Abstract
The complete mitogenome (NC_021119) of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae) was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119). Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.
Keywords: Ussurian tube-nosed bat, Murina ussuriensis, Chiroptera, tRNA secondary structure
| Specifications | |
|---|---|
| Organism/cell line/tissue | Murina ussuriensis/wing membrane |
| Sex | Male |
| Sequencer or array type | Applied Biosystems 3730 DNA Analyzer |
| Data format | Processed |
| Experimental factors | Whole mitochondrial genome of bat wing membrane |
| Experimental features | Secondary structure of 22 mitochondrial tRNA genes |
| Consent | n/a |
| Sample source location | Hongchun-gun, Gangwon Province, Republic of Korea |
1. Direct link to deposited data
2. Experimental design, materials and methods
2.1. Sample collection and DNA extraction
Murina ussuriensis (Ussurian tube-nosed bat), a species of bats in family Vespertilionidae, is distributed in the Korean peninsula, Japan, and southeastern Siberia and Sakhalin of Russia [2]. An individual of M. ussuriensis was captured using Mist-net (Avinet, USA) in mountain forests (Hongchun-gun, Gangwon, South Korea) and a small tissue punched from wing membrane was stored at − 40 °C. Total genomic DNA was extracted from the tissue sample using the DNeasy® Blood & Tissue Kit (Qiagen, Valencia, CA, USA), according to the manufacturer-supplied protocols.
The complete mitochondrial genome of M. ussuriensis, which has described in recent our publication [1], was obtained using the 29 primer sets (Table 1), based on previously published mitochondrial genomes of Myotis formosus [3] and Rhinolophus ferrumequinum [4], [5]. The neighboring primers were designed so that some portions of 5′-terminal and 3′-terminal parts of the amplified-neighboring fragments could overlap each other (Table 1).
Table 1.
Sequences of PCR primers used to amplify the complete Murina ussuriensis mitogenome.
| Primer name | Primer sequence (5′ → 3′) | Amplification position | Reference |
|---|---|---|---|
| Bat_12SF1 | GTAACAAGGTAAGTGTACTG | 1–951 | This study |
| Bat-12SR | AAAGCAAARCACTGAAAATG | 724–1740 | [12] |
| Bat-12SF | TTTCATCTTTTCCTTGCGGTAC | 832–1857 | [12] |
| Bat-16SF | CYGGAAAGTGTGCTTGGA | 1719–2731 | [12] |
| Bat-16SR | GCAATTACCGRRCTCTGCCA | 2370–3308 | [12] |
| L2985 | CCTCGATGTTGGATCAGG | 3123–4047 | [13] |
| ND1R_957 | TTATGTTTGGGGGGGAACACT | 3447–4322 | This study |
| ND1F_957 | ATGTATTTTATTAATCTACTGGCAACA | 3452–4343 | This study |
| H4419 | GTATGGGCCCGATAGCTT | 3605–4488 | [13] |
| Mu_ND1F(long) | GTATCTGGCTTCAATGTAGAATACGCAGGAGGC | 4077–5731 | This study |
| Mu_COIR | TGATTCTTTGGCCACCCAGAA | 5418–6337 | This study |
| Mu_COIR_500 | TCCAGCAGGATCAAAGAAGG | 6176–6629 | This study |
| Mu_COIF_500 | TCACTGCCCATGCTTTTGTA | 6208–7227 | This study |
| Mu_D-COIF1 | AGCTACTATAATTATTGCTATTCC | 6955–7928 | This study |
| Mu_D-cLR1 | CGGCAGGTAAGACAACTC | 7267–8090 | This study |
| Mu_c-LR | ACTGTACCAGCCCAAAGG | 7863–8904 | This study |
| L8929 | GGACAATGCTCAGAAATCTGCGG | 8649–9367 | [14] |
| Mu_c-L1 | CTGTTTATTCAGCCAATAGCC | 9091–10,119 | This study |
| Mu_c-L2 | CTCCATGTTATTATTGGCTC | 9957–11,695 | This study |
| Mu_B1-L4 | CCGCTCTATGGACTCCAC | 11,514–12,545 | This study |
| Mu_B1-cytbH3 | TGTTTTCGTTGATTAATACAAGG | 12,704–13,709 | This study |
