Skip to main content
Canadian Journal of Veterinary Research logoLink to Canadian Journal of Veterinary Research
. 2015 Oct;79(4):329–338.

Relationship of oxidative stress in skeletal muscle with obesity and obesity-associated hyperinsulinemia in horses

Heidi E Banse 1,✉, Nicholas Frank 1, Grace PS Kwong 1, Dianne McFarlane 1
PMCID: PMC4581679  PMID: 26424915

Abstract

In horses, hyperinsulinemia and insulin resistance (insulin dysregulation) are associated with the development of laminitis. Although obesity is associated with insulin dysregulation, the mechanism of obesity-associated insulin dysregulation remains to be established. We hypothesized that oxidative stress in skeletal muscle is associated with obesity-associated hyperinsulinemia in horses. Thirty-five light breed horses with body condition scores (BCS) of 3/9 to 9/9 were studied, including 7 obese, normoinsulinemic (BCS ≥ 7, resting serum insulin < 30 μIU/mL) and 6 obese, hyperinsulinemic (resting serum insulin ≥ 30 μIU/mL) horses. Markers of oxidative stress (oxidative damage, mitochondrial function, and antioxidant capacity) were evaluated in skeletal muscle biopsies. A Spearman’s rank correlation coefficient was used to determine relationships between markers of oxidative stress and BCS. Furthermore, to assess the role of oxidative stress in obesity-related hyperinsulinemia, markers of antioxidant capacity and oxidative damage were compared among lean, normoinsulinemic (L-NI); obese, normoinsulinemic (O-NI); and obese, hyperinsulinemic (O-HI) horses. Increasing BCS was associated with an increase in gene expression of a mitochondrial protein responsible for mitochondrial biogenesis (estrogen-related receptor alpha, ERRα) and with increased antioxidant enzyme total superoxide dismutase (TotSOD) activity. When groups (L-NI, O-NI, and O-HI) were compared, TotSOD activity was increased and protein carbonyls, a marker of oxidative damage, decreased in the O-HI compared to the L-NI horses. These findings suggest that a protective antioxidant response occurred in the muscle of obese animals and that obesity-associated oxidative damage in skeletal muscle is not central to the pathogenesis of equine hyperinsulinemia.

Introduction

Obesity is an increasingly common condition of all domestic animals, including horses. Owner surveys and prospective observational studies in the United States and Europe indicate that 45% to 55% of the equine population is overweight or obese (1–3). Equine obesity is associated with insulin resistance (IR) and fasting hyperinsulinemia (4,5). Furthermore, hyperinsulinemia has been reported to be the most common condition associated with laminitis at a first-opinion hospital (6). Despite the clinical significance of hyperinsulinemia and IR in horses, pathogenesis of equine obesity-associated insulin dysregulation remains poorly understood.

Obesity-associated IR in humans is attributed to oxidative stress, lipid accumulation, and/or inflammation within insulin-sensitive tissues (7–9). Oxidative stress is defined as a disruption in the balance between antioxidant defenses and the production of reactive oxygen species (ROS). Failure of antioxidant defenses to respond to increased ROS, overwhelming ROS production, or decreased antioxidant defenses may all result in oxidative stress. This pro-oxidant state leads to structural modifications of lipids, proteins, and deoxyribonucleic acid (DNA) that can alter cellular function and lead to permanent damage, known as oxidative damage. Stress kinases, activated by ROS, can modify key insulin-signaling proteins in skeletal muscle, resulting in impaired insulin signal transduction, insulin resistance, and hyperinsulinemia (10).

Increased production of reactive oxygen species (ROS) may be attributed to impaired mitochondrial oxidative phosphorylation. In humans with type-II diabetes, skeletal muscle has been demonstrated to have low mitochondrial content, decreased respiratory capacity, and alterations in mitochondrial dynamics, all of which may result in impaired mitochondrial function (11–15). Mitochondrial biogenesis is regulated by peroxisome proliferator-activated receptor gamma coactivators 1 alpha (PGC1α) and 1 beta (PGC1β). Downstream of PGC1α and PGC1β are estrogen-related receptor alpha (ERRα) and nuclear respiratory factor 1 (Nrf1), transcription factors that activate transcription of genes involved in oxidative phosphorylation and biogenesis (16,17). Mitochondrial dynamics include fission and fusion. Mitochondrial fission, or fragmentation, is controlled primarily by dynamin-related protein 1 (Drp1) and fission-1 (Fis-1), while mitochondrial fusion is controlled by the mitofusins (Mfn) 1 and 2 and optic atrophy 1 (OPA-1) protein.

Accurate quantification of oxidative stress within a biological system can be difficult due to poor stability of markers of oxidative stress both in vivo and ex vivo (18,19). Therefore, multiple techniques are often used in order to obtain a more accurate global assessment. Antioxidant capacity and oxidative damage are measured in order to evaluate the consequences of increased ROS, as direct measurement of ROS production is technically challenging and expensive. Antioxidant status is assessed by measuring individual antioxidant concentration, enzymatic activity, or total antioxidant capacity (20). Key antioxidants include glutathione and the enzymes manganese superoxide dismutase (MnSOD), copper-zinc superoxide dismutase (CnZnSOD), catalase, and the mitochondrial peroxiredoxins. Oxidative damage may be assessed by measuring oxidized proteins, lipids, or DNA.

In equids, the role of systemic oxidative stress in obesity, hyperinsulinemia, and insulin resistance (IR) remains to be defined. In one study, antioxidant capacity, as assessed by red blood cell glutathione peroxidase activity, was decreased in obese horses (21). Yet in other studies, systemic oxidative damage, which is the typical consequence of decreased antioxidant capacity, was not associated with either obesity or hyperinsulinemia (21,22). It is likely, however, that oxidative stress in tissues precedes the development of systemic oxidative stress and the role of oxidative stress in insulin-sensitive tissues has not been evaluated in obese and/or hyperinsulinemic horses.

We hypothesized that obesity is associated with mitochondrial dysfunction and oxidative stress in horses. We further hypothesized that obesity-associated oxidative stress is associated with hyperinsulinemia. To test these hypotheses, relationships between body condition score (BCS) as an indicator of obesity and markers of mitochondrial function and oxidative stress were evaluated. In addition, antioxidant capacity and products of oxidative damage were compared among lean, normoinsulinemic (L-NI); obese, normoinsulinemic (O-NI); and obese, hyperinsulinemic horses (O-HI).

