HRP] conjugate; Dako Labs), were incubated for 1 h at room temperature. The antiserum was aspirated, the monolayers were rinsed twice with PBS, and the plaques were visualized by adding 200 μl of Immunopure diaminobenzidine (DAB) substrate (Pierce Chemicals), which was removed after approximately 10 min by rinsing with PBS.

Viral DNA replication and transcription. (i) In vitro.

Confluent Vero cells in 35-mm dishes of were infected at an MOI of 3 with the HSV-GS3 vector. Each treatment group consisted of three replicate dishes (for each time point). Virus was adsorbed for 1 h at 37°C, the inoculum was removed, and the cells were overlaid with complete medium. Antiprogestin (i.e., mifepristone or ulipristal) treatment was initiated at the time of the initial infection. Heat treatment was performed by floating the sealed dishes in a 43.5°C water bath for 30 min on a submerged platform (initiated 4 h postinfection). Dishes were incubated further at 37°C. At 1, 4, 12, and 24 h after heat treatment, medium was removed, and the DNA and RNA were extracted using TRIzol (Life Technologies). Extracted DNA was subjected to TaqMan real-time quantitative PCR (qPCR) for quantitative analysis of HSV-1 DNA (using HSV DNA polymerase [Pol] primers and probe) (42). Extracted RNA was analyzed by TaqMan real-time reverse transcription-qPCR (RT-qPCR) for the presence of ICP4 and glycoprotein C (gC) transcripts (42). DNA and RNA quantities were normalized relative to the cellular adenine phosphoribosyltransferase (APRT) gene and are presented as relative quantities.

(ii) In vivo.

Swiss Webster outbred female mice (4 to 6 weeks old) were anesthetized and inoculated with 1 × 105 PFU of HSV-GS3 vector following saline pretreatment and light abrasion of both rear footpads essentially as previously described (27). Each treatment group consisted of five mice. The animal studies were approved by the University of Florida Institutional Animal Care and Use Committee (IACUC) and were performed in accordance with the approved protocols. Ulipristal treatment was administered intraperitoneally at the time of infection. Heat treatment was performed at 45°C for 10 min (by immersion of hind feet in a water bath) 3 h after virus administration. Mice were allowed to recover at 37°C for 15 min. Mice were sacrificed 24 h (or 4 days in one type of experiment) after heat induction, and the feet and the dorsal root ganglia (DRG) were dissected and snap-frozen in RNAlater (Sigma-Aldrich). DNA and RNA were extracted by grinding the tissues in TRIzol and back-extracting the DNA from the interface. DNA and RNA were analyzed, and data are presented as described in the preceding paragraph.

RESULTS

Heat- and antiprogestin-activated gene switch.

The dually responsive gene switch that was to be employed for controlling replication of an HSV-1 strain contains the highly heat-inducible HSP70B promoter and a transactivator activated by a small-molecule regulator (SMR) (Fig. 1A). Several different versions of the gene switch were assembled and characterized (2123). It appears that the choice of transactivator is not particularly limited by functional constraints. More important considerations may relate to potential toxicity of an SMR associated with a particular transactivator, dysregulation of host genes that may be caused by a transactivator or its SMR, presence in the environment or use in medicine of an SMR or of related compounds that can substitute for the SMR, and the like. The best-characterized dually responsive gene switch employs transactivator GLP65, a chimeric factor containing a DNA-binding domain from Saccharomyces cerevisiae transcription factor GAL4, a truncated ligand-binding domain from a human progesterone receptor (PR), and transcriptional activation domains from human NF-κB P65 that is activated by the antiprogestin mifepristone but not by several progestins (21, 43, 44). Ligand-independent activation of PR can occur and involves enhanced phosphorylation of PR or a coactivator interacting with PR activation function 1 (AF-1) or AF-2 (see reference 7 and references cited therein). The PR sequence in GLP65 lacks all PR AFs, the unique PR sumoylation site, and all known PR sites whose phosphorylation can enhance PR activity (7, 44). Hence, ligand-independent activation should not occur and, to the best of our knowledge, has not been observed during the many years that this transactivator has been tested in diverse animal models. Therefore, the main concern with the use of GLP65 would be the possibility of inadvertent activation by one of the many progestins that are in extensive use in long-term control medications. (For possibly interfering medical uses of antiprogestins, see the Discussion.) To address this concern, we attempted to compile a complete list of medically used progestins, procured the compounds identified, and tested their ability to coactivate a heat- and antiprogestin-activated (GLP65-based) gene switch. In these experiments, cell line J55 was utilized that stably contained the gene switch and a luciferase target gene (21). Results showed unequivocally that none of the progestins had measurable activity (>0.1% of the activity of mifepristone) (Table 2). Note that the antiprogestin mifepristone was included in the experiment as both a positive control and a reference. To more completely characterize the gene switch, we also tested several available antiprogestins. As is shown in Table 3, the activity of telapristone (CDB-4124) was similar to that of mifepristone, and ulipristal (CDB-2914) was more active. No activity was recorded for the synthetic antiprogestin PF-62367982 (45).

TABLE 2.