| Mu_B1-L5 | ACTGCTAATTCATGCGCC | 12,355–13,309 | This study |
| Mu_B1-L6 | TATAGAAGGTCCCACACC | 13,171–14,240 | This study |
| Mu_B1-cytbH2 | GGAGCAGTATCCTGAGTC | 13,521–14,486 | This study |
| Mu_B1-CytbH1 | CTGTTGCTATAACAGCAAAG | 14,357–15,322 | This study |
| Mu_CytbH | GGCTTTATCAGCTGAGAATCCTCCTCAGATTCC | 14,875–15,244 | This study |
| H6 | TCTCCATTTCTGGTTTACAAGAC | 15,135–15,974 | [15] |
| Mu_CytbF | AATAACAACCCTAATAGCACTAGT | 15,577–16,525 | This study |
| Mu_A2-CytbF1 | TACAATTTAAACGAGTACATAATAC | 16,331–17,286 | This study |
2.2. PCR amplification and DNA sequencing
PCR amplification was performed in a final reaction volume of 20 μL, which contains 10 mM Tris–HCl (pH 8.4), 50 mM KCl, 4 mM MgCl2, 200 mM each dNTP, 50 pmol each primer, 2 U ExTaq polymerase, and 1 μL of DNA sample, under the following conditions: 94 °C for 5 min (initial denaturation); then 94 °C for 1 min (denaturation), 46–62 °C for 30 s (annealing), and 72 °C for 2 min (extension) for 35 cycles; and a final extension at 72 °C for 10 min. The PCR products were resolved by electrophoresis with a 1.0% agarose gel, extracted using a DNA Gel Extraction Kit (Qiagen, Valencia. CA, USA), and sent to Biomedic Co., Ltd. (Bucheon, South Korea) for sequencing from both directions by using a primer-walking strategy.
2.3. Identification and secondary structure of mitochondrial tRNA genes
Complete sequence of mitochondrial genome of M. ussuriensis was aligned with the mitochondrial genomes of M. formosus [3] and R. ferrumequinum [4] using ClustalW implemented in Geneious Pro 5.5.9 (Auckland, New Zealand), and then positions of 22 mitochondrial tRNA gene sequences were identified using the two mitochondrial genomes as references for annotation and characterization.
2.4. Gene organization and nucleotide composition of transfer RNA genes
Composition skewing of nucleotides was calculated according to the formulas: AT skew = [A − T] / [A + T] and GC skew = [G − C] / [G + C] [6].
Mitochondrial 22 tRNA genes were interspersed on mitogenome (Table 2). The tRNA genes included two leucine-tRNA genes (tRNALeu(UUR) and tRNALeu(CUN)) and two serine-tRNA genes (tRNASer(AGY) and tRNASer(UCN)). The combined size of 22 tRNA genes is 1516 bp and their average length is 68.9 ± 2.70 bp (n = 22), ranging in size from 62 bp in tRNASer(AGY) to 74 bp in tRNALeu(CUR) and tRNAGln (Table 2).
Table 2.
Nucleotide composition in the 22 tRNA of Murina ussuriensis mitogenome.
| Gene | Position on mitogenome |
Length (bp) | Nucleotide composition (bp) |
AT skew | GC skew | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Start | Stop | A | T | C | G | AT (%) | ||||
| tRNAPhe | 1 | 71 | 71 | 30 | 17 | 12 | 12 | 47 (66.2) | 0.28 | 0.00 |
| tRNAVal | 1044 | 1112 | 69 | 26 | 19 | 13 | 11 | 45 (65.2) | 0.16 | − 0.08 |
| tRNALeu(UUR) | 2671 | 2744 | 74 | 24 | 22 | 12 | 16 | 46 (62.2) | 0.04 | 0.14 |
| tRNAIle | 3706 | 3774 | 69 | 24 | 24 | 9 | 12 | 48 (69.6) | 0.00 | 0.14 |
| tRNAGln | 3772 | 3845 | 74 | 26 | 23 | 17 | 8 | 49 (66.2) | 0.06 | − 0.36 |
| tRNAMet | 3846 | 3914 | 69 | 21 | 17 | 18 | 13 | 38 (55.1) | 0.11 | − 0.16 |
| tRNATrp | 4957 | 5023 | 67 | 22 | 21 | 13 | 11 | 43 (64.2) | 0.02 | − 0.08 |
| tRNAAla | 5028 | 5096 | 69 | 27 | 17 | 16 | 9 | 44 (63.8) | 0.23 | − 0.28 |
| tRNAAsn | 5098 | 5170 | 73 | 28 | 18 | 16 | 11 | 46 (63.0) | 0.22 | − 0.19 |
| tRNACys | 5203 | 5268 | 66 | 20 | 18 | 15 | 13 | 38 (57.6) | 0.05 | − 0.07 |