Materials and methods

Study population and sample collection

Adult horses donated to Oklahoma State University or the University of Tennessee were included in the study. Body condition score (BCS) was assessed in all animals (n = 35) by a single experienced observer, as described in a previous study (23). Thirty-five light breed horses with body condition scores of 3/9 to 9/9 were studied, including 7 obese, normoinsulinemic (O-NI; BCS ≥ 7, resting serum insulin < 30 μIU/mL), 6 obese, hyperinsulinemic (O-HI; BCS > 7, resting serum insulin ≥ 30 μIU/mL) horses, 17 lean horses with normoinsulinemia (L-NI; BCS ≤ 5, resting insulin < 30 μIU/mL), and 5 overweight horses with variable insulin concentration (BCS 6). All horses were considered to be free of systemic disease (aside from endocrine or metabolic disease) on the basis of physical examination.

Blood samples and skeletal muscle biopsies were collected from all horses. Sampling occurred throughout the year, with 10 horses sampled in the fall (August to November), 7 horses in winter (December to February), 10 horses in spring (March to May), and 8 horses in summer (June to July; Table I). All horses (n = 35, Figure 2) were included in correlation analysis that evaluated relationships between body condition score and oxidative stress. In order to determine if hyperinsulinemia had a role in obesity-associated mitochondrial dysfunction, oxidative stress markers in obese horses (BCS ≥ 7) with hyperinsulinemia (O-HI) were compared to those of obese horses with normoinsulinemia (O-NI), with normoinsulinemic lean horses (BCS ≤ 5; L-NI) included as controls (total n = 30; Table I, Figure 2).

Table I.

Population characteristics by group, comparing lean, normoinsulinemic (L-NI); obese, normoinsulinemic (O-NI); and obese, hyperinsulinemic (O-HI) horses

Lean, L-NI
(n = 17)
Overweight
(n = 5)
Obese, O-NI
(n = 7)
Obese, O-HI
(n = 6)
Breed QH/Paint (n = 13)
TB (n = 4)
QH/Paint (n = 3)
Azteca (n = 1)
Arab (n = 1)
QH/Paint (n = 6)
MFT (n = 1)
Paso Fino (n = 2)
Morgan (n = 1)
Azteca (n = 1)
QH (n = 1)
TWH (n = 1)
Age 15 ± 7 16 ± 5 11 ± 5 15 ± 4
Gender Gelding (n = 11)
Mare (n = 6)
Mare (n = 5) Gelding (n = 4)
Mare (n = 3)
Gelding (n = 3)
Mare (n = 3)
BCS 5 (4 to 5)a 6a,b 8 (7 to 8)b 8.5 (8 to 9)b
Insulin (μIU/mL) 6 (5 to 14)a 13 (12 to 356)b 14 (5 to 18)a 195 (72 to 315)b,c
ACTH (pg/mL) 35 (28 to 61) 28 (16 to 99) 36 (19 to 43) 37 (19 to 68)
Fall 4 2 3 1
Winter 6 1 0 0
Spring 6 1 3 0
Summer 1 1 1 5

QH — Quarter horse; TB — Thoroughbred; MFT — Missouri foxtrotter; TWH — Tennessee walking horse.

Age is expressed as mean ± standard deviation; insulin, body condition score (BCS), and adrenocorticotropic hormone (ACTH) are expressed as median (IQR).

Significance between columns (P ≤ 0.01) is denoted by different superscript letters.

Figure 2.

Figure 2

Population characteristics of all horses (n = 35) in study.

Horses were not fed grain for 12 h before sample collection. Blood samples were collected between 9 am and 12 pm into tubes containing no anticoagulant and into tubes containing EDTA and were immediately placed on ice. All samples were centrifuged (1200 × g, 10 min) within 30 min of collection and stored at −80°C until analysis.

Semi-membranosus muscle biopsies were collected antemortem (n = 15) for horses that were not euthanized or within 15 min after euthanasia with pentobarbital (n = 20) using an open biopsy technique as described in a previous study (24). Muscle biopsy samples were flash frozen in liquid nitrogen and stored at −80°C until analysis. All samples were obtained in accordance with the institution’s Animal Care and Use Committee.

Hormone concentrations

Serum insulin concentration was measured by radioimmunoassay (Coat-A-Count; Siemens Healthcare Diagnostics, Tarrytown, New York, USA). Plasma adrenocorticotropic hormone (ACTH) concentration was determined by chemiluminescent assay (Immulite; Siemens Healthcare Diagnostics). Adrenocorticotropin was measured as a marker of pituitary pars intermedia dysfunction. Both assays were previously validated for use in horses (25,26).

Muscle homogenate preparation

Muscle samples (approximately 50 mg) were homogenized in phosphate-buffered saline (PBS) using a tissue homogenizer (Fisher Scientific, Pittsburg, Pennsylvania, USA). Homogenates were centrifuged at 1000 × g for 10 min. Protein concentration of supernatant was quantified using a commercially available assay (DC Protein Assay; Bio-Rad, Hercules, California, USA).

Carbonylated proteins

Carbonylated proteins were derivatized in a sample of skeletal muscle homogenate as described in a previous study (27), with minor modifications. Samples were derivatized with 2,4-dinitrophenylhydrazine (DNPH; Sigma Aldrich, St. Louis, Missouri, USA) diluted in Tris-buffered saline (TBS) and 2.5 μg of protein applied to a polyvinylidene fluoride (PVDF) membrane using a slot blot apparatus. A commercially available oxidized protein (Carbonyl-BSA; Cell Biolabs, San Diego, California, USA) was used as a positive control. The membrane was stained with Ponceau S to evaluate protein loading. The membrane was then blocked in 5% skim milk in TBS for 1 h, washed 3 times in 0.05% Tween (Bio-Rad, Hercules, California, USA) in TBS, and incubated with anti-DNPH primary antibody (Sigma-Aldrich) (1:1000) overnight at 4°C. After washing with 5% skim milk and 1% Tween (Bio-Rad) in TBS, the membrane was incubated in secondary antibody (Goat-anti-mouse IgE; Southern Biotech, Birmingham, Alabama, USA) (1:10000) at room temperature for 1 h. Detection was carried out by chemiluminescence (GE Healthcare, Piscataway, New Jersey, USA). Commercially available software (Bio-Rad) was used for quantitative analysis of the slot blot, accounting for any difference in protein loading with Image J (http://rsb.info.nih.gov/ij).

