L-type Calcium Channel Ca_v1.2 Is Required for Maintenance of Auditory Brainstem Nuclei

Background: Ca_v1.2 is a calcium channel involved in excitation-coupled postsynaptic signaling.

Results: Targeted deletion of Ca_v1.2 in the auditory brainstem causes early postnatal cell death.

Conclusion: Ca_v1.2 is essential for the survival of auditory brainstem neurons shortly after circuit formation.

Significance: This study identifies the common and distinct functions of neuronal L-type calcium channels.

Abstract

Ca_v1.2 and Ca_v1.3 are the major L-type voltage-gated Ca²⁺ channels in the CNS. Yet, their individual in vivo functions are largely unknown. Both channel subunits are expressed in the auditory brainstem, where Ca_v1.3 is essential for proper maturation. Here, we investigated the role of Ca_v1.2 by targeted deletion in the mouse embryonic auditory brainstem. Similar to Ca_v1.3, loss of Ca_v1.2 resulted in a significant decrease in the volume and cell number of auditory nuclei. Contrary to the deletion of Ca_v1.3, the action potentials of lateral superior olive (LSO) neurons were narrower compared with controls, whereas the firing behavior and neurotransmission appeared unchanged. Furthermore, auditory brainstem responses were nearly normal in mice lacking Ca_v1.2. Perineuronal nets were also unaffected. The medial nucleus of the trapezoid body underwent a rapid cell loss between postnatal days P0 and P4, shortly after circuit formation. Phosphorylated cAMP response element-binding protein (CREB), nuclear NFATc4, and the expression levels of p75NTR, Fas, and FasL did not correlate with cell death. These data demonstrate for the first time that both Ca_v1.2 and Ca_v1.3 are necessary for neuronal survival but are differentially required for the biophysical properties of neurons. Thus, they perform common as well as distinct functions in the same tissue.

Introduction

L-type voltage-gated Ca²⁺ channels (L-VGCCs)² serve as key transducers in the plasma membrane, converting membrane depolarization to intracellular signaling (1). They consist of a pore-forming α1 subunit and auxiliary α2, β, γ, and δ subunits (1, 2). Of the four α1 subunits, Ca_v1.1–Ca_v1.4, neurons mainly express Ca_v1.2 and Ca_v1.3 (3). During brain development, these two subunits participate in various processes such as neuronal survival (4, 5), neurite outgrowth (6, 7), the maturation of GABAergic synapses (8, 9), the positioning of the axon initiation segment (10), and myelination (11). In the mature brain, L-VGCCs are important for long-term potentiation (12) and glutamate receptor trafficking (13, 14).

The lack of isoform-specific pharmacological tools against the two subunits has long precluded the dissection of their precise in vivo roles (15, 16). Results from human genetics and transgenic mice have only recently provided some insights into these roles (16). In humans, mutations in Cacna1c, which encodes Ca_v1.2, are associated with Timothy syndrome, characterized by cardiac arrhythmia, syndactyly, cognitive abnormalities, and autism (17), Brugada syndrome-3 (18), associated with shorter QT intervals or early repolarization syndrome with an abnormal electroencephalography pattern (19). Furthermore, genome-wide association studies have linked Cacna1c polymorphisms to psychiatric disorders such as schizophrenia and bipolar disorders (20–22). In mice, constitutive ablation of Cacna1c causes embryonic lethality (23), whereas region-specific deletion in the hippocampus and neocortex results in impaired spatial learning (24). Conversely, the altered function of Ca_v1.3 is linked to sinoatrial node dysfunction and deafness (25, 26), impaired consolidation of fear memory (27), autism spectrum disorders (28), and adrenal aldosterone-producing adenomas (29). However, virtually nothing is known about the individual roles of Ca_v1.2 and Ca_v1.3 during neuronal development, despite the fact that numerous pharmacological studies have demonstrated the importance of L-VGCCs for neuronal survival in vitro and in vivo (5, 30–32).

We recently reported an essential role of Ca_v1.3 in the proper development and function of auditory brainstem structures in mice; the lack of Ca_v1.3 channels results in a reduced volume of major auditory nuclei (33, 34), impaired refinement of tonotopic projections (35), and abnormal auditory brainstem responses (34). Auditory brainstem neurons express both Ca_v1.2 and Ca_v1.3 (36). Therefore, they offer an excellent opportunity to delineate the contributions of both channels to neuronal development and function. To investigate the role of Ca_v1.2, here we employed a conditional knock-out approach and deleted Cacna1c in the mouse auditory brainstem from the embryonic stages onward. This resulted in structural abnormalities of the auditory nuclei. In contrast to the scenario following Ca_v1.3 loss, auditory brainstem responses were nearly normal. Perinatal analyses revealed that Ca_v1.2 is required for early postnatal survival of auditory neurons. In summary, Ca_v1.2 and Ca_v1.3 are both essential for the integrity of the auditory brainstem but differ in their requirement for the proper physiological function of auditory neurons.

Experimental Procedures

Animals

Cacna1c^fl/fl mice (23) and the Cre-driver line Egr2::Cre (37) were described previously. Homozygous Cacna1c^fl/fl mice were crossed with mice containing the locus Egr2::Cre in the heterozygous state and the Cacna1c^fl locus in the homozygous state (Cacna1c^fl/fl). Consequently, 50% of the offspring had the genotype Egr2::Cre;Cacna1c^fl/fl (abbreviated Cacna1c^Egr2), and 50% had the genotype Cacna1c^fl/fl. The latter served as littermate controls. Mice were maintained at a C57BL/6 background, and animals of both sexes were used. The day of birth was taken as postnatal day 0 (P0). All protocols were in accordance with the German Animal Protection Law and approved by the local animal care and use committee (Landesamt für Verbraucherschutz und Lebensmittelsicherheit (LAVES), Oldenburg Regierungspräsidium (RP), Tübingen Landesuntersuchungsamt (LUA), Koblenz). The protocols also followed the National Institutes of Health guidelines for the care and use of laboratory animals.

Immunohistochemistry and Nissl Staining

Fluorescent immunohistochemistry was performed as described previously (33, 38). The antibodies applied were: polyclonal rabbit anti-VGlut1 (1:1,500, gift from Dr. S. El Mestikawy, Creteil, France), monoclonal rabbit anti-p-CREB (1:500, ID code 9198, Cell Signaling Technology, Danvers, MA), polyclonal rabbit anti-NFATc4 (1:200, HPA-031641, Sigma-Aldrich), polyclonal rabbit anti-p75NTR (1:500, AB1554, Millipore, Darmstadt, Germany), polyclonal goat anti-Sort1 (1:500, AF2934, Novus Biologicals, Littleton, CO), rabbit polyclonal anti-Iba1⁷ (1:1,000, ID code 234003, Synaptic Systems, Göttingen, Germany), mouse monoclonal anti-NeuN (1:1,000, ab104224, Abcam, Cambridge, United Kingdom), and rabbit polyclonal anti-Kcnma1 (1:200, HPA-05464, Sigma-Aldrich). Nuclear staining was carried out with TO-PRO®-3 according to the manufacturer's instructions (T3605, Molecular Probes, Waltham, MA). The specificity of the antibodies used was given by analyses and reliable information from the manufacturer: Sigma prestige antibodies anti-NFATc4 and anti-Kcnma1 were tested thoroughly by immunohistochemistry against hundreds of normal and disease tissues in the human protein atlas; anti-p-CREB was tested by Western blot analysis; the specificity of anti-p75NTR is routinely evaluated by immunoprecipitation; anti-Sort1 was tested by direct ELISA and Western blotting; and anti-Iba1 and anti-NeuN were tested by immunohistochemistry and Western blotting. Anti-p75NTR and anti-NeuN are also listed in a collection of trustworthy antibodies by the Journal of Comparative Neurology. In addition, the subcellular localization of detected proteins was taken into account and met expectations (p-CREB in the nucleus; NeuN in the nucleus of neurons, i.e. no colocalization with microglia marker Iba1; Sort1 in the Golgi complex). Antibodies were diluted as indicated in carrier solution containing 1% bovine serum albumin, 1% goat serum, and 0.3% Triton X-100 in PBS, pH 7.4. For staining with goat anti-Sort1, a carrier without goat serum was used. Free-floating 30-μm-thick cryosections were incubated overnight at 7 °C, washed three times in PBS, and incubated in carrier solution with Alexa Fluor dye-coupled secondary antibodies (diluted 1:1,000, Invitrogen) for 1 h at room temperature. Finally, slices were washed and mounted onto gelatin-coated slides. Immunohistochemistry of neonatal tissue (P0–P4) was performed on-slide. To obtain optimal staining results for p-CREB, NFATc4, Sort1, Iba1, and Kcnma1 staining, antigen retrieval was performed using standard 10 mm trisodium citrate buffer, pH 6, treatment for 2 min. Images were taken with a BZ-8100E fluorescence microscope (Keyence, Neu-Isenburg, Germany) or with a TCS SP2 confocal laser scanning microscope (Leica, Wetzlar, Germany). Files were obtained using the Keyence BZ observation software or the Leica confocal software and processed in Adobe Photoshop CS6 (Adobe Systems, San Jose, CA).