Gene switch coactivation by progestins

Condition and compound Relative luciferase activity ± SD at the indicated compound concna
1 nM 100 nM
Without heat
    Mifepristone ND 0.1 ± 0b
    d-Norgestrel ND ND
    Ethynodiol diacetate ND ND
    Etonogestrel ND 0.1 ± 0
    Gestodene ND ND
    Medroxyprogesterone 17- acetate ND ND
    Megestrol acetate 0.1 ± 0.2 ND
    Norethindrone ND ND
    Norethindrone acetate ND 0.1 ± 0.1
    Norgestimate ND ND
With heat (43°C, 2 h)
    Mifepristone 59 ± 16 100 ± 14b
    d-Norgestrel ND 0.1 ± 0.1
    Ethynodiol diacetate 0.1 ± 0 0.1 ± 0
    Etonogestrel 0.1 ± 0 0.1 ± 0
    Gestodene 0.1 ± 0 0.1 ± 0
    Medroxyprogesterone 17- acetate 0.1 ± 0 0.1 ± 0
    Megestrol acetate 0.1 ± 0 0.1 ± 0
    Norethindrone 0.1 ± 0 0.1 ± 0
    Norethindrone acetate 0.1 ± 0 0.1 ± 0.1
    Norgestimate 0.1 ± 0 0.1 ± 0
a

In the controls (no compound) no activity was detected without heat treatment, and an activity of 0.1 ± 0 was detected with heat treatment. Boldface indicates the reference value. ND, none detected.

b

For mifepristone, the concentration was 10 nM.

TABLE 3.

Gene switch coactivation by antiprogestins

Treatment and compound Relative luciferase activity ± SD at the indicated compound concna
1 nM 10 nM 1μM
Without heat
    Mifepristone 0.3 ± 0.1 0.3 ± 0.1 b
    Telapristone ND 0.1 ± 0
    Ulipristal 0.3 ± 0.1 0.4 ± 0
    PF-02367982 ND 0.2 ± 0 0.3 ± 0.1
With heat (43°C, 2 h)
    Mifepristone 74 ± 14 100 ± 20
    Telapristone 92 ± 12 107 ± 14
    Ulipristal 422 ± 36 504 ± 95
    PF-02367982 ND 0.4 ± 0.1 0.4 ± 0
a

Control values (no compound) were 0.2 ± 0 without heat and 0.4 ± 0.1 with heat treatment. Boldface indicates the reference value. ND, none detected.

b

Not determined.

Replication of HSV-GS1 is stringently regulated in cultured cells.

Recombinant virus HSV-GS1 was derived from wild-type HSV-1 strain 17syn+ by insertion of transactivator cassette pHSP70/GAL4-GLP65 (comprising a GLP65 gene functionally linked to a promoter cassette containing a human HSP70B and a GAL4 promoter) and replacement of the viral promoters driving the replication-essential ICP4 genes with GAL4 promoters, subjecting the replication-essential ICP4 genes to gene switch control (Fig. 1B).

In a first experiment, replication of HSV-GS1 in the permissive E5 cells (that express ICP4) was compared with that in the nonpermissive RS cells (Table 4). While HSV-GS1 replicated as efficiently as wild-type strain 17syn+ in the E5 cells, it did not appear to replicate in the RS cells. This result suggested that replication of HSV-GS1 was stringently controlled by the dually responsive gene switch.

TABLE 4.

Titration of viruses in RS and E5 cellsa

Virus Viral load in RS cells (PFU/ml)
Viral load in E5 cells (PFU/ml)
Expt 1 Expt 2 Expt 1 Expt 2
17syn+ 7.2 × 108 9.5 × 108 1.2 × 107 1.2 × 107
HSV-GS1 NDb ND 5.5 × 107 2.5 × 107
a

Confluent monolayers of either RS or E5 cells in 60-mm dishes were infected with HSV-GS1 or 17syn+ at an MOI of 5, incubated for 48 h, harvested by scraping cells into the medium, subjected to two rounds of freeze-thawing, and titrated on E5 cells for infectious virus. Two independent replicates were performed.

b

ND, none detected. The detection limit in this experiment was about 100 PFU/ml.

To corroborate the latter result as well as to find out whether activation of the ICP4 genes was dependent on both heat and SMR, single-step growth experiments were carried out in Vero cells using the procedure described in Materials and Methods. It is noted that these experiments were performed at an MOI of 3 to sensitively detect recombinant virus replication in the absence of activation. Sets of cultures of HSV-GS1-infected cells were either exposed to 10 nM mifepristone (from the time of infection) and heat treated at 43.5°C for 30 min (activating treatment), exposed to mifepristone in the absence of a heat treatment, heat treated in the absence of mifepristone, or left untreated. Cultures were harvested at various time points, extracts were prepared, and infectious virus present in the extracts was titrated on E5 cells. Results showed vigorous replication of the recombinant virus after activating treatment (Fig. 2A). No replication was observed in the absence of a heat treatment and/or mifepristone. Hence, replication of HSV-GS1 was stringently controlled by the dually responsive gene switch. Another experiment compared replication efficiencies of HSV-GS1 and the wild-type parent 17syn+. This experiment demonstrated that, subsequent to activating treatment, HSV-GS1 replicated essentially as efficiently as the wild-type virus (Fig. 2B). It was noted that the activating treatment modestly reduced wild-type virus yield.

FIG 2.

FIG 2

Single-step growth experiments with HSV-GS1 in Vero cells. (A) Controllability of replication. Four basic conditions were tested: (i) heat treatment at 43.5°C for 30 min in the presence of 10 nM mifepristone (activating treatment), (ii) heat treatment alone, (iii) mifepristone exposure alone, and (iv) no treatment (No Tx). Heat treatment was administered immediately after infection (i.e., immediately after removal of the viral inoculum). (B) Comparison of replication efficiencies of wild-type strain 17syn+ and HSV-GS1 with or without activating treatment. Heat treatment was applied 4 h after infection. For other details on single-step growth experiments, see Materials and Methods. Mif, mifepristone. Error bars indicate standard deviations.

Tightly controlled replication of HSV-GS3 in different cell lines.