Thiobarbituric acid reactive substances

Thiobarbituric acid reactive substances (TBARS) were evaluated in muscle homogenate supernatants using a commercially available kit (OXI-TEK; Enzo Life Sciences, Farmingdale, New York, USA) that has previously been validated in the horse (28). Muscle supernatants were analyzed in triplicate according to manufacturer’s directions.

Antioxidant assays

Total superoxide dismutase (TotSOD) activity was measured in muscle homogenate supernatants using a commercially available kit (Enzo Life Sciences) and manganese superoxide dismutase (MnSOD) activity was determined by inhibition of copper-zinc superoxide dismutase (CuZnSOD) with 2.8 mmol sodium cyanide (Sigma Aldrich). For assessment of total glutathione, homogenate supernatant was added to a reaction mixture containing 0.32 mM 5,5′-dithiobis (2-nitrobenzoic acid), 0.32 mM reduced nicotinamide adenine dinucleotide phosphate (NADPH), and 1.3 U/mL glutathione reductase (Sigma Aldrich) as previously described in the horse (29). Glutathione peroxidase (GPX) activity was assessed in 10 μL of supernatant using serial dilutions of bovine glutathione peroxidase (Sigma Aldrich) as an assay standard (29).

Gene expression

Total ribonucleic acid (RNA) was extracted from approximately 30 mg of muscle tissue, using TRIzol extraction (Invitrogen, Eugene, Oregon, USA). The integrity of RNA was assessed using agarose gel electrophoresis. For quantitative polymerase chain reaction (qPCR), total RNA was treated with DNAse (Ambion, Crawley, Texas, USA) and complementary DNA (cDNA) was transcribed according to the manufacturer’s directions (Life Technologies, Carlsbad, California, USA). Equine-specific primers (Supplementary Table I) were designed with Primer3 (primer3.sourceforge.net) from published equine sequence data (www.ncbi.nlm.nih.gov/nuccore) and used to amplify peroxisome proliferator-activated receptor gamma coactivator 1 (PGC1), PGC1α, PGC1β, estrogen-related receptor alpha (ERRα), manganese superoxide dismutase (MnSOD), glutathione peroxidase 1 (GPX1), glutathione synthetase (GSS), glutathione reductase (GRS), catalase, peroxiredoxin (PRX), nuclear respiratory factor 1 (Nrf1), mitofusin 2 (Mfn2), and dynamin-related protein (Drp). Primer concentration for amplification was 10 mM.

The relative expression (RE) of each gene was calculated using β-actin, which was chosen as the housekeeping gene after analysis of 4 potential housekeeping genes [β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S, and cyclophilin A] with a commercially available software program (geNorm; Biogazelle, Zwijnaarde, Belgium). It was demonstrated that β-actin was a stable reference gene, with gene expression within 2 standard deviations of the mean cycle threshold on each plate.

Mitochondrial DNA content

The DNA was extracted from approximately 15 mg of muscle tissue using a commercially available kit (DNeasy Blood and Tissue Kit; Qiagen, Valencia, California, USA). Equine-specific primers (Supplementary Table II) were used to amplify the mitochondrial-encoded genes, nicotinamide adenine dinucleotide dehydrogenase (NADH-dh), and cytochrome c oxidase subunit II (COXII) using β-actin as a nuclear reference gene.

Statistical analysis

Statistical analysis was carried out using commercially available software (GraphPad Software, La Jolla, California, USA). Continuous variables were checked for normality using a D’Agostino Pearson test.

A Spearman’s rank correlation coefficient was used to determine the correlation between body condition score (BCS) and markers of oxidative stress, as the data were not normally distributed. All horses (n = 35) were included in correlation analysis. Measurement of oxidative stress consisted of markers of oxidative damage (carbonylated proteins and TBARS); markers of antioxidant capacity [glutathione (GSH) concentration, MnSOD and TotSOD activity, and gene expression of the antioxidant enzymes catalase, glutathione reductase, glutathione synthetase, and peroxiredoxin]; and markers of mitochondrial function (mitochondrial density and gene expression of PGC1α, PGC1β, ERRα, Drp1, Mfn2, and Nrf1). To account for the large number of pairwise comparisons being evaluated by correlation analysis, a Holm-Bonferroni correction was applied.

Population characteristics were compared among groups (lean, normoinsulinemic, L-NI; obese, normoinsulinemic, O-NI; and obese, hyperinsulinemic, O-HI). Body condition scores (BCS) were compared across groups using a Kruskal-Wallis test. A Dunn’s posthoc test was conducted to identify differences among groups. The continuous variables insulin, ACTH, TBARS, protein carbonyls, and MnSOD and TotSOD activity were log-transformed for normality. Comparisons were made using analysis of variance (ANOVA). For any marker that was different across groups, a Tukey’s posthoc test was carried out to identify which groups were different. Because large numbers of samples had GPX activity below detection, GPX activity was dichotomized (detectable versus undetectable) and analyzed by a chi-squared test. Because samples were collected throughout the year, the proportion of horses sampled in fall (versus non-fall) and spring (versus non-spring) was analyzed by a Chi-squared test, and ACTH concentrations (fall versus non-fall) and insulin concentrations (spring versus non-spring and fall versus non-fall) were compared using a t-test. Significance for all variables was interpreted to exist at P ≤ 0.05.

Results

Population characteristics of all horses (n = 35) included in the correlation analysis are presented in Table I and characteristics of 3 subgroups included in the ANOVA (n = 30) are included in Figure 2. Correlation analysis revealed an association between body condition score (BCS) and ERRα gene expression (r = 0.50; P = 0.05; Supplementary Table III). However, there was no relationship between BCS and PGC1α, PGC1β, Nrf1, Drp1, or Mfn2. As the expression of ERRα, a regulator of mitochondrial biogenesis, was upregulated with increasing body condition score, relationships between markers of mitochondrial biogenesis (ERRα, PGC1α, PGC1β, and Nrf1) and mitochondrial density (mitochondrial DNA and COXII) were examined. Regulators of mitochondrial biogenesis were not correlated with COXII expression (P > 0.05).