Quantification of Kcnma1 immunosignals was performed with ImageJ (National Institutes of Health). A region of interest of 70 × 70 μm was defined within the central lateral superior olive (LSO) as well as outside the superior olivary complex (SOC) for background subtraction. Gray values were calculated and statistical analysis was performed using two-tailed Student's t test after testing for Gaussian distribution of the data sets with SPSS, version 21.0 (IBM Corp.). In the case of a non-Gaussian distribution, a Mann-Whitney U test was performed.

Nissl staining was performed on consecutive 30-μm-thick sections. The volume of auditory nuclei was calculated by multiplying the outlined area with the thickness of each section. Three young adult animals (P25–P30) and two young animals (P0 and P4) were used from each genotype. Analysis was carried out blind to the respective genotype. Sections were then analyzed using ImageJ, and statistical analysis was performed as mentioned above.

Quantitative RT-PCR Analysis

SOC tissue was collected from P2 animals as described (39). Briefly, 200-μm-thick brainstem slices were used to dissect the SOC from both sides under visual inspection. Tissue was stored at −80 °C until further use. For RNA isolation, SOC tissue from five animals was pooled to obtain sufficient yield per biological replicate. Two biological replicas were prepared for each genotype. Total RNA was extracted using the innuPREP RNA mini kit (Analytik Jena, Jena, Germany). cDNA was synthesized following the protocol of the RevertAid RT kit (Fermentas, Waltham, MA). To confirm Cre-mediated deletion of exons 14 and 15 in the dissected SOC tissue of Cacna1c^Egr2 mice, RT-PCR was performed as described previously (23) with the primer pair VS11 (CTGGAATTCCTTGAGCAACCTTGT) and VS16 (AATTTCCACAGATGAAGAGGATG). GAPDH was amplified using the primers GAPDH forward (AATTTCCACAGATGAAGA GGATG) and GAPDH reverse (CTTGGCAGCACCAGTGGATG).

Quantitative RT-PCR was performed on a LightCycler 96 system (Roche) using the FastStart Essential DNA Green Master (Roche) containing SYBR Green. Primers used were as follows: RPL3 forward (GGTTTGCGCAAAGTTGCCTG), RPL3 reverse (ACCATCTGCACAAAGTGGTC), Fas forward (CCAGAAATCGCCTATGGTTG), Fas reverse (GTCATGTCTTCAGCAATTCTC), FasL forward (GACAGCAGTGCCACTTCATC), FasL reverse (ACTCCAGAGATCAGAGCGGT), p75NTR forward (AGACCTCATAGCCAGCACAG), p75NTR reverse (ACTGTAGAGGTTGCCATCAC), Sort1 forward (TTGATGACCTCAGTGGCTCAG), and Sort1 reverse (CCAAACATACTGCTTTGTGG). Each reaction was run in triplicate with the following thermocycling protocol: 95 °C for 5 min, 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s for a total of 45 cycles. Additionally, melting curves were generated to verify specificity of products. Samples were analyzed using the method of Pfaffl (40). All values were normalized to RPL3 and reported as fold change in expression of Cacna1c^Egr2 compared with Cacna1c^fl/fl. Statistical analysis was performed as mentioned above.

Extracellular Matrix Immunohistochemistry and Determination of Cell Diameters

Control and Cacna1c^Egr2 animals (P70, n = 3, 3) were perfused transcardially under deep CO₂ anesthesia with 100 ml of 0.9% NaCl and 0.1% heparin followed by 100 ml of fixative containing 4% paraformaldehyde and 0.1% glutaraldehyde in 0.1 m PBS, pH 7.4. Brains were removed from the skull and postfixed in the same fixation solution overnight. The tissue was cryoprotected in 30% sucrose containing 0.01% sodium azide. 30-μm-thick coronal sections were collected individually in PBS containing 0.1% azide. Before staining, the sections were pretreated with 60% methanol containing 1% H₂O₂ for 30 min following a blocking step with a blocking solution containing 2% BSA, 0.3% milk powder, and 0.5% donkey serum in PBS-Tween (0.05%) for 1 h. All antibodies, incubated in the same blocking solution overnight at 4 °C, were applied as follows: a polyclonal rabbit anti-aggrecan antibody (1:1,000, AB1031, Millipore) that recognizes an epitope within amino acids 1177–1326 near the central domain of aggrecan at chondroitin sulfate glycosaminoglycan binding sites (41); a monoclonal mouse anti-brevican antibody (1:1000, BDB610894 clone2, BD Biosciences), detecting a 50-kDa N-terminal fragment and full-length brevican (41); and a polyclonal sheep anti-neurocan antibody (1:1,000, AF5800, R&D Systems) recognizing full-length neurocan (42).

Visualization of primary antibodies was performed by Cy3-conjugated anti-rabbit, anti-goat, anti-sheep, or anti-mouse antibodies raised in donkeys (1:1,000, Dianova). Image stacks were taken with a BZ-9000 fluorescence microscope (Keyence). Cell diameters were determined on full focus image stacks. Based on the neurocan immunoreaction in about 10 consecutive sections, cell diameters were measured of 10 principal cells/section using the BZ analyzer software. Statistical analysis was performed with SigmaPlot 12.5 software (Systat Software GmbH) by performing a Mann-Whitney U test.

Auditory Evoked Brainstem Responses and Otoacoustic Emissions

Auditory brainstem responses (ABR) and distortion product otoacoustic emission (DPOAE) were recorded in adult mice anesthetized with a mixture of ketamine hydrochloride (75 mg/kg body weight, Pharmacia, Erlangen, Germany) and xylazine hydrochloride (5 mg/kg body weight, Bayer, Leverkusen, Germany). Electrical brainstem responses to free field click (100 μs), noise burst (1 ms), and pure tone (3 ms with 1-ms ramp) stimuli were recorded with subdermal silver wire electrodes at the ear, the vertex, and the back of the animals. After amplification and bandpass filtering (200 Hz–5 kHz), signals were averaged for 64–256 repetitions at each sound pressure level presented (usually 0–100 db SPL in steps of 5 db). Thresholds were determined by the lowest sound pressure that evoked visually distinct potentials from above threshold to near threshold. The cubic 2f1 − f2 DPOAE was measured for f2 = 1.24 × f1 and L2 = L1–10 db. Emission signals were recorded during sound presentation of 260 ms and averaged four times for each sound pressure and frequency presented. First, the 2f1-f2 distortion product amplitude was measured with L1 = 50 db SPL and f2 between 4 and 32 kHz. Subsequently, the 2f1-f2 distortion product amplitude was measured for L1 ranging from −10 to 65 db SPL at frequencies of f2 between 4.0 and 32.0 kHz.