While the dually responsive gene switch provides HSV-GS1 with a safeguard against inadvertent activation, a single mutation or recombination event may be sufficient to remove the ICP4 genes from regulation. In HSV-GS3, both ICP4 and ICP8 genes are under gene switch control. Subjecting two replication-essential genes to gene switch control ensures that no single mutation or recombination event can result in uncontrolled viral replication. HSV-GS3 was derived from HSV-GS1 by replacing the promoter of the ICP8 gene with a GAL4 promoter (Fig. 1C). Single-step growth experiments were carried out to characterize HSV-GS3.

To determine whether HSV-GS3 was capable of robust replication, a single-step growth experiment was conducted in which replication of HSV-GS3 and that of wild-type virus were compared in the presence or absence of an activating treatment. In this experiment, parallel cultures of E5 cells (or E5 cells transfected with ICP8 expression plasmid in the case of infection with HSV-GS3 in the absence of an activating treatment) were infected with HSV-GS3 or wild-type virus at an MOI of 3. The cultures were untreated or subjected to an activating treatment (heat treatment administered immediately after infection). Cultures were harvested at different times, extracts were prepared, and infectious virus present in the extracts was titrated on E5 cells transfected with an ICP8 expression plasmid. Results revealed that HSV-GS3 replicated nearly as efficiently as wild-type virus (Fig. 3A). The activating treatment had only a minor effect on the replication efficiencies of HSV-GS3 and wild-type virus. Additional single-step growth experiments were carried out. These experiments were aimed primarily at finding out whether HSV-GS3 replication was tightly controlled in diverse cell types. Examples of experiments in monkey Vero cells or human SCC-15 tumor cells are shown in Fig. 3B and C. Robust replication in these and other cell types occurred subsequent to activating treatment. Replication could not be observed in the absence of heat treatment and/or exposure to mifepristone.

FIG 3.

FIG 3

Single-step growth experiments with HSV-GS3. (A) Comparison of the replication efficiencies of wild-type strain 17syn+ and HSV-GS3 with or without activating treatment in E5 cells (17syn+) or E5 cells transfected with an ICP8 expression plasmid (HSV-GS3). (B) Regulation of replication of HSV-GS3 in Vero cells. See the legend of Fig. 2 for a description of the four basic conditions tested. (C) Analogous experiment in SCC-15 cells. In these experiments, heat treatments were administered immediately after infection. Error bars indicate standard deviations.

For historical reasons the earlier experiments utilized mifepristone as a coactivator. Ulipristal is a more selective antiprogestin than mifepristone and for this reason would be a preferred coactivator (46). After ulipristal was found to be capable of coactivating the dually responsive gene switch in J55 cells (Table 3), an experiment was carried out to determine whether ulipristal was as effective as mifepristone as a coactivator of HSV-GS3 replication. Parallel cultures of Vero cells were infected with HSV-GS3. Mifepristone or ulipristal was added at the time of infection, and heat treatments at 43.5°C for 30 min were performed immediately after infection. Cultures were harvested at different times after infection, and DNA and RNA were extracted and analyzed by qPCR and RT-qPCR, respectively. Results presented in Fig. 4 show that ulipristal and mifepristone are equivalent coactivators. As expected based on the results of the single-step growth experiments, HSV-GS3 DNA replication was strictly dependent on activation in host cells by heat treatment in the presence of antiprogestin (Fig. 4A). Consistent with the expected time course of HSV-1 replication, elevated DNA levels were measured in cells harvested 12 or 24 h after infection but not in cells harvested after 1 or 4 h. Corresponding data were obtained for the expression of the ICP4 and gC genes (Fig. 4B and C). Mifepristone and ulipristal similarly coactivated transcription of the viral genes. As expected, transcripts of the regulated ICP4 genes appeared earlier than transcripts of the late gC gene. DNA replication and viral gene transcription did not occur in the absence of heat treatment and, subsequent to heat treatment, were dependent on antiprogestin concentration.

FIG 4.

FIG 4

Regulation of viral DNA replication and transcription in Vero cells infected with HSV-GS3. Multiple infected cultures were subjected to the treatments indicated on the panels. Heat treatment (43.5°C for 30 min) was administered 4 h after infection, and sets of cultures were harvested 1, 4, 12, and 24 h later, and DNA and RNA, as indicated on the left of each panel, were extracted and analyzed by qPCR and RT-qPCR, respectively. For other details, see Materials and Methods. Uli, ulipristal. Values and standard deviations were normalized relative to the highest value in each panel.

Replication of HSV-GS3 in vivo is strictly dependent on an activating treatment.

Groups of adult female mice were inoculated with HSV-GS3 on both rear footpads. Different doses of ulipristal were administered intraperitoneally at the time of infection. Heat treatment was performed at 45°C for 10 min (by immersion of hind feet in a water bath) 3 h after virus administration. Mice were sacrificed 24 h after heat induction. The feet and DRG were dissected, and DNA and RNA were extracted and subjected to qPCR for quantitative analysis for HSV-1 DNA. RNA was analyzed by RT-qPCR for the presence of ICP4 and gC transcripts. HSV-1 is a neurotropic virus and capable of establishing latency in sensory nerve cells. In the interest of a more complete characterization, the analysis was carried out on both feet and DRG. Viral DNA levels in feet and, to a much more limited extent, in DRG increased with ulipristal dose in heat-treated animals (Fig. 5A). Heat treatment alone (Fig. 5A, the condition heat plus 1 μg/kg ulipristal) or administration of ulipristal alone did not result in increased DNA levels. These results were mirrored at the level of ICP4 and gC transcripts, at least in feet (Fig. 5B and C). Transcripts were undetectable in DRG. These findings strongly suggested that replication in vivo of HSV-GS3 was stringently controlled by the heat- and antiprogestin-activated gene switch.