Total superoxide dismutase (SOD) activity, a marker of antioxidant capacity, was upregulated with increasing body condition score (r = 0.51; P = 0.05; Supplementary Table III). No other marker of antioxidant capacity (GSH concentration; GPX activity; and catalase, peroxiredoxin, GPX, GSS, or GRS expression) was upregulated with increasing body condition score. Products of oxidative damage (protein carbonyls and TBARS) were not associated with body condition score.

In order to determine how the presence of hyperinsulinemia influenced the relationship between oxidative stress and obesity, further analysis was carried out among O-HI, O-NI, and L-NI horses. Body condition score (BCS), hormone concentrations, and markers of antioxidant capacity and oxidative damage were compared among groups (Table 1, Figures 3 and 4). As expected, BCS was significantly increased in O-HI (P < 0.001) and O-NI horses (P = 0.02) compared to L-NI horses. Furthermore, insulin concentration was significantly increased in O-HI horses compared to O-NI or L-NI horses (P < 0.001 for both groups) and in O-NI compared to L-NI horses (P = 0.02). There was no difference in age or ACTH concentration among the 3 groups. When evaluating the potential for a seasonal influence, there were no significant differences among groups in distribution of horses sampled in the fall (August to November) versus non-fall (P = 0.51) or spring (March to May) versus non-spring (P = 0.19). Furthermore, there was no significant difference when evaluating ACTH (P = 0.88) or insulin (P = 0.23) concentrations in fall versus non-fall. There was a trend towards a difference in insulin concentrations in spring versus non-spring (P = 0.09), with higher concentrations in non-spring.

Figure 3.

Figure 3

Total superoxide dismutase (SOD) activity, manganese SOD activity, and total glutathione (GSH) in L-NI (n = 17), O-NI (n = 7), and O-HI (n = 6) horses. Line indicates mean.

** P < 0.01.

Figure 4.

Figure 4

Protein carbonyls and thiobarbituric acid reactive substances (TBARS) in L-NI, O-NI, and O-HI horses. Line indicates mean.

** P < 0.01.

Total SOD activity was increased in muscle samples from O-HI compared to L-NI horses (P = 0.001), while MnSOD activity and GSH concentration did not differ among groups (Figure 3). Carbonylated protein concentration was decreased in O-HI horses compared to O-NI (P = 0.005) and L-NI horses (P < 0.001), but there was no change in TBARS concentration (Figure 4).

Discussion

In the present study, relationships between markers of oxidative stress in skeletal muscles, obesity, and hyperinsulinemia were examined. Increasing body condition score (BCS) was associated with changes in mitochondrial biogenesis and increased antioxidant capacity, which suggests increased exposure to reactive oxygen species (ROS) with obesity. However, there was no evidence of oxidative damage in skeletal muscle in obesity or obesity-associated hyperinsulinemia. These findings suggest that a protective antioxidant response occurred in the muscle of obese animals and that obesity-associated oxidative damage in skeletal muscle is not central to the pathogenesis of equine hyperinsulinemia.

In humans, an increase in systemic markers of oxidative damage is associated with hyperglycemia (as a proxy for type-II diabetes) and obesity (30). In contrast, systemic markers of oxidative damage in horses are not increased with obesity, hyperinsulinemia, or a history of laminitis (21,22,28), a clinical sequelae of hyperinsulinemia. Collectively, these findings suggest that systemic oxidative damage is not a key factor in the development of obesity-associated hyperinsulinemia in horses. However, oxidative stress within tissues is likely to precede the development of systemic oxidative stress markers. Therefore, we explored the relationship between oxidative stress in skeletal muscle and obesity with or without concurrent hyperinsulinemia.

In the present study, expression of ERRα, a regulator of mitochondrial biogenesis, was associated with increasing body condition score. Estrogen-related receptor α is an effector downstream of PGC1α that appears to play a key role in activating transcriptional regulators of mitochondrial biogenesis (16). In vitro, transcription of PGC1α, the master regulator of mitochondrial biogenesis, has been shown to increase with acute ROS exposure (31,32). Although studies have not directly evaluated the effects of ROS on ERRα, the finding of increased expression of ERRα in the current study may support transcriptional upregulation of mitochondrial biogenesis in association with obesity.

Despite the upregulation of ERRα, there was no association between obesity and the master regulator of mitochondrial biogenesis, PGC1α. There was no functional evidence of increased mitochondrial replication, as assessed by mitochondrial content using a mitochondrial specific gene, COXII, to estimate copy number. In addition, expression of nuclear respiratory factor (Nrf1), a transcriptional activator of genes involved in mitochondrial replication and oxidative phosphorylation, was not associated with obesity or other markers of mitochondrial biogenesis. Taken together, these findings suggest that regulators of mitochondrial biogenesis may become dissociated from one another with increasing body condition score (BCS). A loss of regulation of mitochondrial biogenesis has also been reported to occur in obese humans (33).

Tissue antioxidant capacity has been shown to be either downregulated (34) or upregulated (35) with obesity. Downregulation may lead to insufficient cellular protection against ROS and cellular damage, while upregulation may occur secondary to ROS exposure and protect against oxidative damage (35,36). In the current study, TotSOD activity, a marker of antioxidant capacity, increased with increasing BCS. However, there was no change in lipid peroxidation or protein oxidation with increasing obesity. These findings suggest that there may be alterations in skeletal muscle mitochondrial function and ROS production with equine obesity, but a compensatory upregulation in antioxidant capacity limits oxidative damage to skeletal muscle.

Since obesity was associated with oxidative stress in this study, we explored whether obesity-associated hyperinsulinemia was associated with more profound changes in antioxidant capacity or oxidative damage compared to normoinsulinemic horses. Total superoxide dismutase (TotSOD) activity was higher in O-HI than in L-NI horses, while protein carbonyl concentration, a product of oxidative damage, was markedly lower in O-HI than in L-NI or O-NI horses. Considered together with the observed changes in regulation of mitochondrial biogenesis, these data suggest that, although obese horses are exposed to increased ROS, they have a sufficiently protective antioxidant response to avoid accumulation of markers of oxidative damage. The absence of accumulation of products of either lipid peroxidation or protein oxidation in obese, hyperinsulinemic horses would suggest that oxidative damage in skeletal muscle is unlikely to be a key contributor to obesity-associated hyperinsulinemia.