Average ABR wave curves are presented as mean ± S.E. Peak amplitudes and latencies were collected, grouped in clusters of similar peak amplitudes and latencies, and averaged for ABR wave input-output analysis. Clusters of peaks were found at average latencies n0.9-p1.2 (wave I), n1.5-p2.2 (wave II), n2.9-p3.5 (wave III), and n3.9-p4.9 (wave IV) (n is negative peak, p is positive peak, and the number is the peak latency in ms). The differences of the mean were compared for statistical significance by Student's t test, α-levels corrected for multiple testing by Bonferroni-Holms, and two-way analysis of variance (GraphPad Prism 2.01). Statistical significance was tested at α = 0.05, and the resulting p values are reported in the text and in Fig. 8.

FIGURE 8.

Nearly normal ABRs in Cacna1c^Egr2 mice. A, ABR thresholds were invariant between Cacna1c^fl/fl (control, closed circles) and Cacna1c^Egr2 mice (open squares) for pure tone stimuli (p > 0.05, two-way analysis of variance), click stimuli (lower left corner), and noise burst stimuli (lower right corner). Mean values ± S.D. B, DPOAE thresholds for Cacna1c^fl/fl (closed circles) and Cacna1c^Egr2 mice (open squares) were not significantly different (p > 0.05, two-way analysis of variance). C, signal strength for the 2f1 − f2 distortion product at 50 db SPL f1 stimulation level was not significantly different for Cacna1c^fl/fl (closed bar) and Cacna1c^Egr2 mice (open bar, p = 0.15, one-sided t test). Emission signals of individual ears are shown as circles within each bar. D, click-evoked ABR waves (mean values ± S.E.) from Cacna1c^fl/fl (black) and Cacna1c^Egr2 (red) mice for an 86-db SPL stimulus were overlaid for comparison. The peaks corresponding to ABR wave I to wave IV are indicated. Waves are defined by their leading negative (n) and following positive (p) peak, as illustrated for wave I. ABR wave amplitudes and peak latencies differed between genotypes, and differences were most pronounced for waves II–IV. E, responsible for the changed ABR waveform in D was a larger variation of peak occurrence between 2 and 4 ms in individual Cacna1c^Egr2 mice, as indicated by the larger horizontal extension of the bar (arrows, ±1 S.D. of the ABR peak latencies from individual ears for stimulus levels between 20 and 80 db). Peaks corresponding to associated waves are connected by dashed lines. F, normal peak amplitudes in Cacna1c^Egr2 mice. Average I/O functions from control mice are shown as black lines and from Cacna1c^Egr2 mice as red lines (±S.E.).

Electrophysiology

Patch clamp recordings in the whole-cell configuration were performed in acutely prepared slices on principal LSO neurons showing an I_H current (43). Animals were decapitated at P12 ± 2, and their brains were removed quickly. Coronal brainstem slices containing the superior olivary complex (270-μm thick, 1–2 slices/animal) were cut on a vibratome (VT-1200 S, Leica) in an ice-cold preparation solution (composition in mm: NaHCO₃, 26; NaH₂PO₄, 1.25; KCl, 2.5; MgCl₂, 1; CaCl₂, 2; d-glucose, 260; sodium pyruvate, 2; myo-inositol, 3; and kynurenic acid, 1; pH 7.4 when bubbled with 95% O₂ and 5% CO₂) and then stored at 37 °C for 1 h in artificial CSF (composition in mm: NaCl, 125; NaHCO₃, 25; NaH₂PO₄, 1.25; KCl, 2.5, MgCl₂, 1; CaCl₂, 2; d-glucose, 10; sodium pyruvate, 2; myoinositol, 3; and ascorbic acid 0.44; pH 7.4 when bubbled with 95% O₂ and 5% CO₂). Thereafter, slices were stored at room temperature before being transferred into a recording chamber in which they were continually superfused with artificial CSF. The chamber was mounted on an upright microscope (Eclipse E600FN, Nikon, Tokyo, Japan) equipped with differential interference contrast optics (Nikon objectives: 4× CFI Achromat, 0.1 NA; 60× CFI Fluor W, 1.0 NA) and an infrared video camera system (CCD camera C5405-01 (Hamamatsu, Herrsching, Germany) and PC frame-grabber card, pciGrabber-4plus (PHYTEK, Mainz, Germany)). Patch pipettes were pulled from borosilicate glass capillaries (GB150(F)-8P, Science Products, Hofheim, Germany) with a horizontal puller (P-87, Sutter Instruments, Novato). They had resistances of 3–6 meghoms when filled with artificial intracellular solution (composition in mm: potassium gluconate, 140; EGTA, 5; MgCl₂, 1; HEPES, 10; Na2ATP, 2; and Na2GTP, 0.3; pH 7.2 with KOH; liquid junction potential, 15.4 mV) and connected to an EPC 10 patch clamp amplifier (HEKA Elektronik, Lambrecht, Germany). The liquid junction potential was corrected online. Sample frequency was 20 kHz, and cut-off frequency of low-pass filtering was 10 kHz. Series resistance was routinely compensated by 10–30%.

The biophysical properties of the neurons were assessed at room temperature. To analyze the passive membrane properties and spiking characteristics, recordings were performed in current clamp mode, and 200-ms-long rectangular current pulses were injected from −200 to +450 pA in 50-pA steps.

Synaptic responses were analyzed from voltage clamp recordings at a holding potential of −70 mV and nearly physiological temperature (36 ± 1 °C). To measure evoked inhibitory postsynaptic currents (eIPSCs), a theta glass electrode (TST150-6, World Precision Instruments) with a tip diameter of 10–20 μm was filled with artificial CSF and placed lateral to the medial nucleus of the trapezoid body (MNTB). Biphasic pulses (100 μs each) were applied through a programmable pulse generator (STG4004, Multi Channel Systems GmbH, Reutlingen, Germany). The amplitude of the stimulus pulses was 500–3,000 μA and was set to achieve stable synaptic responses with an amplitude jitter of <50 pA. To determine the synaptic performance of the MNTB-LSO connection and the size of the readily releasable pool, five 100-pulse trains at 100 Hz were applied with a 59-s pause between trains. The peak amplitude of the first eIPSC in a trial was set to 100% for normalization.

Miniature Events

To determine synaptic release properties, inhibitory and excitatory miniature events (mIPSCs and mEPSCs) were recorded simultaneously with 50-kHz sampling. Miniature recordings were performed in the presence of a 1 μm tetrodotoxin (Sigma-Aldrich), which was bath-applied for 5 min before 6-min recordings were obtained. Because of the ion concentrations in the artificial CSF and the artificial intracellular solution, the equilibrium potentials, E_Cl⁻ and E_Na⁺, amounted to approximately −110 and +93 mV, respectively, thus being considerably more negative and positive than the holding potential of −70 mV.

Data Analysis

The biophysical membrane properties were analyzed using pCLAMP10 (Molecular Devices, Sunnyvale, CA) and Fitmaster (HEKA Elektronik). eIPSC and eEPSC peak amplitudes were analyzed with a customized plug-in for IgorPro 6.32 (WaveMetrics, Portland, OR). mEPSC and mIPSC data analysis was performed with MiniAnalysis 6.0.3 (Synaptosoft, Decatur, GA).

Statistics

To assess statistical significance, the WinSTAT package was used (R. Fitch Software, Bad Krotzingen, Germany). Data were checked for Gaussian distribution (Kolmogorov-Smirnov) and outliers (more than 4× S.D. above or below the mean) were excluded. A two-tailed Student's t test was performed. Error bars in the diagrams illustrate S.E. Dot plots of single values are added to the bar charts in the diagrams to illustrate the distribution.

Results

Structural Abnormalities in the Adult SOC of Cacna1c^Egr2 Mice

Functional expression of Ca_v1.2 has been demonstrated previously in the auditory brainstem (36). To study the role of this channel type in the cochlear nucleus complex (CNC) and SOC, we used a recently generated Egr2::Cre;Cacna1c^fl/fl (Cacna1c^Egr2) mouse model (44) in which Cre-mediated recombination results in deletion of exons 14 and 15 of Cacna1c in rhombomeres 3 and 5 (Fig. 1A). Accordingly, mRNA containing exons 14 and 15 is undetectable in the SOC tissue (Fig. 1A, inset). This is in agreement with the lack of protein in the auditory brainstem in this mouse line (44). Taken together, these data demonstrate that the Egr2::Cre driver line very efficiently recombines the Cacna1c^fl/fl allele, which results in undetectable levels of Ca_v1.2 in auditory hindbrain neurons. In all experiments, Cacna1c^fl/fl mice served as controls.