| tRNATyr | 5269 | 5336 | 68 | 18 | 23 | 16 | 11 | 41 (60.3) | − 0.12 | − 0.19 |
| tRNASer(UCN) | 6892 | 6960 | 69 | 22 | 18 | 18 | 11 | 40 (58.0) | 0.10 | − 0.24 |
| tRNAAsp | 6968 | 7034 | 67 | 22 | 23 | 9 | 13 | 45 (67.2) | − 0.02 | 0.18 |
| tRNALys | 7722 | 7788 | 67 | 25 | 22 | 11 | 9 | 47 (70.1) | 0.06 | − 0.10 |
| tRNAGly | 9415 | 9481 | 67 | 25 | 23 | 11 | 8 | 48 (71.6) | 0.04 | − 0.16 |
| tRNAArg | 9829 | 9898 | 70 | 30 | 28 | 6 | 6 | 58 (82.9) | 0.03 | 0.00 |
| tRNAHis | 11,568 | 11,636 | 69 | 30 | 22 | 10 | 7 | 52 (75.4) | 0.15 | − 0.18 |
| tRNASer(AGY) | 11,637 | 11,698 | 62 | 19 | 15 | 15 | 13 | 34 (54.8) | 0.12 | − 0.07 |
| tRNALeu(CUN) | 11,699 | 11,769 | 71 | 27 | 21 | 10 | 13 | 48 (67.6) | 0.13 | 0.13 |
| tRNAGlu | 14,096 | 14,164 | 69 | 23 | 21 | 14 | 11 | 44 (63.8) | 0.05 | − 0.12 |
| tRNAThr | 15,311 | 15,380 | 70 | 24 | 20 | 14 | 12 | 44 (62.9) | 0.09 | − 0.08 |
| tRNAPro | 15,380 | 15,445 | 66 | 25 | 16 | 16 | 9 | 41 (62.1) | 0.22 | − 0.28 |
| Concatenated length | 1516 | 538 | 448 | 291 | 239 | 986 | 0.1 | − 0.1 | ||
| Average | 68.9 | 24.5 | 20.4 | 13.2 | 10.9 | 44.8 | 0.1 | − 0.1 | ||
The number in parenthesis indicates percentage of AT content.
Overall nucleotide composition of the combined 22 tRNA genes is AT bias with nucleotide composition of 33.5% A, 29.6% T, 19.2% C and 15.8% G, showing pattern of A > T > C > G. Among 22 tRNA genes, the most common pattern is A > T ≧ C ≧ G which is observed in 16 tRNA genes. The pattern of A ≧ T > G > C is observed in tRNALeu(UUR), tRNALeu(CUN) and tRNAIle, pattern of T > A > C > G in tRNATyr and pattern of T > A > G > C in tRNAAsp, and pattern of A > C > T > G in tRNAMet, respectively. As expected by the nucleotide composition, average AT skew value of 22 tRNA genes and AT skew value of the concatenated 22 tRNA genes were positive, while GC skew was negative values, indicating existence of more ‘A’ residues on the strand than ‘T’ and more ‘C’ residues than ‘G’, respectively (Table 2). Among 22 tRNA genes, AT skew of 19 tRNA genes is positive, while the negative value is shown in tRNATyr and tRNAAsp and zero value in tRNAIle, which the frequencies of A and T is same. In case of GC skew, the positive value is shown in tRNALeu(UUR), tRNAIle, tRNAAsp and tRNALeu(CUN), zero value in tRNAPhe and tRNAArg, and the negative value in the other 16 tRNA genes. The two leucine tRNA genes (tRNALeu(UUR)and tRNALeu(CUN)) have positive value in both AT skew and GC skew.
2.5. Secondary structure and feature of transfer RNA genes
Both the tRNA scan-SE search server and Arwen web server with default parameters were used for the confirmation of tRNA gene sequences and potential stem-loop secondary structures within these tRNAs deduced from the tRNA genes [7], [8].
Canonical cloverleaf secondary structure is observed in all the other the tRNAs except tRNASer(AGY) without DHU in its secondary structure. Such deletion of DHU arm in secondary structure of tRNASer(AGY) was considered a common condition in the metazoan mitogenome [9], [10]. The lengths of amino acid acceptor stem and anticodon stem are 7 bp and 5 bp, respectively, in the 21 tRNAs except for tRNASer(AGY), which has 6 bp in the anticodon stem. The CCA 3′-terminal group used to attach the amino acid was added during processing and therefore did not appear in all the tRNAs.