In contrast to the horses studied here, markers of oxidative damage have been shown to accumulate in skeletal muscle of diabetic mice (35) and diabetic humans (7). The differences observed between humans and rodents and the horses in this study may be attributable to differences in glucose regulation in species, as fasting hyperglycemia is relatively uncommon in obese or hyperinsulinemic horses (21). Hyperglycemia has been shown to induce ROS production in cultured muscle cells (37) and species that have higher glucose levels may have more profound increases in ROS production and exposure. The insulin-dysregulated horse, with sustained high fasting insulin concentrations and seemingly limited exposure to high blood glucose concentrations, may be less likely to accumulate products of oxidative damage within skeletal muscle than other species.

In this study, fasting insulin concentration was an outcome of primary interest as hyperinsulinemia is a risk factor for laminitis (5). Insulin resistance can result in hyperinsulinemia, but multiple organs beyond skeletal muscle (liver, adipose, GI tract, and pancreas) contribute to insulin regulation, either as alternate sites of insulin-sensitive glucose uptake, or through clearance or secretion of insulin or other hormones, including incretins. Thus, dysfunction of any of these processes could affect resting insulin concentrations. We elected to evaluate oxidative damage as a potential mechanism of insulin resistance in skeletal muscle in part based on previous findings of impaired insulin-dependent (GLUT4) glucose transport in insulin-resistant horses (38).

A limitation of the present study is that skeletal muscle insulin resistance was not directly evaluated, and there are other factors involved in hyperinsulinemia beyond skeletal muscle insulin resistance in horses. The absence of accumulation of oxidized proteins or lipids in the obese horses, however, suggests that oxidative damage in muscle is unlikely to be an underlying pathology leading to hyperinsulinemia. As the effect of ROS on insulin-signaling is dependent on both concentration and location (39), it may be that skeletal muscle insulin resistance occurs in the absence of accumulation of products of oxidative damage. Alternatively, fasting insulin concentration may not always be associated with skeletal muscle insulin resistance in horses, as has been suggested by dynamic insulin sensitivity testing (40). Further work is needed to determine which pathway or pathways contribute to the development of hyperinsulinemia in the horse.

Another potential limitation of this study was that horses were sampled across seasons. In ponies, markers of systemic oxidative stress (41) and inflammation (42) change over time, thus it is possible that oxidative stress in skeletal muscle is affected by time of year. Furthermore, both ACTH and insulin concentrations change over the season, with ACTH concentrations higher in the fall (43) and insulin concentrations appearing to fluctuate depending on when forage is highest in non-structural carbohydrate (42,44–46). No difference in ACTH concentrations was observed among the groups, which suggests that this hormone was unlikely to have a substantial impact on the differences in oxidative stress markers among groups. There were no significant differences among groups in proportions of horses sampled in the fall (versus non-fall) or spring (versus non-spring) or in concentrations of hormones between fall and non-fall or spring and non-spring, which suggests that season would have a limited influence on differences in hormone concentrations observed among groups.

In conclusion, although oxidative stress in skeletal muscle appears to occur with equine obesity, oxidative damage does not appear to be associated with obesity and is therefore unlikely to be central to obesity-associated hyperinsulinemia. Further investigation into the relationship between phosphorylation status of insulin-signaling proteins and markers of oxidative stress within skeletal muscle may clarify these findings.

Supplementary materials

Supplementary Table I.

Primer sequences used for gene expression analysis

Primer Forward (5′-3′) Reverse (5′-3′) Ampliconsize (bp) Function
β-actin agtactccgtatggatcggcg ccggactcgtcgtactcctg 91 Housekeeping gene
Catalase cttaccaaggtttggcctca ggagagcactggcttttacg 386 Antioxidant enzyme
Drp-1 cccagaggcactggtattgt cctacaggcaccttggtcat 353 Mitochondrial fission
ERR-α tggcctctggctaccacta gcatggcatacagcttctca 384 Mitochondrial biogenesis
GPX tgagaagtgcgaggtgaatg tccccagagaaaagcactgt 328 Glutathione oxidation
GRS tcgctaatgatacggcatga cagcagctattgcaactgga 397 Glutathione reductase
GSS ttcacgctcttcccttcact tcttggcagcttctttggtt 368 Glutathione synthesis
MnSOD aatggtggaggccatatcaa cgtccctggtccttattgaa 203 Mitochondrial antioxidant enzyme
Mfn2 ctcttccctcgatgcaactc gcagaactttgtcccagagc 358 Mitochondrial fusion
Nrf1 tcccgaggacacctcttatg gcagactccaggtcttccag 369 Oxidative phosphorylation and mitochondrial biogenesis
Peroxiredoxin III tcccttggatttcacctttg gtttgctgggcagacttctc 397 Mitochondrial antioxidant enzyme
PGC1α gtgaagaccagcctctttgc aatccgtcttcatccacagg 247 Mitochondrial biogenesis
PGC1β gagttgcacggaactgcata gggtctgatctgcttgaagg 361 Mitochondrial biogenesis

Drp-1 — dynamin-related protein; ERR-α — estrogen-related receptor alpha; GPX — glutathione peroxidase; GRS — glutathione reductase; GSS — glutathione synthetase; MnSOD — manganese superoxide dismutase; Mfn2 — mitofusin 2; Nrf1 — nuclear respiratory factor 1; PGC1α — peroxisome proliferator-activated receptor gamma coactivator 1 alpha; PGC1β — peroxisome proliferator-activated receptor gamma coactivator 1 beta.

Supplementary Table II.

Primer sequences used for measuring mitochondrial DNA content

Primer Forward (5′-3′) Reverse (5′-3′) Location of DNA
β-actin agtactccgtatggatcggcg ccggactcgtcgtactcctg Nuclear
NADH-dh ccatagaagcctccaccaaa ccaagttttatggcgagagc Mitochondrial
COXII cgagtggttctccccataga gagaggccacgagagttgtc Mitochondrial

NADH-dh — nicotinamide adenine dinucleotide dehydrogenase; COXII — cytochrome c oxidase subunit II.