FIGURE 1.

Normal gross morphology of CNC and SOC in Cacna1c^Egr2 mice. A, schematic drawing of the mouse lines used. Inset, RT-PCR experiments demonstrating the absence of Cacna1c exons 14 and 15 containing mRNAs in the SOC. B, VGlut1 immunoreactivity in coronal brainstem sections of P25 Cacna1c^fl/fl (i, iii, and v) and Cacna1c^Egr2 mice (ii, iv, and vi) indicating normal gross morphology of CNC and SOC nuclei. Dorsal is up, and lateral is to the right. Scale bars, 100 μm.

To investigate the functional consequences of Ca_v1.2 ablation, we probed the integrity of the young adult (P25–P30) CNC and SOC by fluorescent immunohistochemistry for VGlut1, which is strongly expressed in auditory brainstem nuclei (38, 45, 46) (Fig. 1B). No obvious alterations were detected in the CNC, and all three subdivisions, the anterior ventral cochlear nucleus (AVCN), the posteroventral cochlear nucleus (PVCN), and the dorsal cochlear nucleus (DCN) were clearly delineated (Fig. 1B, i–iv). However, quantitative analysis of Nissl-stained sections demonstrated a significant volume reduction of the AVCN by 11.9% (control, 0.142 ± 0.014 mm³; Cacna1c^Egr2, 0.125 ± 0.009 mm³; p = 0.028) and the DCN by 26.7% (control, 0.211 ± 0.017 mm³; Cacna1c^Egr22, 0.154 ± 0.014 mm³; p = 0.00042) (Table 1). No volume change was observed for the PVCN (Fig. 2A and Table 1), which is in agreement with its origin mainly from rhombomere 4 (47). Major SOC nuclei, such as the LSO or the MNTB, appeared smaller in Cacna1c^Egr2 mice compared with control littermates when labeled for VGlut1 or Nissl stained (Fig. 1B, v and vi, and Fig. 2F, i and iii). Quantitative analysis revealed a volume reduction of the LSO by 35.2% (control, 0.025 ± 0.003 mm³; Cacna1c^Egr2, 0.016 ± 0.004 mm³; p = 0.002) and the MNTB by 21.2% (control, 0.037 ± 0.006 mm³; Cacna1c^Egr22, 0.029 ± 0.003 mm³; p = 0.019) (Fig. 2A and Table 1). There was no difference between control animals and heterozygous knock-out animals with only one Cacna1c^fl allele (data not shown).

TABLE 1.

Quantification of structural changes in the three CNC nuclei and in two SOC nuclei of young adult Cacna1c^fl/fl and Cacna1c^Egr2 mice

Values are means ± S.D.

	Volume				Cell number
	Cacna1cfl/fl	Cacna1cEgr2	p value	% reduction	Cacna1cfl/fl	Cacna1cEgr2	p value	% reduction
DCN	0.2109 ± 0.0168	0.1545 ± 0.0140	0.000422	26.7
PVCN	0.0884 ± 0.0211	0.0900 ± 0.0038	0.859
AVCN	0.1416 ± 0.0136	0.1247 ± 0.0086	0.028	11.9
MNTB	0.0373 ± 0.0062	0.0294 ± 0.0032	0.019	21.2	2906.17 ± 132.36	2227.83 ± 318.81	0.001	23.3
LSO	0.0253 ± 0.0029	0.0164 ± 0.0045	0.002	35.2	1511.8 ± 158.7	704.3 ± 17.2	0.0000001	53.4

FIGURE 2.

Structural alterations in young adult auditory brainstem nuclei. A, in Cacna1c^Egr2 mice, the volume of DCN, AVCN, LSO, and MNTB was significantly decreased, whereas no changes were observed in the PVCN arising from rhombomere 4. B, LSO and MNTB of Cacna1c^Egr2 mice displayed a lower numbers of cells. C, cell diameter was reduced in MNTB neurons of Cacna1c^Egr2 mice. Determination of cell diameter in P70 MNTB neurons was performed using neurocan-labeled cells (see Fig. 3). 449 (Cacna1c^fl/fl) and 454 (Cacna1c^Egr2) cells from three animals were analyzed. D, volume of CNC nuclei was analyzed in P25 Nissl-stained parasagittal section series (5 or 6 nuclei from 3 animals). E, volume and cell number of SOC nuclei were analyzed in P25 Nissl-stained coronal sections (six nuclei from three animals). As a test for statistical significance, Student's t test (volume and cell number) or Mann-Whitney U test (diameter) was used. Color coding: black = control Cacna1c^fl/fl mice; red = Cacna1c^Egr2mice. *, p ≤ 0.01; **, p ≤ 0.05; ***, p ≤ 0.001; ns, not significant. F, representative examples of the morphological changes in Cacna1c^Egr2 mice. In Nissl-stained sections the MNTB appears more stretched and narrowed compared with slices of control mice (i and iii, scale bars = 200 μm). Single MNTB cells of Cacna1c^Egr2 mice are also clearly smaller in aggrecan-stained specimens (ii and iv, scale bars = 20 μm). Dorsal is up, and lateral is to the right with the exception of D, where dorsal is up, and caudal to the right.

Because the strongest volume decrease was observed in the SOC, we focused our subsequent analyses on this structure. Cell counts revealed that the decreased volume in the LSO and MNTB was due to a reduced number of neurons (LSO: control, 1,511.8 ± 158.7; Cacna1c^Egr2, 704.3 ± 17.2 (−53.4%), p = 10⁻⁷_; MNTB: control, 2,906.17 ± 132.36; Cacna1c^Egr2, 2,227.83 ± 318.81 (−23.3%), p = 0.001) (Fig. 2B and Table 1). Furthermore, analysis of the soma size of MNTB neurons revealed a slight but significant 8% reduction in cell diameter (control, 17.4 ± 3.8 μm; Cacna1c^Egr2, 16.0 ± 3.01 μm; p = 0.001, Mann-Whitney U test) (Fig. 2C). This reduction was also visible in aggrecan-immunopositive MNTB neurons (Fig. 2F, ii and iv). Taken together, these anatomical data indicate a crucial role of Ca_v1.2 in the proper formation of the mature CNC and SOC. Significantly, the structural phenotype resembles the changes reported after the loss of Ca_v1.3, and again, the SOC was affected more heavily than the CNC (33, 34).

Immunohistochemical Analysis of the Extracellular Matrix in Cacna1c^Egr2 Mice

Previous studies have revealed the prominent appearance of perineuronal nets (PNs) around the soma of virtually every principal MNTB neuron (41), in agreement with the high expression of genes encoding the proteoglycans brevican, aggrecan, and versican, hyaluronan and proteoglycan link protein 1, and tenascin R in the developing SOC (48, 49). As the extracellular matrix of PNs is assumed to be involved in Ca²⁺ signaling, diffusion, and channel activity (50–52), and as VGCCs have been implicated in the formation of PNs (53), we analyzed the expression of the major proteoglycans, aggrecan, brevican, and neurocan, in the MNTB at P70. At this age, PNs are fully developed, and any alteration should therefore clearly be recognizable. All three PN components strongly decorated MNTB neurons in both control animals and Cacna1c^Egr2 mice (Fig. 3). No difference was obvious between genotypes. These data suggest that the formation of PNs around MNTB neurons is independent of the presence of Ca_v1.2.

FIGURE 3.