FIG 5.

FIG 5

Regulation of HSV-GS3 DNA replication and transcription and comparison of replicative yields between HSV-GS3 and KD6 in the mouse footpad model. Adult outbred mice were inoculated on the slightly abraded footpads of their hind legs with 1 × 105 PFU of HSV-GS3 or KD6. The indicated doses of ulipristal (Uli) were administered intraperitoneally at the time of infection. Localized heat treatment at 45°C for 10 min was performed 3 h after virus administration. Mice were sacrificed 24 h (panels A to C) or 4 days (panel D) after heat treatment, and DNA and RNA, as indicated on the left of each panel, were isolated from feet and dorsal root ganglia (DRG) and analyzed by qPCR and RT-qPCR, respectively. For other details, see Materials and Methods. Values and standard deviations were normalized relative to the highest value shown in each panel. ND, none detected.

Finally, we wished to compare the in vivo replicative yields between HSV-GS3 and the replication-defective (ICP4-deficient) HSV-1 recombinant KD6. Mice were virus infected on the rear footpads and were either untreated or subjected to activating treatment (45°C for 10 min, 50 μg/kg ulipristal). Four days later, ganglia and feet were dissected and homogenized. Homogenates were divided into two fractions. From one fraction DNA was extracted for qPCR analysis. The other fraction was assayed for infectious virus by plaque assay (on E5 cells transfected with an ICP8 expression plasmid). Elevated levels of viral DNA were detected in feet from HSV-GS3-infected animals that had been subjected to heat treatment in the presence of ulipristal but not from animals that had not received such activating treatment or from animals that had been infected with KD6 (Fig. 5D). Low levels of HSV-1 DNA were found in DRG of KD6- and HSV-GS3-infected animals, suggesting that both viruses were capable of latently infecting the ganglia (albeit at low levels). Infectious virus could be isolated only from feet of HSV-GS3-infected animals that had been subjected to an activating treatment and not from untreated HSV-GS3-infected animals or from KD6-infected animals.

DISCUSSION

The results presented here describe the construction and testing of novel conditionally replication-competent HSV-1 recombinants in which replication can be induced both in vitro and in vivo by a transient heat treatment of infected cells in the presence of an antiprogestin (i.e., mifepristone or ulipristal). We show that in the absence of either or both coactivators, viral transcription and replication are tightly suppressed. This provides the basis for future exploration of such replication-competent controlled viruses as HSV vaccines or tumor vaccines.

The potential advantage of replication-competent controlled viruses is the ability to induce one or more initial rounds of robust viral replication in the target tissue (e.g., the skin) where viral antigens are efficiently presented to the host antigen-presenting cells in the natural context of the infection. This is in contrast to replication-defective or attenuated HSV vectors that, because of their nature, are not expected to be similarly effective immunogens. Even in the case of disabled infectious single-cycle (DISC)-type vaccines (such as gD mutants), replication is limited to the initially infected cell. HSV-GS3 affords additional rounds of replication if heat and antiprogestin are reapplied and also provides the potential for boosting the immunogen. Therefore, this type of replication-competent controlled virus could provide substantial advantages in efficacy as an immunization vector over previously investigated vaccines. From a safety point of view, replication-competent controlled viruses such as HSV-GS3 should exhibit similar safety profiles as existing HSV vaccine vectors, and one may argue that the conditional nature of their controlled replication may make them safer than some attenuated vectors, especially in the immunocompromised.

While we show here that our replication-competent controlled HSV recombinants have the potential to establish a latent infection (Fig. 5D, HSV-GS3), this is not surprising since even nonreplicating HSV vectors are known to do so (47) (Fig. 5D, KD6 virus). The replication-competent controlled HSV should not be able to reactivate in the absence of heat and antiprogestin. Should this be desirable, derivative vectors may be constructed that should be incapable of reactivation even in the presence of the coactivators, e.g., by subjecting the controlled replication-essential gene(s) to additional repression by a latency-specific factor.

It is noted that HSV-GS1 and HSV-GS3 should be regarded as first examples of replication-competent controlled herpesviruses. Variants may be explored in which other replication-essential viral genes than ICP4 and ICP8 are subjected to the control of a dually responsive gene switch. Additional genes may be brought under gene switch control, which may further increase the stringency of regulation of virus replication. Essentially any two or more replication-essential viral genes may be so controlled, provided that the sustained presence of the protein products of the selected genes does not negatively affect replication efficiency and that the activated gene switch is capable of transactivating the genes at nonlimiting rates. There is no reason why components of immune evasion mechanisms, e.g., transporter associated with antigen processing (TAP) inhibitor gene ICP47, could not be disabled or why immune-modulating genes could not be introduced to further boost or direct immune responses. HSV-GS1 and HSV-GS3 were derived from HSV-1 wild-type strain 17syn+. Analogous replication-competent controlled viruses may be constructed based on other HSV-1 strains or other suitable viruses, which may include the alphaherpesviruses HSV-2 and varicella-zoster virus (VZV) and the betaherpesviruses, including cytomegalovirus (CMV) and the roseola viruses (HSV-6 and -7). In the present study, use was made of a dually responsive gene switch comprising an antiprogestin-activated artificial transactivator. This transactivator was chosen because its activity is strictly dependent on its SMR, i.e., an antiprogestin such as ulipristal or mifepristone. The antiprogestins are readily available, are unlikely to have negative effects on the immune system if used at low concentrations, have been safety tested in humans, are not considered essential active ingredients by the WHO, and are utilized only sporadically and in single dose in human subjects. It is noted that tight dual regulation of replication of a controlled herpesvirus will be particularly important at the time of administration and for several weeks thereafter when virus is abundant and systemically present. After this period, sporadic, single uses of antiprogestins would likely pose minimal risks, especially if the treated subject had normal or nearly normal body temperature. Other SMR-dependent transactivators may be utilized in replication-competent controlled viruses such as, for example, the well-characterized Tet-on transactivators. Of particular interest would be transactivators whose SMR is not used at all in human therapy. At this time, this would include dimerizer-based transactivators activated by nonimmunosuppressive analogs of rapamycin (rapalogs) and the ecdysone receptor-based RheoSwitch transactivator activated by synthetic ligand RSL-1 (4851). A heat- and rapalog-activated gene switch has been developed recently (22, 23).