Multiple non-Watson–Crick base pairs appear in the amino acceptor stems of tRNAVal (U·G), tRNALeu(UUR) (G·U), tRNAGln (A·A), tRNAMet (A·G), tRNAAla (G·U), tRNAAsn (U·U), tRNACys (U·G, U·G), tRNASer(UCN) (G·U), tRNAHis (C·A), tRNAGlu (A·U), and tRNAThr (A·A), the anticodon stems of tRNALeu(UUR) (U·U, G·U), tRNAAla (U·U, U·U), tRNAAsn (U·C), tRNASer(UCN) (G·U, U·G), tRNAAsp (U·G), tRNAHis (C·A) and tRNASer(AGY) (A·A), and the TΨC arm of tRNAVal (C ∙ A), tRNAGln (U·G), tRNAMet (U·U, U·U), tRNAAla (U·G), tRNAAsn (G·U), tRNASer(UCN) (G·U, G·U), tRNAAsp (U·G), tRNALeu(CUN) (U·G), tRNAGlu (G·A), tRNAThr (A·C) and tRNAPro (G·U) (Fig. 1). The most common non-Watson–Crick base pair was G·U (or U·G) wobble base pairs, followed by U·U base pairs. Since the G·U (or U·G) base pair has been known to provide comparable thermodynamic stability to Watson–Crick base pairs and is nearly isomorphic to them, they would be likely to substitutes for G·U or A·U base pairs, as observed in other metazoan animals [11].
Fig. 1.
Secondary structure of 22 tRNAs of Murina ussuriensis.
Anticodon loop of tRNAs is well conserved (Table 3). The first Y-position in the 5′ side-anticodon (5′ side of anticodon) consists of only pyrimidine nucleotide ‘C’ or ‘U’ and in the second Y-position of the 5′ side-anticodon highly conserved ‘U’ is observed in 21 tRNAs except tRNAMet with ‘C’. Only purine nucleotide ‘A’ or ‘G’ is observed in the R-position in the 3′ side-anticodon. All four nucleotides are found in the N-position, but most common nucleotide is ‘A’, which is present in N-position of 15 tRNAs. A pyrimidine nucleotide ‘C’ is observed in N-position of only tRNAMet. Conserved sequences of anticodon loop could be classified into seven motifs (Table 3). Most common motif is CU-ANT-AA, which is found in 10 tRNAs. The motif CC-ANT-AC and UU-ANT-AG are shown only in tRNAMet and tRNAIle, respectively, and CT-ANT-GA is observed in two leucine-tRNAs.
Table 3.
Motifs of nucleotide composition in anticodon loop of tRNA genes.
| Motif | tRNAs | 5′-Anticodon loop-3′ |
||||||
|---|---|---|---|---|---|---|---|---|
| Y | Y | Anticodon | R | N | ||||
| CC-ANT-AC | tRNAMet | C | C | · | · | · | A | C |
| CU-ANT-AA | tRNAPhe | C | U | · | · | · | A | A |
| tRNAGln | C | U | · | · | · | A | A | |
| tRNATrp | C | U | · | · | · | A | A | |
| tRNAAsn | C | U | · | · | · | A | A | |
| tRNATyr | C | U | · | · | · | A | A | |
| tRNASer(UCN) | C | U | · | · | · | A | A | |
| tRNALys | C | U | · | · | · | A | A | |
| tRNAGly | C | U | · | · | · | A | A | |
| tRNASer(AGY) | C | U | · | · | · | A | A | |
| tRNAThr | C | U | · | · | · | A | A | |
| CU-ANT-GA | tRNALeu(UUR) | C | U | · | · | · | G | A |
| tRNALeu(CUN) | C | U | · | · | · | G | A | |
| UU-ANT-AA | tRNACys | U | U | · | · | · | A | A |
| tRNAAsp | U | U | · | · | · | A | A | |
| tRNAHis | U | U | · | · | · | A | A | |
| UU-ANT-AC | tRNAVal | U | U | · | · | · | A | C |
| tRNAArg | U | U | · | · | · | A | C | |
| UU-ANT-AG | tRNAIle | U | U | · | · | · | A | G |
| UU-ANT-GU | tRNAAla | U | U | · | · | · | G | U |
| tRNAGlu | U | U | · | · | · | G | U | |
| tRNAPro | U | U | · | · | · | G | U | |
ANT indicates ‘anticodon’.
3. Discussion
We described here characteristics of mitochondrial 22 tRNA genes and 22 tRNAs of the Ussurian tube-nosed bat M. ussuriensis (Chiroptera: Vespertilionidae). Main contents of the present study include gene organization and nucleotide composition of mitochondrial 22 tRNA genes, description of secondary structure and feature of mitochondrial 22 tRNAs, and sequence motifs in anticodon loop. We also provide primer information and PCR condition for PCR amplification of the complete mitogenome of M. ussuriensis. Sequence dataset of the 22 tRNA genes used in the present study is chosen from recently published M. ussuriensis mitogenome.