Normal PN formation in Cacna1c^Egr2 mice. Immunoreactivity of the MNTB for the proteoglycans aggrecan (ACAN), brevican (BCAN), and neurocan (NCAN). Insets depict single representative MNTB neurons. No differences were observed in PN composition or structure between Cacna1c^Egr2 mice and littermate controls. Dorsal is up, and lateral is to the left. Scale bars, 50 μm; in insets, 10 μm.

Half-width of Action Potentials Is the Only Altered Biophysical Property of LSO Neurons in Cacna1c^Egr2 Mice

To assess whether loss of Ca_v1.2 affects the functional characteristics of LSO neurons, several biophysical properties were analyzed. For this purpose, we performed current clamp recordings in acute slices of P12 ± 2 control and Cacna1c^Egr2 mice and determined passive and active membrane properties. The resting membrane potential (V_rest) did not differ between genotypes. Likewise, there was no difference in the input resistance, the membrane time constant, and the membrane capacitance (Table 2). Depolarizing current pulses of sufficient amplitude elicited action potentials in both genotypes in which the overshooting peak amplitudes did not differ (Fig. 4, A and B, and Table 2). Likewise, both genotypes displayed similar firing thresholds (Fig. 4, A and C, and Table 2), and similar afterhyperpolarization amplitudes (Fig. 4D and Table 2). The 0–63% rise time of responses to subthreshold depolarizations also did not differ (Table 2). However, a significant difference between genotypes was observed in the half-width of the action potentials, which was 17% narrower in the knockouts (Fig. 4, A and E, and Table 2). To check whether this change was associated with an altered expression of Ca²⁺-activated potassium channels of the BK type, we probed expression of Kcnma1 in the LSO at P12. Kcnma1 represents the pore-forming α-subunit (54). Immunohistochemistry revealed low expression (Fig. 5A) with no quantitative difference between genotypes (Fig. 5B, control, 2.01 ± 0.25; Cacna1d^Egr2, 2.04 ± 0.31). The low abundance of Kcnma1 is in agreement with immunohistochemical results in the mouse auditory system (54) and argues against an important role for this protein in shaping the action potentials in this nucleus.

TABLE 2.

Biophysical properties of Cacna1c^fl/fl and Cacna1c^Egr2 mice

Values are means ± S.E. Action potential (AP) properties (rows 4–8) are measured at the first appearing action potential. V_rest, resting membrane potential; pF, picofarad.

	Cacna1cfl/fl	Cacna1cEgr2	p value
Number of cells	20	22
Input resistance (megohms)	44.3 ± 2.8	47.0 ± 3.3	0.27
Vrest (mV)	−71.2 ± 1.3	−71.9 ± 1.0	0.66
Firing onset (ms)	33.2 ± 0.4	32.8 ± 0.2	0.83
Firing threshold (mV)	−46.1 ± 1.6	−44.4 ± 1.4	0.43
Peak amplitude (mV)	20.8 ± 3.8	26.3 ± 2.6	0.22
Half-width (ms)	0.6 ± 0.06	0.5 ± 0.03	0.03
Afterhyperpolarization (mV)	−63.6 ± 2	−59.9 ± 1.6	0.15
Capacitance (pF)	25.7 ± 1.3	26.3 ± 1.2	0.71
Membrane time constant (ms)	0.5 ± 0.08	0.7 ± 0.07	0.2
0–63% rise time (ms)	2.6 ± 0.2	2.6 ± 0.2	0.7
Single firing (%)	76.4	81.3
Multiple firing (%)	23.6	18.7
Number of AP elicited by 500 pA current injection	14.7 ± 3.3	10.6 ± 6.2	0.5

FIGURE 4.

Narrowed half-width of spikes in LSO neurons of Cacna1c^Egr2 mice. A, exemplary traces of first evoked spikes of a Cacna1c^fl/fl (black) and a Cacna1c^Egr2 (red) in response to a +100 pA rectangular current injection illustrating the analyzed parameters. Peak amplitude (B), firing threshold (C), and afterhyperpolarization (D) did not differ significantly between genotypes. E, in contrast, there was a significant difference in the half-width, which was narrowed by 17% in Cacna1c^Egr2 mice. *, p < 0.05; **, p < 0.01; ***, p < 0.001; two-sided Student's t test. ns, not significant. F, exemplary traces of evoked single and multiple firing LSO neurons in both Cacna1c^fl/fl (black) and Cacna1c^Egr2 (red) upon rectangular current injection of +500 pA for 200 ms. G, the great majority of LSO neurons fired a single spike during a 200-ms-long depolarizing pulse, independent of the genotype. Solid bar, single firing neurons; dashed bar, multiple firing neurons. H, the number of action potentials elicited upon increasing the current injections did not differ significantly between genotypes.

FIGURE 5.

No changes in Kcnma1 immunoreactivity in the LSO of Cacna1c^Egr2 mice. A, immunohistochemistry for Kcnma1 in the LSO of Cacna1c^Egr2 (i) and control mice (ii) at P12. Dorsal is up, and lateral is to the left. Scale bars: 50 μm. B, quantification of the Kcnma1 signal in the LSO relative to fluorescence outside the SOC area (mean ± S.D., 8–10 LSO slices from two animals for each genotype). No difference in relative intensities was observed between the two genotypes. As a test for statistical significance, Student's t test was used. Black, control Cacna1c^fl/fl mice; red, Cacna1c^Egr2 mice. Dorsal is up, and lateral is to the right.

In mice lacking Ca_v1.3, the majority of LSO neurons display a multiple firing pattern during depolarizing pulses, in contrast to the controls (33). We also analyzed the firing pattern in Cacna1c^Egr2 mice (Fig. 4F). Independent of the genotype, the majority of neurons fired a single action potential (Fig. 4G and Table 2), and consequently, multiple spiking was less abundant. Finally, the input-output curves of the few multiple firing neurons did not display significant differences (Fig. 4H). This implies that the firing pattern in response to current pulses of varying amplitude was unaltered upon Ca_v1.2 deletion. Together, these data reveal different requirements of Ca_v1.3 and Ca_v1.2 for the maturation of the biophysical parameter in principal LSO neurons.

Unaltered Neurotransmission to the LSO in Cacna1c^Egr2 Animals

In a next series of experiments, we analyzed excitatory and inhibitory neurotransmission to LSO neurons. To do so, miniature postsynaptic currents were recorded over a period of 6 min during which several parameters were analyzed (Fig. 6 and Table 3). Neither in the excitatory nor the inhibitory inputs could we find a change in the amplitude of miniature currents (Fig. 6, A–C, and Table 3). Likewise, the frequency, rise time, and decay time of mEPSCs and mIPSCs were unaltered (Fig. 6, D–I, and Table 3). Together, these results are suggestive of unchanged transmitter vesicles in the presynaptic axon terminals and unchanged postsynaptic transmitter composition.

FIGURE 6.

Spontaneous synaptic release was not altered in LSO neurons of Cacna1c^Egr2 mice. A, exemplary traces of 1-s recordings at a holding potential of −70 mV of Cacna1c^fl/fl (black) and a Cacna1c^Egr2 (red). Spontaneous excitatory miniature events (mEPSC) are indicated by solid arrowheads, spontaneous inhibitory miniature events (mIPSC) are marked by open arrowheads. Cumulative occurrence of mEPSC amplitude (B), mIPSC amplitude (C), mEPSC instantaneous frequency (D), mIPSC instantaneous frequency (E), mEPSC rise time (F), mIPSC rise time (G), mEPSC decay time (H), and, mIPSC decay time (I) was not changed between genotypes. Insets show relative occurrence and mean values of each parameter. ns, not significant.

TABLE 3.

Properties of excitatory and inhibitory miniature events in Cacna1c^fl/fl and Cacna1c^Egr2 mice

Values are means ± S.E.