Replication-defective or attenuated viruses have long been used as vehicles for the delivery of heterologous antigens (i.e., antigens of other organisms) (5254). Experience was gathered with a variety of different viruses, including adenoviruses, HSV, poxviruses, measles virus, lentiviruses, and yellow fever virus. Hence, replication-competent controlled HSVs such as HSV-GS3 not only may be considered potential HSV candidate vaccines but may also serve as platforms for expressing heterologous antigens. As has been argued previously for antigens of the controlled virus itself, superior and more balanced immune responses against heterologous antigens may be induced if these antigens are expressed and presented in the context of vigorous viral replication. Depending on the duration of expression desired, a gene for a heterologous antigen may be subjected to the control of the dually responsive gene switch or to an unregulated (or differently regulated) promoter.

The results presented here support the further testing of replication-competent controlled herpesviruses such as HSV-GS3 as a new generation of regulated and robust immunization vectors. Interest in oncolytic HSV vectors has been rekindled by the recent clinical development by Amgen of talimogene laherparepvec (also known as T-VEC), which resulted in an application for a biologics license in the United States. A phase 3 study on melanoma patients revealed a statistically significant better response to intralesional injection of T-VEC than to control treatment (subcutaneous granulocyte-macrophage colony-stimulating factor [GM-CSF]) (55). T-VEC is an attenuated derivative of HSV-1 wild-type strain JS1 and carries a GM-CSF passenger gene (56). We suggest that a replication-competent controlled HSV may have significant advantages over a vector such as T-VEC. Because the safety of a controlled virus relies on spatiotemporal regulation rather than attenuation, such a virus could be derived from the most potent oncolytic wild-type virus without diminishing its oncolytic activity. The controlled virus could be directly administered to lesions and specifically activated within the lesions. Highly localized activation of virus-mediated oncolysis could be achieved by high-intensity focused ultrasound (HIFU) heating in the systemic presence of the appropriate SMR. Magnetic resonance (MR)-guided HIFU devices have been developed for medical uses (ExAblate Systems; InSightec, Ltd.) and are capable of heat-ablating small tissue volumes with high accuracy. A device of this type was also shown to be capable of activating a heat shock protein (HSP) promoter in a narrowly defined tissue region of a small animal (57). We note that the activating heat treatment may provide an additional independent benefit: activating HSF1 in tumor cells (which results in enhanced accumulation of HSPs) prior to their killing has been reported to enhance their immunogenicity (58).

ACKNOWLEDGMENTS

This work was supported by contracts from HSF Pharmaceuticals (to D.C.B. and N.V.), an award from the UF Opportunity Fund (to D.C.B.), and grant PI12/01698 (to N.V.) from Fondo de Investigaciones Sanitarias (Spanish Ministry of Economy and Competitiveness, MINECO, Spain).

We also acknowledge technical assistance by L. Watson (University of Florida) and A. Boré (CIBER-BBN and Hospital Universitario La Paz-IdiPAZ).

R.V. is the founder of HSF Pharmaceuticals SA, a company with an exclusive focus on research and early development activities.