Supplementary Table III.

Spearman correlation coefficients between markers of oxidative stress and body condition score. *P ≤ 0.05

Parameter BCS
TBARS plasma −0.22
TBARS muscle 0.39
GSH 0.19
Protein carbonyls −0.48
MnSOD activity −0.03
TotSOD activity 0.51*
PGC1α (RE) 0.40*
ERRα (RE) 0.50*
COXII (RE) 0.07
Nrf1 (RE) −0.08
MnSOD (RE) 0.27
Mfn2 (RE) 0.23
Drp1 (RE) 0.45
PGC1β (RE) −0.06
Cat (RE) 0.11
PRX (RE) −0.01
GSS (RE) 0.13
GRS (RE) 0.01
GPX (RE) 0.32

Figure 1.

Figure 1

Proposed relationship between obesity, mitochondrial function, oxidative stress, and hyperinsulinemia.

Acknowledgments

Funding was provided by the American Quarter Horse Association and the Oklahoma State University Research Advisory Committee. The authors thank Kim Hill and Kristen McDaniel for technical assistance.

References

  • 1.Thatcher CD, Pleasant RS, Geor RJ, Elvinger F. Prevalence of overconditioning in mature horses in southwest Virginia during the summer. J Vet Intern Med. 2012;26:1413–1418. doi: 10.1111/j.1939-1676.2012.00995.x. [DOI] [PubMed] [Google Scholar]
  • 2.Stephenson HM, Green MJ, Freeman SL. Prevalence of obesity in a population of horses in the UK. Vet Rec. 2011;168:131. doi: 10.1136/vr.c6281. [DOI] [PubMed] [Google Scholar]
  • 3.Wyse CA, McNie KA, Tannahil VJ, Murray JK, Love S. Prevalence of obesity in riding horses in Scotland. Vet Rec. 2008;162:590–591. doi: 10.1136/vr.162.18.590. [DOI] [PubMed] [Google Scholar]
  • 4.Vick MM, Adams AA, Murphy BA, et al. Relationships among inflammatory cytokines, obesity, and insulin sensitivity in the horse. J Anim Sci. 2007;85:1144–1155. doi: 10.2527/jas.2006-673. [DOI] [PubMed] [Google Scholar]
  • 5.Muno JD. MS thesis. Columbus, Ohio: Ohio State University; 2009. Prevalence, risk factors and seasonality of plasma insulin concentrations in normal horses in central Ohio. [Google Scholar]
  • 6.Karikoski NP, Horn I, McGowan TW, McGowan CM. The prevalence of endocrinopathic laminitis among horses presented for laminitis at a first-opinion/referral equine hospital. Domest Anim Endocrinol. 2011;41:111–117. doi: 10.1016/j.domaniend.2011.05.004. [DOI] [PubMed] [Google Scholar]
  • 7.Ingram KH, Hill H, Moellering DR, et al. Skeletal muscle lipid peroxidation and insulin resistance in humans. J Clin Endocrinol Metab. 2012;97:E1182–E1186. doi: 10.1210/jc.2011-2963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Poelkens F, Lammers G, Pardoel EM, Tack CJ, Hopman MT. Upregulation of skeletal muscle inflammatory genes links inflammation with insulin resistance in women with the metabolic syndrome. Exp Physiol. 2013;98:1485–1494. doi: 10.1113/expphysiol.2013.072710. [DOI] [PubMed] [Google Scholar]
  • 9.Coen PM, Hames KC, Leachman EM, et al. Reduced skeletal muscle oxidative capacity and elevated ceramide but not diacylglycerol content in severe obesity. Obesity. 2013;21:2362–2371. doi: 10.1002/oby.20381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Vinayagamoorthi R, Bobby Z, Sridhar MG. Antioxidants preserve redox balance and inhibit c-Jun-N-terminal kinase pathway while improving insulin signaling in fat-fed rats: Evidence for the role of oxidative stress on IRS-1 serine phosphorylation and insulin resistance. J Endocrinol. 2008;197:287–296. doi: 10.1677/JOE-08-0061. [DOI] [PubMed] [Google Scholar]
  • 11.Hsieh CJ, Weng SW, Liou CW, et al. Tissue-specific differences in mitochondrial DNA content in type 2 diabetes. Diabetes Res Clin Pract. 2011;92:106–110. doi: 10.1016/j.diabres.2011.01.010. [DOI] [PubMed] [Google Scholar]
  • 12.Morino K, Petersen KF, Dufour S, et al. Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents. J Clin Invest. 2005;115:3587–3593. doi: 10.1172/JCI25151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Phielix E, Schrauwen-Hinderling VB, Mensink M, et al. Lower intrinsic ADP-stimulated mitochondrial respiration underlies in vivo mitochondrial dysfunction in muscle of male type 2 diabetic patients. Diabetes. 2008;57:2943–2949. doi: 10.2337/db08-0391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jheng HF, Tsai PJ, Guo SM, et al. Mitochondrial fission contributes to mitochondrial dysfunction and insulin resistance in skeletal muscle. Mol Cell Biol. 2012;32:309–319. doi: 10.1128/MCB.05603-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sebastián D, Hernández-Alvarez MI, Segalés J, et al. Mitofusin 2 (Mfn2) links mitochondrial and endoplasmic reticulum function with insulin signaling and is essential for normal glucose homeostasis. Proc Natl Acad Sci U S A. 2012;109:5523–5528. doi: 10.1073/pnas.1108220109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Schreiber SN, Emter R, Hock MB, et al. The estrogen-related receptor alpha (ERRalpha) functions in PPARgamma coactivator 1alpha (PGC-1alpha)-induced mitochondrial biogenesis. Proc Natl Acad Sci U S A. 2004;101:6472–6477. doi: 10.1073/pnas.0308686101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wu Z, Puigserver P, Andersson U, et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell. 1999;98:115–124. doi: 10.1016/S0092-8674(00)80611-X. [DOI] [PubMed] [Google Scholar]
  • 18.Halliwell B, Chirico S. Lipid peroxidation: Its mechanism, measurement, and significance. Am J Clin Nutr. 1993;57:715S–724S. doi: 10.1093/ajcn/57.5.715S. [DOI] [PubMed] [Google Scholar]
  • 19.Kalyanaraman B, Darley-Usmar V, Davies KJ, et al. Measuring reactive oxygen and nitrogen species with fluorescent probes: Challenges and limitations. Free Radic Biol Med. 2012;52:1–6. doi: 10.1016/j.freeradbiomed.2011.09.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wood LG, Gibson PG, Garg ML. A review of the methodology for assessing in vivo antioxidant capacity. J Sci Food Agric. 2006;86:2057–2066. [Google Scholar]
  • 21.Pleasant RS, Suagee JK, Thatcher CD, Elvinger F, Geor RJ. Adiposity, plasma insulin, leptin, lipids, and oxidative stress in mature light breed horses. J Vet Intern Med. 2013;27:576–582. doi: 10.1111/jvim.12056. [DOI] [PubMed] [Google Scholar]
  • 22.Holbrook TC, Tipton T, McFarlane D. Neutrophil and cytokine dysregulation in hyperinsulinemic obese horses. Vet Immunol Immunopathol. 2012;145:283–289. doi: 10.1016/j.vetimm.2011.11.013. [DOI] [PubMed] [Google Scholar]
  • 23.Henneke D, Potter GD, Kreider JL, Yates B. Relationship between condition score, physical measurements and body fat percentage in mares. Equine Vet J. 1983;15:371–372. doi: 10.1111/j.2042-3306.1983.tb01826.x. [DOI] [PubMed] [Google Scholar]