	Cacna1cfl/fl	Cacna1cEgr2	p value
Number of cells	28	48
mEPSC amplitudes (pA)	24.0 ± 1.8	23.1 ± 1.3	0.72
mIPSC amplitudes (pA)	26.1 ± 3.1	24.1 ± 1.8	0.56
mEPSC events/s	2.5 ± 0.7	1.0 ± 0.2	0.09
mIPSC events/s	2.0 ± 0.9	1.0 ± 0.2	0.33
mEPSC rise time (ms)	0.7 ± 0.04	0.7 ± 0.02	0.17
mIPSC rise time (ms)	0.7 ± 0.03	0.8 ± 0.04	0.16
mEPSC decay time (ms)	0.7 ± 0.02	0.7 ± 0.04	0.71
mIPSC decay time (ms)	1.1 ± 0.07	1.1 ± 0.05	0.31

Finally, we analyzed the inhibitory neurotransmission between MNTB and LSO in acute slices upon electrical stimulation of the MNTB axons. Mean peak amplitudes of eIPSCs were 515 ± 100 pA in controls and 640 ± 110 pA in Cacna1c^Egr2 mice, and these did not differ significantly from each other (Table 4). Upon high-frequency stimulation (100-Hz trains of 100 pulses), short-term depression was observed in both genotypes, and the time course was virtually the same (Fig. 7A). The amount of depression was ∼60% for both control and knock-out mice, and the last peak amplitude in the train reached similar values (Fig. 7B and Table 4). From the high-frequency stimulation experiments, we also determined the size of the readily releasable pool and the release probability. We found no differences between genotypes (Fig. 7C and Table 4), which is indicative of an unaltered presynaptic release machinery in the MNTB axon terminals upon loss of Ca_v1.2.

TABLE 4.

Properties of short-term synaptic depression in Cacna1c^fl/fl and Cacna1c^Egr2 mice

Values are means ± S.E. RRP, readily releasable pool.

	Cacna1cfl/fl	Cacna1cEgr2	p values
Number of cells	12	15
First eIPSC amplitude (pA)	515 ± 100	640 ± 110	0.42
Last eIPSC amplitude (pA)	175 ± 37	211 ± 42	0.54
RRP size (nA)	3.5 ± 0.6	5.8 ± 1.3	0.21
Release probability (%)	14.5 ± 0.8	13.3 ± 1.0	0.98

FIGURE 7.

Short-term synaptic depression did not differ between LSO neurons of Cacna1c^fl/fl and Cacna1c^Egr2 mice. A, course of depression of normalized mean eIPSC amplitudes of Cacna1c^fl/fl (black) and a Cacna1c^Egr2 (red) LSO neurons was not altered upon 100-Hz stimulation for 1 s. Solid lines show individual cells, two for each genotype. Raw traces of the first and last five eIPSC amplitudes also show no obvious difference among the groups. B, the first and last eIPSC amplitude did not differ significantly between genotypes. C, cumulative eIPSC amplitude with back-extrapolated linear fits (dotted gray line (102)). Insets show that no differences in the size of the readily releasable pool (RRP) or the release probability were observed. ns, not significant.

Nearly Normal Auditory Brainstem Responses in Cacna1c^Egr2 Animals

We next assessed the functional consequences of the loss of Ca_v1.2 for acoustic information processing. To do so, we analyzed ABRs and DPOAE. ABR thresholds for pure tone, click, and noise burst stimuli as well as DPOAE thresholds and amplitudes were similar for Cacna1c^Egr2 and control animals (Fig. 8, A–C), demonstrating normal hearing sensitivity of the inner ear in Cacna1c^Egr2 mice. Next, ABR waves (peak amplitudes and latencies) were analyzed, which are a characteristic sequence of negative (n) and positive (p) deflections (peaks), with each pair of n and p referred to as a wave (waves I–V). The summed activity of the auditory nerve gives rise to wave I, whereas wave II reflects the response of globular bushy cells in the CNC. Wave III originates mainly in the CNC and SOC. Finally, the lateral lemniscus and inferior colliculus appear to contribute to waves IV and V (55, 56). At 86 db SPL, ABR waves III and IV appeared to have smaller amplitudes in Cacna1c^Egr2 animals than in controls when averaged across five animals (Fig. 8D). Fine analyses revealed that this difference was due to a significant increase in the interindividual variation of the latency of the negative peaks III and IV (Fig. 8E). When each animal was analyzed separately, no difference in amplitude was observed compared with control animals (Fig. 8F). These data indicate a higher interindividual variability in the conductance or wiring of the central auditory circuitry in the absence of Ca_v1.2 but otherwise normal ABRs. The results are in contrast to the findings in Cacna1d^Egr2 mice, which showed a decreased amplitude for wave I between 50 and 75 db and increased amplitudes for waves II and III for stimulation amplitudes above 60 db (34). Thus, they point to distinct functions of Ca_v1.2 and Ca_v1.3 regarding the processing of acoustic information in the auditory brainstem.

Loss of Ca_v1.2 Causes Early Postnatal Death of SOC Neurons

Our anatomical analysis of the SOC in young adult Cacna1c^Egr2 mice revealed a dramatic reduction in cell number. In mice, SOC neurons are born between embryonic days 9 and 14 (57) and have completed their migration by birth (58). Therefore, the observed reduction in neuron number may be due to defects in cell birth, migration, or postmigratory survival of neurons. To assess which of these steps requires Ca_v1.2, we analyzed the MNTB at P0, as this nucleus is the only clearly recognizable SOC structure in Nissl-stained sections at this age. Quantitative analysis revealed a trend to a decreased nuclear volume (control, 0.013 ± 0.0009 mm³; Cacna1c^Egr2, 0.011 ± 0.0007 mm³; p = 0.241) and a small, albeit significant decrease in the neuron number of Cacna1c^Egr22 mice (control, 1,771 ± 94; Cacna1c^Egr2, 1,596 ± 23; p = 0.041) (Fig. 9 and Table 5).

FIGURE 9.

Rapid postnatal loss of MNTB neurons in Cacna1c^Egr2 mice. Volume and cell number were determined at P0 (A) and P4 (B) from Nissl-stained serial sections (four nuclei from two animals). A highly significant decrease in volume and cell number was observed in Cacna1c^Egr2 mice at P4 but not at P0. Black, control Cacna1c^fl/fl mice; red, Cacna1c^Egr2 mice. As a test for statistical significance, Student's t test was used. *, p ≤ 0.01; ***, p ≤ 0.001; ns, not significant.

TABLE 5.

Quantification of structural changes in the MNTB of neonatal Cacna1c^fl/fl and Cacna1c^Egr2 mice

Values are means ± S.D.

	Volume				Cell number
	Cacna1cfl/fl	Cacna1cEgr2	p value	% reduction	Cacna1cfl/fl	Cacna1cEgr2	p value	% reduction
P0 MNTB	0.013 ± 0.0009	0.011 ± 0.0007	0.241	15.4%	1771 ± 94	1596 ± 23	0.041	9.9%
P4 MNTB	0.021 ± 0.0006	0.013 ± 0.0002	0.0000001	39.0%	2041 ± 91	1217 ± 59	0.000005	40.4%

As reported previously, ablation of Ca_v1.3 results in an abnormal LSO structure, which is observed already at P4 (33, 34). To investigate whether Ca_v1.2 is similarly required during early postnatal differentiation, we analyzed the MNTB at P4 as well. Quantitative analysis of Nissl-stained sections revealed significant differences in volume (control, 0.021 ± 0.001 mm³; Cacna1c^Egr2, 0.013 ± 0.0002 mm³; −39%, p = 10⁻⁷) and neuron number (control, 2,041 ± 91; Cacna1c^Egr2, 1,217 ± 59; −40.4%, p = 5 × 10⁻⁶, Fig. 9 and Table 5). The drastic decline of ∼40% in the neuron number between P0 and P4 reveals that MNTB neurons heavily depend on L-VGCC-mediated signaling for survival during the first postnatal days in mice. This time period occurs soon after circuit formation, which allows spontaneous activity arising in the cochlea to spread along the auditory pathway (59–61).