REFERENCES

  • 1.Pulendran B, Ahmed R. 2006. Translating innate immunity into immunological memory: implications for vaccine development. Cell 124:849–863. doi: 10.1016/j.cell.2006.02.019. [DOI] [PubMed] [Google Scholar]
  • 2.Boonnak K, Paskel M, Matsuoka Y, Vogel L, Subbarao K. 2012. Evaluation of replication, immunogenicity and protective efficacy of a live attenuated cold-adapted pandemic H1N1 influenza virus vaccine in non-human primates. Vaccine 30:5603–5610. doi: 10.1016/j.vaccine.2012.06.088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Peng B, Wang LR, Gomez-Roman VR, Davis-Warren A, Montefiori DC, Kalyanaraman VS, Venzon D, Zhao J, Kan E, Rowell TJ, Murthy KK, Srivastava I, Barnett SW, Robert-Guroff M. 2005. Replicating rather than nonreplicating adenovirus-human immunodeficiency virus recombinant vaccines are better at eliciting potent cellular immunity and priming high-titer antibodies. J Virol 79:10200–10209. doi: 10.1128/JVI.79.16.10200-10209.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Halford WP, Weisend C, Grace J, Soboleski M, Carr DJJ, Balliet JW, Imai Y, Margolis TP, Gebhardt BM. 2006. ICP0 antagonizes Stat I-dependent repression of herpes simplex virus: implications for the regulation of viral latency. Virol J 3:44. doi: 10.1186/1743-422X-3-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Huang X, Lu B, Yu W, Fang Q, Liu L, Zhuang K, Shen T, Wang H, Tian P, Zhang L, Chen Z. 2009. A novel replication-competent vaccinia vector MVTT is superior to MVA for inducing high levels of neutralizing antibody via mucosal vaccination. PLoS One 4:e4180. doi: 10.1371/journal.pone.0004180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liu H, Yu X, Tang X, Wang H, Ouyang W, Zhou J, Chen Z. 2010. The route of inoculation determines the tissue tropism of modified vaccinia Tiantan expressing the spike glycoprotein of SARS-CoV in mice. J Med Virol 82:727–734. doi: 10.1002/jmv.21667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Voellmy R, Bloom DC, Vilaboa N. 2015. A novel approach for addressing diseases not yielding to effective vaccination? Immunization by replication-competent controlled virus. Expert Rev Vaccines 14:637–651. doi: 10.1586/14760584.2015.1013941. [DOI] [PubMed] [Google Scholar]
  • 8.Bramson JL, Hitt M, Gauldie J, Graham FL. 1997. Pre-existing immunity to adenovirus does not prevent tumor regression following intratumoral administration of a vector expressing IL-12 but inhibits virus dissemination. Gene Ther 4:1069–1076. doi: 10.1038/sj.gt.3300508. [DOI] [PubMed] [Google Scholar]
  • 9.Vilaboa N, Boellmann F, Voellmy R. 2011. Gene switches for deliberate regulation of transgene expression: recent advances in system development and uses. J Genet Syndr Gene Ther 2:107. [Google Scholar]
  • 10.Vilaboa N, Voellmy R. 2015. Deliberate regulation of therapeutic transgenes: recent advances in system development and uses, p 628–675. In Smyth Templeton N. (ed), Gene and cell therapy: therapeutic mechanisms and strategies, 4th ed CRC Press, Boca Raton, FL. [Google Scholar]
  • 11.Voellmy R, Ahmed A, Schiller P, Bromley P, Rungger D. 1985. Isolation and functional analysis of a human 70,000-dalton heat shock protein gene segment. Proc Natl Acad Sci U S A 82:4949–4953. doi: 10.1073/pnas.82.15.4949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Dreano M, Brochot J, Meyers A, Cheng-Meyer C, Rungger D, Voellmy R, Bromley P. 1986. High-level, heat-regulated synthesis of proteins in eukaryotic cells. Gene 49:1–8. doi: 10.1016/0378-1119(86)90380-X. [DOI] [PubMed] [Google Scholar]
  • 13.Mehta HB, Popovich BK, Dillmann WH. 1988. Ischemia induces changes in the level of mRNAs coding for stress protein 71 and creatine kinase M. Circ Res 63:512–517. doi: 10.1161/01.RES.63.3.512. [DOI] [PubMed] [Google Scholar]
  • 14.Benjamin IJ, Kröger B, Williams RS. 1990. Activation of the heat shock transcription factor by hypoxia in mammalian cells. Proc Natl Acad Sci U S A 87:6263–6267. doi: 10.1073/pnas.87.16.6263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Locke M, Noble EG, Tanguay RM, Field MR, Ianuzzo SE, Ianuzzo CD. 1995. Activation of heat-shock factor in rat heart after heat shock and exercise. Am J Physiol 268:C1387–C1394. [DOI] [PubMed] [Google Scholar]
  • 16.Salminen WF Jr, Voellmy R, Roberts SM. 1997. Differential heat shock protein induction by acetaminophen and a nonhepatotoxic regioisomer, 3′-hydroxyacetanilide, in mouse liver. J Pharmacol Exp Ther 282:1533–1540. [PubMed] [Google Scholar]
  • 17.Moseley PL. 1998. Heat shock proteins and the inflammatory response. Ann N Y Acad Sci 856:206–213. doi: 10.1111/j.1749-6632.1998.tb08327.x. [DOI] [PubMed] [Google Scholar]
  • 18.Bajramovic JJ, Bsibsi M, Geutskens SB, Hassankhan R, Verhulst KC, Stege GJ, de Groot CJ, van Noort JM. 2000. Differential expression of stress proteins in human adult astrocytes in response to cytokines. J Neuroimmunol 106:14–22. doi: 10.1016/S0165-5728(99)00260-X. [DOI] [PubMed] [Google Scholar]
  • 19.Shastry S, Toft DO, Joyner MJ. 2002. Hsp70 and Hsp90 expression in leucocytes after exercise in moderately trained humans. Acta Physiol Scand 175:139–146. doi: 10.1046/j.1365-201X.2002.00979.x. [DOI] [PubMed] [Google Scholar]