  • 24.Firshman AM, Valberg SJ, Bender JB, Annandale EJ, Hayden DW. Comparison of histopathologic criteria and skeletal muscle fixation techniques for the diagnosis of polysaccharide storage myopathy in horses. Vet Pathol. 2006;43:257–269. doi: 10.1354/vp.43-3-257. [DOI] [PubMed] [Google Scholar]
  • 25.Freestone JF, Wolfsheimer KJ, Kamerling SG, Church G, Hamra J, Bagwell C. Exercise induced hormonal and metabolic changes in Thoroughbred horses: Effects of conditioning and acepromazine. Equine Vet J. 1991;23:219–223. doi: 10.1111/j.2042-3306.1991.tb02760.x. [DOI] [PubMed] [Google Scholar]
  • 26.Perkins GA, Lamb S, Erb HN, Schanbacher B, Nydam DV, Divers TJ. Plasma adrenocorticotropin (ACTH) concentrations and clinical response in horses treated for equine Cushing’s disease with cyproheptadine or pergolide. Equine Vet J. 2002;34:679–685. doi: 10.2746/042516402776250333. [DOI] [PubMed] [Google Scholar]
  • 27.Alves RM, Vitorino R, Figueiredo P, Duarte JA, Ferreira R, Amado F. Lifelong physical activity modulation of the skeletal muscle mitochondrial proteome in mice. J Gerontol A Biol Sci Med Sci. 2010;65:832–842. doi: 10.1093/gerona/glq081. [DOI] [PubMed] [Google Scholar]
  • 28.Treiber K, Carter R, Gay L, Williams C, Geor R. Inflammatory and redox status of ponies with a history of pasture-associated laminitis. Vet Immunol Immunopathol. 2009;129:216–220. doi: 10.1016/j.vetimm.2008.11.004. [DOI] [PubMed] [Google Scholar]
  • 29.McFarlane D, Cribb AE. Systemic and pituitary pars intermedia antioxidant capacity associated with pars intermedia oxidative stress and dysfunction in horses. Am J Vet Res. 2005;66:2065–2072. doi: 10.2460/ajvr.2005.66.2065. [DOI] [PubMed] [Google Scholar]
  • 30.Keaney JF, Jr, Larson MG, Vasan RS, et al. Obesity and systemic oxidative stress: Clinical correlates of oxidative stress in the Framingham Study. Arterioscler Thromb Vascular Biol. 2003;23:434–439. doi: 10.1161/01.ATV.0000058402.34138.11. [DOI] [PubMed] [Google Scholar]
  • 31.Meirhaeghe A, Crowley V, Lenaghan C, et al. Characterization of the human, mouse and rat PGC1 beta (peroxisome-proliferator-activated receptor-gamma co-activator 1 beta) gene in vitro and in vivo. Biochem J. 2003;373:155–165. doi: 10.1042/BJ20030200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Irrcher I, Ljubicic V, Hood DA. Interactions between ROS and AMP kinase activity in the regulation of PGC-1alpha transcription in skeletal muscle cells. Am J Physiol Cell Physiol. 2009;296:C116–C123. doi: 10.1152/ajpcell.00267.2007. [DOI] [PubMed] [Google Scholar]
  • 33.Holloway GP, Thrush AB, Heigenhauser GJ, et al. Skeletal muscle mitochondrial FAT/CD36 content and palmitate oxidation are not decreased in obese women. Am J Physiol Endocrinol Metab. 2007;292:E1782–E1789. doi: 10.1152/ajpendo.00639.2006. [DOI] [PubMed] [Google Scholar]
  • 34.Furukawa S, Fujita T, Shimabukuro M, et al. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest. 2004;114:1752–1761. doi: 10.1172/JCI21625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bonnard C, Durand A, Peyrol S, et al. Mitochondrial dysfunction results from oxidative stress in the skeletal muscle of diet­-induced insulin-resistant mice. J Clin Invest. 2008;118:789–800. doi: 10.1172/JCI32601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Boden MJ, Brandon AE, Tid-Ang JD, et al. Overexpression of manganese superoxide dismutase ameliorates high-fat diet-induced insulin resistance in rat skeletal muscle. Am J Physiol Endocrinol Metab. 2012;303:E798–E805. doi: 10.1152/ajpendo.00577.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yu T, Robotham JL, Yoon Y. Increased production of reactive oxygen species in hyperglycemic conditions requires dynamic change of mitochondrial morphology. Proc Natl Acad Sci U S A. 2006;103:2653–2658. doi: 10.1073/pnas.0511154103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Waller AP, Burns TA, Mudge MC, Belknap JK, Lacombe VA. Insulin resistance selectively alters cell-surface glucose transporters but not their total protein expression in equine skeletal muscle. J Vet Intern Med. 2011;25:315–321. doi: 10.1111/j.1939-1676.2010.0674.x. [DOI] [PubMed] [Google Scholar]
  • 39.Iwakami S, Misu H, Takeda T, et al. Concentration-dependent dual effects of hydrogen peroxide on insulin signal transduction in H4IIEC hepatocytes. PloS One. 2011;6:e27401. doi: 10.1371/journal.pone.0027401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Banse HE, McFarlane D. Comparison of three methods for evaluation of equine insulin regulation in horses of varied body condition score. J Equine Vet Sci. 2014;34:742–748. [Google Scholar]
  • 41.Bruynsteen L, Janssens GP, Harris PA, et al. Changes in oxidative stress in response to different levels of energy restriction in obese ponies. Br J Nutr. 2014;112:1402–1411. doi: 10.1017/S0007114514001974. [DOI] [PubMed] [Google Scholar]
  • 42.Wray H, Elliott J, Bailey SR, Harris PA, Menzies-Gow NJ. Plasma concentrations of inflammatory markers in previously laminitic ponies. Equine Vet J. 2013;45:546–551. doi: 10.1111/evj.12031. [DOI] [PubMed] [Google Scholar]
  • 43.Donaldson MT, McDonnell SM, Schanbacher BJ, Lamb SV, McFarlane D, Beech J. Variation in plasma adrenocorticotropic hormone concentration and dexamethasone suppression test results with season, age, and sex in healthy ponies and horses. J Vet Intern Med. 2005;19:217–222. doi: 10.1892/0891-6640(2005)19<217:vipahc>2.0.co;2. [DOI] [PubMed] [Google Scholar]
  • 44.Bailey SR, Habershon-Butcher JL, Ransom KJ, Elliott J, Menzies-Gow NJ. Hypertension and insulin resistance in a mixed-breed population of ponies predisposed to laminitis. Am J Vet Res. 2008;69:122–129. doi: 10.2460/ajvr.69.1.122. [DOI] [PubMed] [Google Scholar]
  • 45.Frank N, Elliott SB, Chameroy KA, Toth F, Chumbler NS, McClamroch R. Association of season and pasture grazing with blood hormone and metabolite concentrations in horses with presumed pituitary pars intermedia dysfunction. J Vet Intern Med. 2010;24:1167–1175. doi: 10.1111/j.1939-1676.2010.0547.x. [DOI] [PubMed] [Google Scholar]
  • 46.Borer KE, Bailey SR, Menzies-Gow NJ, Harris PA, Elliott J. Effect of feeding glucose, fructose, and inulin on blood glucose and insulin concentrations in normal ponies and those predisposed to laminitis. J Anim Sci. 2012;90:3003–3011. doi: 10.2527/jas.2011-4236. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table I.