Analyses of Candidate Pathways for Increased Postnatal Death of SOC Neurons

The cAMP response element-binding protein (CREB) has been widely implicated in the survival of neurons and is activated by L-VGCCs (62–65). Of note, in the AVCN, deafferentation sharply increases the amount of phosphorylated CREB (p-CREB), likely triggering a pro-survival signaling cascade (66). To study whether the phosphorylation of CREB was also increased in auditory brainstem neurons lacking Ca_v1.2, we performed immunohistochemical analyses of p-CREB in the DCN, PVCN, AVCN, LSO, and MNTB at P0 and P4 (Fig. 10, shown for the MNTB). p-CREB displays a dynamic pattern during perinatal development, but no difference was observed between both genotypes (Fig. 10). The lack of any differences in p-CREB labeling between control and Cacna1c^Egr2 mice argues against a role for this protein in the survival of Ca_v1.2-deprived auditory neurons. This conclusion is supported by the significant cell loss in the MNTB and DCN, despite considerable p-CREB expression.

FIGURE 10.

No change in p-CREB immunoreactivity in Cacna1c^Egr2 mice. Shown is the immunohistochemistry of p-CREB in the MNTB of control (i and iii) and Cacna1c^Egr2 mice (ii and iv) at P0 and P4. The labeling intensity of the other auditory nuclei is documented in the lower panel. At P0, strong p-CREB immunoreactivity was observed in the AVCN and MNTB, whereas the DCN, PVCN, and LSO were moderately labeled. At P4, strong labeling persisted in the MNTB and moderate labeling in the DCN, whereas the AVCN, PVCN, and the LSO showed decreased p-CREB immunoreactivity. No differences were observed between control and Cacna1c^Egr2 mice. Dorsal is up, and lateral is to the right. Scale bars, 100 μm; for inserts, 20 μm.

A signaling cascade involved in deafferentation-associated cell death in the auditory brainstem involves NFATc4, the death receptor Fas, and its ligand, FasL. NFATc4 displayed an increased nuclear localization and FasL an increased expression in mice during deafferentation-induced cell death via immunohistochemistry and semiquantitative RT-PCR, respectively (67). To probe this pathway, we performed similar experiments. Immunohistochemical studies revealed no change in the subcellular localization of NFATc4 between Cacna1c^Egr2 mice and control littermates (Fig. 11A, i–iv, shown for MNTB). Furthermore, quantitative RT-PCR experiments revealed no up-regulation of FasL or Fas in the P2 SOC (Fig. 11B, FasL, 1.06 ± 0.24-fold change; Fas, 1.17 ± 0.09-fold), suggesting that this signaling pathway does not underlie increased cell death in Cacna1c^Egr2 mice.

FIGURE 11.

No changes in signaling pathways associated with cell death in Cacna1c^Egr2 mice at P2. A, immunohistochemistry of NFATc4 (i–iv; green = NFATc4, blue = TO-PRO-3), p75NTR (v–viii), Sort1 (iv–xii), and Iba1 (xiii and xiv; green = Iba1, red = NeuN) in the MNTB of control (i/ii, v/vi, iv/x, and xiii) and Cacna1c^Egr2 mice (iii/iv, vii/viii, xi/xii, and xiv). For all investigated proteins there was no difference in the staining pattern, subcellular localization, or intensity between the two genotypes. Dorsal is up, and lateral is to the right. Scale bars, 50 μm (i, iii, v, vii, iv, xi, xiii, and xiv) and 20 μm (ii, iv, vi, viii, x, and xii). B, mean fold change ± S.E. in gene expression revealed by qRT-PCR for p75NTR, Sort1, Fas, and FasL. No significant up- or down-regulation of these gene products was observed in Cacna1c^Egr2 mice. C, quantification of Iba1-positive cells in the MNTB of Cacna1c^fl/fl and Cacna1c^Egr2 mice (mean ± S.E.). Analysis of 36 MNTB slices of three Cacna1c^Egr2 mice and 24 MNTB slices of three control mice revealed no difference in the number of Iba1-positive cells. Student's t test was used to test for statistical significance.

We next focused on neurotrophins, as they play an important role in neuronal survival (68). Previous studies in the developing auditory brainstem reveal that BDNF and NT3 and their high-affinity tyrosine kinase receptors TrkB and TrkC start to be expressed from P3 onwards (69, 70). TrkA is not expressed at all (70). In contrast, p75NTR is expressed already in the perinatal auditory brainstem and present even at late embryonic stages (71). This makes p75NTR the most promising candidate for study, as it is present during the occurrence of cell death in Cacna1c^Egr2 mice. Furthermore, in association with Sort1, this neurotrophin receptor promotes cell death (68). We focused on the SOC, as its nuclei exhibited the strongest cell loss. Immunohistochemical analysis of p75NTR and Sort1 showed no difference in abundance between Cacna1c^Egr2 mice and control littermates (Fig. 11A, v–viii and iv–xii). This was confirmed on the mRNA level by quantitative RT-PCR analysis of P2 SOC tissue (Fig. 11B, -fold change p75NTR, 0.93 ± 0.11-fold change; -fold change Sort1, 0.89 ± 0.39-fold).

Finally, we analyzed the expression of Iba1, a marker for activated microglia (72). Microglia play an important role in controlled phagocytosis during development but are also highly activated during pathological cell loss, as shown for retinal degeneration (73) and neurodegenerative diseases (74). Quantitative immunohistochemical analysis demonstrated no change in the number of Iba1-positive cells in the P2 MNTB (Fig. 11A, xiii and xiv; Fig 11C, control, 5.83 ± 0.5; Cacna1c^Egr2, 4.58 ± 0.48). Together, these data imply the operation of other cell death-triggering pathways in Cacna1c^Egr2 mice than observed after deafferentation. Alternatively, the lack of a precisely timed intervention, a hallmark of deafferentation protocols, might impair the detection of alterations in signaling cascades, which often are short-lived.

Discussion

Our study demonstrates that lack of Ca_v1.2 causes neuronal loss and volume reduction of auditory brainstem nuclei, similar to the defects seen when Ca_v1.3 is absent. Thus, Ca_v1.2 and Ca_v1.3 have a common function concerning the survival of auditory neurons. Nevertheless, each channel type cannot compensate the loss of its paralogous protein. In contrast to Ca_v1.3, the deletion of Ca_v1.2 narrows the spike width. However, absence of Ca_v1.2 does not appear to alter the other biophysical properties and basic aspects of synaptic transmission. In addition, it only marginally affects ABRs. We identified P0–P4 as the period in which a significant number of auditory brainstem neurons are lost in the absence of Ca_v1.2. Finally, we observed no differences in several signaling cascades associated with neuronal cell death in Cacna1c^Egr2 mice.

The Role of Ca²⁺ in a Life-or-Death Decision in the Auditory Brainstem

Our study has established a critical role of Ca_v1.2 in maintaining the integrity of auditory brainstem centers. We observed a volume decrease between 11.9% (AVCN) and 35% (LSO) in Cacna1c^Erg2 mice due to post-migratory cell death (Figs. 2 and 9). Hence, both neuronal L-VGCCs are required for auditory brainstem integrity, as Cacna1d^−/− mice (33) and Cacna1d^Egr2 mice (34) also showed significant volume decreases and neuronal loss. A role for both channel types in neuronal survival was also suggested for spiral ganglion neurons, based on histological analyses of 2- and 4-month-old Cacna1d^−/− or heterozygous Cacna1c^+/− mice (75). Of note, auditory neurons show a bimodal reaction upon disturbed synaptic signaling, as part of the auditory brainstem neurons is able to survive, whereas a significant number undergo cell death (76). This is in agreement with previous reports on deafferented auditory neurons (77, 78). Indeed, the first report dates back to 1949, when Levi-Montalcini (79) described significant neuronal loss in auditory brainstem structures upon otocyst extirpation in the chick embryo.