Conflict of interest
The authors have no conflicts of interest.
Acknowledgements
This study was supported by a grant from National Research Foundation of Korea (NRF) Joint Research Program “2013K2A1A2055207”.
References
- 1.Yoon K.B., Kim H.R., Kim J.Y., Jeon S.H., Park Y.C. The complete mitochondrial genome of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae) in Korea. Mitochondrial DNA. 2013;24:397–399. doi: 10.3109/19401736.2013.763243. [DOI] [PubMed] [Google Scholar]
- 2.Hirakawa H., Kawai K. Hiding low in the thicket: roost use by Ussurian tube-nosed bats (Murina ussuriensis) Acta Chiropterol. 2006;8:263–269. [Google Scholar]
- 3.Kim Y.M., Choi E.H., Kim S.K., Jang K.H., Ryu S.H., Hwang U.W. Complete mitochondrial genome of the Hodgson's bat Myotis formosus (Mammals, Chiroptera, Vespertilionidae) Mitochondrial DNA. 2011;22:71–73. doi: 10.3109/19401736.2011.624598. [DOI] [PubMed] [Google Scholar]
- 4.Yoon K.B., Kim J.Y., Cho J.Y., Park Y.C. The complete mitochondrial genome of the greater horseshoe bat subspecies, Rhinolophus ferrumequinum korai (Chiroptera: Rhinolophidae) Mitochondrial DNA. 2011;22:102–104. doi: 10.3109/19401736.2011.624614. [DOI] [PubMed] [Google Scholar]
- 5.Yoon K.B., Kim H.R., Kim J.Y., Cho J.Y., Park Y.C. The complete mitochondrial DNA genome of a greater horseshoe bat subspecies Rhinolophus ferrumequinum quelpartis (Chiroptera: Rhinolophidae) Mitochondrial DNA. 2013;24:22–24. doi: 10.3109/19401736.2012.716049. [DOI] [PubMed] [Google Scholar]
- 6.Lobry J.R. Asymmetric substitution patterns in the two DNA strands of bacteria. Mol. Biol. Evol. 1996;13:660–665. doi: 10.1093/oxfordjournals.molbev.a025626. [DOI] [PubMed] [Google Scholar]
- 7.Lowe T.M., Eddy S.R. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955–964. doi: 10.1093/nar/25.5.955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Laslett D., Canbäck B. Arwen: a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics. 2008;24:172–175. doi: 10.1093/bioinformatics/btm573. [DOI] [PubMed] [Google Scholar]
- 9.Lavrov D.V., Brown W.M., Boore J.L. A novel type of RNA editing occurs in the mitochondrial tRNAs of the centipede Lithobius forficatus. Proc. Natl. Acad. Sci. U.S.A. 2000;97:13738–13742. doi: 10.1073/pnas.250402997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kilpert F., Podsiadlowski L. The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features. BMC Genomics. 2006;7:241. doi: 10.1186/1471-2164-7-241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Varani G., McClain W.H. The G × U wobble base pair. A fundamental building block of RNA structure crucial to RNA function in diverse biological systems. EMBO Rep. 2000;1:18–23. doi: 10.1093/embo-reports/kvd001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gu X.M., He S.Y., Ao L. Molecular phylogenetics among three families of bats (Chiroptera: Rhinolophidae, Hipposideridae, and Vespertilionidae) based on partial sequences of the mitochondrial 12S and 16S rRNA genes. Zool. Stud. 2008;47:368–378. [Google Scholar]
- 13.Jan C.M., Frith K., Glover A.M., Butlin R.K., Scott C.D., Greenaway F., Ruedi M., Frantz A.C., Dawson D.A., Altringham J.D. Myotis alcathoe confirmed in the UK from mitochondrial and microsatellite DNA. Acta Chiropterol. 2010;12:471–483. [Google Scholar]
- 14.Pulgarin-R P.C., Burg T.M. Genetic signals of demographic expansion in downy woodpecker (Picoides pubescens) after the last North American glacial maximum. PLoS One. 2012;7:e40412. doi: 10.1371/journal.pone.0040412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Latinne A., Waengsothorn S., Herbreteau V., Michaux J.R. Thai Society of Higher Education Institutes on Environment; 2011. Thai Limestone Karsts: An Impending Biodiversity Crisis; pp. 176–187. [Google Scholar]