  • 20.Zou J, Salminen WF, Roberts SM, Voellmy R. 1998. Correlation between glutathione oxidation and trimerization of heat shock factor 1, an early step in the stress induction of the Hsp response. Cell Stress Chaperones 3:130–141. doi: 10.1379/1466-1268(1998)003<0130:CBGOAT>2.3.CO;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vilaboa N, Fenna M, Munson J, Roberts SM, Voellmy R. 2005. Novel gene switches for targeted and timed expression of proteins of interest. Mol Ther 12:290–298. doi: 10.1016/j.ymthe.2005.03.029. [DOI] [PubMed] [Google Scholar]
  • 22.Martin-Saavedra FM, Bore A, Voellmy R, Vilaboa N. 2009. Heat-activated, rapamycin-dependent gene switches for tight control of transgene expression. Hum Gene Ther 20:1060–1061. [Google Scholar]
  • 23.Martín-Saavedra FM, Wilson CG, Voellmy R, Vilaboa N, Franceschi RT. 2013. Spatiotemporal control of vascular endothelial growth factor expression using a heat shock and rapamycin-dependent gene switch. Hum Gene Ther Methods 24:160–170. doi: 10.1089/hgtb.2013.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Roizman B. 1996. The family Herpesviridae: a brief introduction, p 2297–2342. In Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE (ed), Fields virology, 3rd ed Lippincott Williams & Wilkins, Philadelphia, PA. [Google Scholar]
  • 25.Roizman B. Herpes simplex viruses and their replication, p 2399–2460. In Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE (ed), Fields virology, 3rd ed Lippincott Williams & Wilkins, Philadelphia, PA. [Google Scholar]
  • 26.Lou E. 2003. Oncolytic herpes viruses as a potential mechanism for cancer therapy. Acta Oncol 42:660–671. doi: 10.1080/0284186031000518. [DOI] [PubMed] [Google Scholar]
  • 27.Bloom DC. 1998. HSV vectors for gene therapy, p 369–386. In Brown S, MacLean A (ed), Herpes simplex virus protocols. Humana Press, Totowa, NJ. [Google Scholar]
  • 28.Hansen SG, Ford JC, Lewis MS, Ventura AB, Hughes CM, Coyne-Johnson L, Whizin N, Oswald K, Shoemaker R, Swanson T, Legasse AW, Chiuchiolo MJ, Parks CL, Axthelm MK, Nelson JA, Jarvis MA, Piatak M Jr, Lifson JD, Picker LJ. 2011. Profound early control of highly pathogenic SIV by an effector memory T-cell vaccine. Nature 473:523–527. doi: 10.1038/nature10003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Steffensen MA, Jensen BA, Holst PJ, Bassi MR, Christensen JP, Thomson AR. 2012. Pre-existing vector immunity does not prevent replication-deficient adenovirus from inducing efficient CD8 T-cell memory and recall responses. PLoS One 7:e34884. doi: 10.1371/journal.pone.0034884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Brockman MA, Knipe DM. 2002. Herpes simplex virus vectors elicit durable immune responses in the presence of preexisting host immunity. J Virol 76:3678–3687. doi: 10.1128/JVI.76.8.3678-3687.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chahlavi A, Rabkin S, Todo T, Sundaresan P, Martuza R. 1999. Effect of prior exposure to herpes simplex virus 1 on viral vector-mediated tumor therapy in immunocompetent mice. Gene Ther 6:1751–1758. doi: 10.1038/sj.gt.3301003. [DOI] [PubMed] [Google Scholar]
  • 32.Delman KA, Bennett JJ, Zager JS, Burt BM, McAuliffe PF, Petrowsky H, Kooby DA, Hawkins WG, Horsburgh BC, Johnson P, Fong Y. 2000. Effects of preexisting immunity on the response to herpes simplex-based oncolytic therapy. Hum Gene Ther 11:2465–2472. doi: 10.1089/10430340050207957. [DOI] [PubMed] [Google Scholar]
  • 33.Hocknell PK, Wiley RD, Wang X, Evans TG, Bowers WJ, Hanke T, Federoff HJ, Dewhurst S. 2002. Expression of human immunodeficiency virus type 1 gp120 from herpes simplex virus type 1-derived amplicons results in potent, specific, and durable cellular and humoral immune responses. J Virol 76:5565–5580. doi: 10.1128/JVI.76.11.5565-5580.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lambright ES, Kang EH, Force S, Lanuti M, Caparrelli D, Kaiser LR, Albelda SM, Molnar-Kimber KL. 2000. Effect of preexisting anti-herpes immunity on the efficacy of herpes simplex viral therapy in a murine intraperitoneal tumor model. Mol Ther 2:387–393. doi: 10.1006/mthe.2000.0133. [DOI] [PubMed] [Google Scholar]
  • 35.Herrlinger U, Kramm CM, Aboody-Guterman KS, Silver JS, Ikeda K, Johnston KM, Pechan PA, Barth RF, Finkelstein D, Chiocca EA, Louis DN, Breakefield XO. 1998. Pre-existing herpes simplex virus 1 (HSV-1) immunity decreases, but does not abolish, gene transfer to experimental brain tumors by a HSV-1 vector. Gene Ther 5:809–819. doi: 10.1038/sj.gt.3300643. [DOI] [PubMed] [Google Scholar]
  • 36.Lauterbach H, Ried C, Epstein AL, Marconi P, Bricker T. 2005. Reduced immune responses after vaccination with a recombinant herpes simplex virus type 1 vector in the presence of antiviral immunity. J Gen Virol 86:2401–2410. doi: 10.1099/vir.0.81104-0. [DOI] [PubMed] [Google Scholar]
  • 37.Watanabe D, Brockman MA, Ndung'u T, Mathews L, Lucas WT, Murphy CG, Felber BK, Pavlakis GN, Deluca NA, Knipe DM. 2007. Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector. Virology 357:186–198. doi: 10.1016/j.virol.2006.08.015. [DOI] [PubMed] [Google Scholar]