Primer sequences used for gene expression analysis

Primer Forward (5′-3′) Reverse (5′-3′) Ampliconsize (bp) Function
β-actin agtactccgtatggatcggcg ccggactcgtcgtactcctg 91 Housekeeping gene
Catalase cttaccaaggtttggcctca ggagagcactggcttttacg 386 Antioxidant enzyme
Drp-1 cccagaggcactggtattgt cctacaggcaccttggtcat 353 Mitochondrial fission
ERR-α tggcctctggctaccacta gcatggcatacagcttctca 384 Mitochondrial biogenesis
GPX tgagaagtgcgaggtgaatg tccccagagaaaagcactgt 328 Glutathione oxidation
GRS tcgctaatgatacggcatga cagcagctattgcaactgga 397 Glutathione reductase
GSS ttcacgctcttcccttcact tcttggcagcttctttggtt 368 Glutathione synthesis
MnSOD aatggtggaggccatatcaa cgtccctggtccttattgaa 203 Mitochondrial antioxidant enzyme
Mfn2 ctcttccctcgatgcaactc gcagaactttgtcccagagc 358 Mitochondrial fusion
Nrf1 tcccgaggacacctcttatg gcagactccaggtcttccag 369 Oxidative phosphorylation and mitochondrial biogenesis
Peroxiredoxin III tcccttggatttcacctttg gtttgctgggcagacttctc 397 Mitochondrial antioxidant enzyme
PGC1α gtgaagaccagcctctttgc aatccgtcttcatccacagg 247 Mitochondrial biogenesis
PGC1β gagttgcacggaactgcata gggtctgatctgcttgaagg 361 Mitochondrial biogenesis

Drp-1 — dynamin-related protein; ERR-α — estrogen-related receptor alpha; GPX — glutathione peroxidase; GRS — glutathione reductase; GSS — glutathione synthetase; MnSOD — manganese superoxide dismutase; Mfn2 — mitofusin 2; Nrf1 — nuclear respiratory factor 1; PGC1α — peroxisome proliferator-activated receptor gamma coactivator 1 alpha; PGC1β — peroxisome proliferator-activated receptor gamma coactivator 1 beta.

Supplementary Table II.

Primer sequences used for measuring mitochondrial DNA content

Primer Forward (5′-3′) Reverse (5′-3′) Location of DNA
β-actin agtactccgtatggatcggcg ccggactcgtcgtactcctg Nuclear
NADH-dh ccatagaagcctccaccaaa ccaagttttatggcgagagc Mitochondrial
COXII cgagtggttctccccataga gagaggccacgagagttgtc Mitochondrial

NADH-dh — nicotinamide adenine dinucleotide dehydrogenase; COXII — cytochrome c oxidase subunit II.

Supplementary Table III.

Spearman correlation coefficients between markers of oxidative stress and body condition score. *P ≤ 0.05

Parameter BCS
TBARS plasma −0.22
TBARS muscle 0.39
GSH 0.19
Protein carbonyls −0.48
MnSOD activity −0.03
TotSOD activity 0.51*
PGC1α (RE) 0.40*
ERRα (RE) 0.50*
COXII (RE) 0.07
Nrf1 (RE) −0.08
MnSOD (RE) 0.27
Mfn2 (RE) 0.23
Drp1 (RE) 0.45
PGC1β (RE) −0.06
Cat (RE) 0.11
PRX (RE) −0.01
GSS (RE) 0.13
GRS (RE) 0.01
GPX (RE) 0.32

Articles from Canadian Journal of Veterinary Research are provided here courtesy of Canadian Veterinary Medical Association

RESOURCES