The in vivo signaling pathways involved in the survival of auditory neurons have remained largely unknown. Our data demonstrate for the first time in vivo that L-VGCC-mediated Ca²⁺ signaling is required for the postmigratory integrity of auditory nuclei. A comparison of our data with previous studies, however, indicates an ambivalent role for Ca²⁺ signaling. In the AVCN of cochlea-deprived animals, cell death is triggered by a hypercalcemic condition caused by an increased Ca²⁺ influx through AMPA receptors (66, 67, 76), likely potentiated by L-VGCCs (76, 80). Our results in Cacna1c- or Cacna1d-deficient mice demonstrate the in vivo importance of Ca²⁺ entry via L-VGCCs as a survival-promoting signal (this study and Ref. 33, 34). These partially opposing findings may be reconciled by the fact that auditory brainstem neurons appear to be very sensitive to the optimal range of Ca²⁺ influx (30, 81). The survival of rat SOC slice cultures depended on depolarization by 25 mm K⁺ in the medium in order to open L-VGCCs, whereas 40 mm K⁺ was detrimental. This demonstrates a narrow window for pro-survival Ca²⁺ signaling in auditory neurons, in agreement with results obtained in other neuronal systems (82, 83). The importance of the intracellular Ca²⁺ homeostasis is supported by the developmentally regulated expression pattern of the Ca²⁺-buffering proteins calbindin, calretinin, and parvalbumin in the auditory brainstem (84, 85) and changes therein upon altered neuronal activity (86).

Downstream Signaling of L-VGGCs

Deafferentation studies have linked cell survival in auditory brainstem nuclei to the transcription factor p-CREB (66) and cell death to NFAT4c signaling (67). Our immunohistochemical analysis of either of these pathways revealed no difference between control and Cacna1c^Erg2 mice (Figs. 10 and 11). Two explanations may account for this discrepancy. Deafferentation represents an unnatural condition that might trigger both physiological and nonphysiological responses. Secondly, deafferentation provides a precise time point, and the reported alterations in p-CREB and NFATc4 were observed only during a narrow time window of about 1 h. Such a sharp window for the majority of neurons might not be present in Cacna1c^Erg2 mice, as the trigger for the respective signaling cascade likely shows a high intercellular variety. The time period of the altered signaling pathways might be, for instance, a function of the precise time of innervation during development, which differs for individual neurons.

Alternatively, disrupted BDNF signaling was proposed to cause the cell death of deafferented MNTB neurons (77). Of note, L-VGCC-mediated signaling has been tightly linked to BDNF expression (87–89). However, BDNF (69) and its major receptor TrkB (70) are barely expressed at P0 throughout the auditory brainstem, and their expression increases up to P15, implying a role during the maturation of auditory neurons. Similar results have been obtained for NTF3, NTF4, and TrkC (70, 69). We therefore focused on p75NTR and Sort1, as both together can promote cell death. Both on the mRNA and protein level, no difference between the two genotypes was observed, arguing against a role for this pathway in the observed cell death. Yet, it is not excluded that lack of Ca_v1.2 causes the release of proneurotrophins, which then activate p75NTR-coupled apoptotic pathways. It might therefore still be worthwhile to cross Cacna1c^Erg2 mice with available p75NTR null mice (90).

Circuit Formation and Neonatal Cell Loss

Our anatomical analysis revealed a considerable decline in the number of MNTB neurons between P0 and P4 in Cacna1c^Erg2 mice, which corresponds well with the time period observed in Atoh1^Erg2 mice (91). In these animals, the number of MNTB neurons decreases to 50% of the control value by P3 and to 30% by P7, with no further decline thereafter. Developing MNTB neurons become functionally innervated in the mouse at embryonic day 17 (E17), immediately after migration and ∼2 days prior to birth (92). In addition, spontaneous EPSCs can be recorded from MNTB neurons at E17, in agreement with spontaneous activity originating in the cochlea prior to hearing onset (59, 60). Taken together, our data identify a neonatal period directly after functional circuit formation, during which auditory brainstem neurons appear to depend on synaptic signaling involving L-VGCCs. Of note, inhibitory neurotransmitters cause depolarization of auditory neurons during this perinatal period (93–96), enabling “inhibitory” projections to execute pro-survival signaling through L-VGCCs. The precise closing of this period of vulnerability, however, has yet to be determined. Experiments in gerbils demonstrate a sharp border between P7 and P9 with respect to survival of AVCN neurons following deafferentation (97).

Different Impact of Ca_v1.2 and Ca_v1.3 Signaling on Biophysical Properties of Auditory Brainstem Neurons

Lack of Ca_v1.2 affects spike shape in an opposite way than lack of Ca_v1.3. Whereas LSO neurons of Cacna1c^Egr2 mice exhibit a 17% narrower half-width, spikes are wider by 40% in Cacna1d knock-out mice (33). To investigate the underlying mechanism, we examined the expression of BK channels. However, immunohistochemistry revealed no quantitative or qualitative differences between the two genotypes (Fig. 5). The sparse expression of Kcnma1 further argues against a major contribution of BK channels to the spike shape of LSO neurons. Therefore, additional studies will be needed to investigate the underlying mechanism of narrower action potentials in these mice, which will likely involve altered expression of voltage-gated Na⁺ or K⁺ channels (98).

Notable are the many unchanged electrophysiological properties of surviving neurons in Cacna1c^Egr2 mice. Apparently, Ca_v1.2 is required mainly for cell survival, or compensatory mechanisms enable nearly normal development of those neurons that survive.

Another notable difference between Cacna1c^Egr2 and Cacna1d^Egr2 mice is demonstrated by the ABRs. Cacna1d^Egr2 animals display a higher excitation in auditory brainstem nuclei, whereas ABR thresholds and amplitudes are nearly normal in Cacna1c^Egr2 mice (Fig. 8). As a corollary, these nearly normal ABRs in mice with reduced volumes of the auditory brainstem nuclei (up to 35%) illustrate that ABR amplitudes do not mirror such brainstem abnormalities. In concordance with the difference in ABRs of Cacna1c^Egr2and Cacna1d^Egr2 mice is the altered spiking behavior of LSO neurons in Cacna1d^Egr2, which was not observed in Cacna1c^Egr2animals. Whereas the majority of Ca_v1.2-deficient LSO neurons fire a single action potential, most Ca_v1.3-deficient neurons fire multiple times.

The stronger auditory phenotype in Cacna1d^Egr2mice compared with Cacna1c^Egr2 mice might be attributed to a stronger contribution of the Ca_v1.3 channels (30%) to a total Ca²⁺ influx in perinatal LSO neurons compared with Ca_v1.2 (6%) (36). Furthermore, Ca_v1.3 channels open at more negative membrane potentials than Ca_v1.2 channels (99, 100). In postsynaptic neurons, this may trigger Ca²⁺ influx more readily during the period of spontaneous activity. Moreover, this Ca²⁺ influx and the associated depolarization may facilitate the opening of Ca_v1.2 channels. If so, Cacna1d^Egr2 mice suffer not only from a lack of Ca²⁺ entry through Ca_v1.3 channels but also from impaired opening of Ca_v1.2 channels.

Finally, the more severe central auditory phenotype in Ca_v1.3 knock-out mice, together with a pivotal role for this channel at the inner hair cell synapses, reveals an intriguing recruitment of this channel to the auditory system during evolution (101). This is in contrast to most other brain areas, where Ca_v1.2 is the predominant form (3).

In conclusion, our data demonstrate overlapping as well as distinct functions for Ca_v1.2 and Ca_v1.3 in the developing auditory brainstem. Despite their co-expression in auditory neurons, both channel types are required for neuronal survival and cannot substitute for one another. This is also indicated by their differing impact on the signal processing and firing behavior of auditory neurons.

Author Contributions

H. G. N. conceived and coordinated the study. L. E. designed, performed, and analyzed the experiments shown in Figs. 1, 2, 5, 10, and 11. S. V. S. initiated the analysis of the mouse model, contributed to Fig. 2, and performed and analyzed the experiment shown in Fig. 9. E. F. designed the experiments in Figs. 4, 6, and 7, which were performed by K. J. with the help of D. G. L. R. and M. K. designed, performed, and analyzed the experiments shown in Fig. 8. M. B. and M. M. designed, performed, and analyzed the experiments shown in Fig. 3. Finally, F. H. contributed the floxed mice. All authors reviewed the results and approved the final version of the manuscript.