  • 38.DeLuca NA, Schaffer PA. 1987. Activities of herpes simplex virus type 1 (HSV-1) ICP4 genes specifying nonsense peptides. Nucleic Acids Res 15:4491–4511. doi: 10.1093/nar/15.11.4491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Dobson AT, Margolis TP, Sedarati F, Stevens JG, Feldman LT. 1990. A latent, nonpathogenic HSV-1-derived vector stably expresses β-galactosidase in mouse neurons. Neuron 5:353–360. doi: 10.1016/0896-6273(90)90171-B. [DOI] [PubMed] [Google Scholar]
  • 40.Reference deleted.
  • 41.Bewig B, Schmidt WE. 2000. Accelerated tittering of adenoviruses. Biotechniques 28:870–873. [DOI] [PubMed] [Google Scholar]
  • 42.Kubat NJ, Amelio AL, Giordani NV, Bloom DC. 2004. The herpes simplex virus type 1 latency-associated transcript (LAT) enhancer/rcr is hyperacetylated during latency independently of LAT transcription. J Virol 78:12508–12518. doi: 10.1128/JVI.78.22.12508-12518.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Burcin MM, Schiedner G, Kochanek S, Tsai SY, O'Malley BW. 1999. Adenovirus-mediated regulable target gene expression in vivo. Proc Natl Acad Sci U S A 96:355–360. doi: 10.1073/pnas.96.2.355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Ye X, Schillinger K, Burcin MM, Tsai SY, O'Malley BW. 2002. Ligand-inducible transgene regulation for gene therapy. Methods Enzymol 346:551–561. doi: 10.1016/S0076-6879(02)46076-4. [DOI] [PubMed] [Google Scholar]
  • 45.de Giorgio-Miller A, Bungay P, Tutt M, Owen J, Goodwin D, Pullen N. 2008. The translational pharmacology of a novel, potent, and selective nonsteroidal progesterone receptor antagonist, 2-[4-(4-cyano-phenoxy)-3,5-dicyclopropyl-1H-pyrazol-1-yl]-N-methylacetamide (PF-02367982). J Pharmacol Exp Ther 327:78–87. doi: 10.1124/jpet.108.140467. [DOI] [PubMed] [Google Scholar]
  • 46.Attardi BJ, Burgenson J, Hild SA, Reel JR. 2004. In vitro antiprogestational/antiglucocorticoid activity and progestin and glucocorticoid receptor binding of the putative metabolites and synthetic derivatives of CDB-2914, CDB-4124, and mifepristone. J Steroid Biochem Mol Biol 88:277–288. doi: 10.1016/j.jsbmb.2003.12.004. [DOI] [PubMed] [Google Scholar]
  • 47.Sedarati F, Margolis TP, Stevens JG. 1993. Latent infection can be established with drastically restricted transcription and replication of the HSV-1 genome. Virology 192:687–691. doi: 10.1006/viro.1993.1089. [DOI] [PubMed] [Google Scholar]
  • 48.Rivera VM, Clackson T, Nateson S, Pollock R, Amara JF, Keenan T, Magari SR, Phillips T, Courage NL, Cerasoli F Jr, Holt DA, Gilman M. 1996. A humanized system for pharmacologic control of gene expression. Nat Med 2:1028–1032. doi: 10.1038/nm0996-1028. [DOI] [PubMed] [Google Scholar]
  • 49.Pollock R, Issner R, Zoller K, Natesan S, Rivera VM, Clackson T. 2000. Delivery of a stringent dimerizer-regulated gene expression system in a single retroviral vector. Proc Natl Acad Sci U S A 97:13221–13226. doi: 10.1073/pnas.230446297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Palli SR, Kapitskaya MZ, Kumar MB, Cress DE. 2003. Improved ecdysone receptor-based inducible gene regulation system. Eur J Biochem 270:1308–1315. doi: 10.1046/j.1432-1033.2003.03501.x. [DOI] [PubMed] [Google Scholar]
  • 51.Kumar MB, Potter DW, Hormann RE, Edwards A, Tice CM, Smith HC, Dipietro MA, Polley M, Lawless M, Wolohan PRN, Kethidi DR, Palli SR. 2004. Highly flexible ligand binding pocket of ecdysone receptor. A single amino acid change leads to discrimination between two groups of nonsteroidal ecdysone agonists. J Biol Chem 279:27211–27218. [DOI] [PubMed] [Google Scholar]
  • 52.Draper SJ, Heeney JL. 2010. Viruses as vaccine vectors for infectious diseases and cancer. Nat Rev Microbiol 8:62–73. doi: 10.1038/nrmicro2240. [DOI] [PubMed] [Google Scholar]
  • 53.Smith GL, Mackett M, Moss B. 1983. Infectious vaccinia virus recombinants that express hepatitis B virus surface antigen. Nature 302:490–495. doi: 10.1038/302490a0. [DOI] [PubMed] [Google Scholar]
  • 54.Moss B, Smith GL, Gerin JL, Purcell RH. 1984. Live recombinant vaccinia virus protects chimpanzees against hepatitis B. Nature 311:67–69. doi: 10.1038/311067a0. [DOI] [PubMed] [Google Scholar]
  • 55.Food and Drug Administration. 2015. Cellular, Tissue and Gene Therapies Advisory Committee and Oncologic Drugs Advisory Committee briefing document: BLA 125518, talimogene laherparepvec (Amgen). Food and Drug Administration, Silver Spring, MD: http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/BloodVaccinesandOtherBiologics/CellularTissueandGeneTherapiesAdvisoryCommittee/UCM444660.pdf. [Google Scholar]
  • 56.Liu BL, Robinson M, Han Z-Q, Branston RH, English C, Reay P, McGrath Y, Thomas SK, Thornton M, Bullock P, Love CA, Coffin RS. 2003. ICP34.5 deleted herpes simplex virus with enhanced oncolytic, immune stimulating, and anti-tumour properties. Gene Ther 10:292–303. doi: 10.1038/sj.gt.3301885. [DOI] [PubMed] [Google Scholar]
  • 57.Deckers R, Quesson B, Arsaut J, Eimer S, Couillaud F, Moonen CTW. 2009. Image-guided, noninvasive, spatiotemporal control of gene expression. Proc Natl Acad Sci U S A 106:1175–1180. doi: 10.1073/pnas.0806936106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Gough MJ, Melcher AA, Crittenden MR, Sanchez-Perez L, Voellmy R, Vile RG. 2004. Induction of cell stress through gene transfer of an engineered heat shock transcription factor enhances tumor immunogenicity. Gene Ther 11:1099–1104. doi: 10.1038/sj.gt.3302274. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES