Significance
Malaria remains a major public health issue worldwide and world health organization estimates ∼198 million cases and ∼584,000 deaths in the year of 2013 alone due to malaria. Lack of an effective vaccine and rapid emergence of drug resistance are two major causes of this persistent problem. Understanding the biology of the parasite and studies of its gene function are essential to identify potential drug targets. Here we report a morpholino oligomer (MO)-based approach to alter gene expression via inhibition of post-transcriptional processes or by targeting mRNAs for degradation. The ease in design of the MO molecules presents a possibility for their use in large-scale genome functional analyses and possibly in malaria therapy.
Keywords: malaria, intraerythrocytic development, peptide conjugated morpholino oligomer, vivo morpholino oligomer, gene expression
Abstract
Identification and genetic validation of new targets from available genome sequences are critical steps toward the development of new potent and selective antimalarials. However, no methods are currently available for large-scale functional analysis of the Plasmodium falciparum genome. Here we present evidence for successful use of morpholino oligomers (MO) to mediate degradation of target mRNAs or to inhibit RNA splicing or translation of several genes of P. falciparum involved in chloroquine transport, apicoplast biogenesis, and phospholipid biosynthesis. Consistent with their role in the parasite life cycle, down-regulation of these essential genes resulted in inhibition of parasite development. We show that a MO conjugate that targets the chloroquine-resistant transporter PfCRT is effective against chloroquine-sensitive and -resistant parasites, causes enlarged digestive vacuoles, and renders chloroquine-resistant strains more sensitive to chloroquine. Similarly, we show that a MO conjugate that targets the PfDXR involved in apicoplast biogenesis inhibits parasite growth and that this defect can be rescued by addition of isopentenyl pyrophosphate. MO-based gene regulation is a viable alternative approach to functional analysis of the P. falciparum genome.
Of the ∼5,300 genes encoded by the Plasmodium falciparum genome, only a small number of genes have been successfully targeted for genetic modification using available genetic tools. With the lack of RNAi technology in this parasite, forward genetic approaches suitable for large-scale functional analysis are needed to validate possible drug targets and to gain a better understanding of P. falciparum pathophysiology (1). Recent efforts aimed to develop such tools include the use of Piggy-Bac, peptide-conjugated morpholino oligomers (PPMO), zinc-finger nucleases, glmS ribozyme, CRISPR-Cas9–mediated genome editing, peptide nucleic acids, and the Tet-R aptamer system (2–8). Each of these methods requires further development and optimization to be used in a large-scale format to assess the function of P. falciparum genes. Morpholino oligomers (MO) have identical Watson–Crick base-pair characteristics as DNA or RNA. They are resistant to degradation by nucleases due to the presence of a morpholine ring and have no charge because of the phosphorodiamidate bond in the backbone. The MO-based RNA-targeting approach has been shown to be an excellent alternative to RNAi as morpholinos can bind to RNA with high specificity (9). The sequence of the MO thereby decides the fate of the endogenous transcript. For example, MOs with External Guide Sequence (EGS) conjugated to peptides (PPMOs) have been designed to target essential genes of several pathogenic bacteria and have displayed strong antibacterial activity (10–13). Similarly, PPMOs targeting the P. falciparum PfGyrA and PfPAT RNAs for RNase P-mediated cleavage inhibit parasite growth in the low micromolar range (4, 14–16). Because binding of MOs to their target RNAs can prevent binding of other molecules to the same targets, MO conjugates have also been used to inhibit RNA splicing and initiation of protein translation (9, 17, 18).
To enhance cellular uptake of morpholino oligomers and other drug-like molecules, arginine-rich peptides and polyguanidino dendrimers have been used (19–23). For morpholino-based antimicrobial activity, two types of conjugates have been developed, PPMOs and vivo morpholino oligomers (VMOs, octa-guanidinium dendrimer-conjugated MOs; Materials and Methods). PPMOs are produced following conjugation of a specific MO to a cell-penetrating, arginine-rich peptide, whereas VMOs are synthesized as conjugates between a MO molecule and an octa-guanidinium head group (13, 17, 24). To date, VMOs have been used to down-regulate gene expression in human fibroblasts, mice, zebrafish, Xenopus oocytes, Toxoplasma gondii, and other model organisms (20, 25–29). However, these conjugates have not yet been assessed for their use in functional analysis of P. falciparum genes.
We report here the successful use of VMO or PPMO conjugates designed to target translation, splicing, and degradation of target RNAs in P. falciparum. Using these conjugates, we have targeted the PfDXR, PfPMT, and PfCRT genes that play a critical role in apicoplast biogenesis, membrane biosynthesis, and drug/metabolite transport (30–32). We show that VMO (PfPMT, PfCRT) and PPMO (PfDXR) conjugates reduce endogenous levels of their target RNAs and inhibit parasite growth. PfCRT-VMO was effective against drug-sensitive and -resistant strains and rendered a chloroquine-resistant strain more sensitive to the drug.
Results
Inhibition of Luciferase Reporter Activity with a Specific Luciferase-VMO.
To assess the specificity of VMO-mediated inhibition, transgenic parasites expressing luciferase (LUC) (33) were used, and a Luc-VMO that binds at the start codon to inhibit translation initiation was designed. (Fig. 1A and Table 1) (18). The morpholino sequence was designed to have less than 16 contiguous hydrogen-bonding bases to limit self- complementarity and no more than nine guanine residues to be water soluble (9). As a control, a VMO with no homology to the parasite genome was used (Ctrl-VMO) (Table 1). Both Luc-VMO and Ctrl-VMO were conjugated to dendritic molecular transporter units with guanidine head groups to facilitate delivery to host cells (24). Parasites expressing luciferase were synchronized and treated at the ring stage with Ctrl-VMO or Luc-VMO at two different concentrations (see legend to Fig. 1), and parasite intraerythrocytic development was monitored after one (Rings → Trophozoite → Schizont → Ring) and two 48-h cycles of parasite growth. As expected, no differences in growth could be detected after one or two cycles between Luc-VMO– and Ctrl-VMO–treated parasites (see Fig. S1 A and B). However, treatment with 2 µM Luc-VMO resulted in a 17 and 30% reduction in luciferase activity compared with Ctrl-VMO after one and two cycles, respectively (Fig. 1D). Higher concentrations of VMO conjugates altered parasite growth most likely due to the inherent toxicity of the targeting dendrimer as has been previously reported in mice (Fig. S1B) (34).
Fig. 1.
Inhibition of translation and splicing using VMOs (A–C) Schematic representation of the binding sites of luciferase-VMO. (A), PfPMT-VMO (B), and PfCRT-VMO (C) on their respective sites on the mRNA or pre-mRNA. Arrows indicate the sites and orientation of the primers used for qPCR. cDNA was made from VMO-treated 3D7 parasites. (D) Luciferase-expressing parasites were treated with 1 or 2 µM Ctrl-VMO and luciferase-VMO; 72 h (one cycle) and 96 h (two cycles) later parasites lysates were used for luciferase assay. Luciferase activity is plotted after normalization to Ctrl-VMO. (E and G) qPCR studies with primers 2F and 2R to amplify PfPMT or PfCRT steady-state transcripts. (F and H) qPCR analyses carried out using primers 1F and 1R, which amplify PfPMT or PfCRT unspliced transcripts. The results represent three independent experiments, and the error bars indicate SE of mean. The level of significance in the graph is indicated with an asterisk (*P < 0.01). (I) cDNA from PBS (lane 1), PfPMT-VMO (lane 2), and PfCRT-VMO (lane 3) treated 3D7 parasites along with genomic DNA (lane 4) were amplified using PfPMT 3F and 3R, and the PCR products were separated on a 1% agarose gel.
Table 1.
Sequences of VMOs and PPMOs used in the text
| Gene | Conjugate | Sequence of VMO/PPMO (5′-3′) |
| Control | VMO | CCTCTTACCTCAGTTACAATTTATA |
| Luciferase | VMO | TCATAAACTTTCGAAGTCATGCGGC-5 |
| PfPMT | VMO | AAGTTTTTAGCACCTTCATCCGTAT55 |
| PfCRT | VMO | CCATTTTTGGATACTTACTTCCTTC84 |
| PfDXR | PPMO | GTCCACGAGGTTCGAATCCTCTATATCC141 |
| SaGyr | PPMO | ACCTTGGCCAACCA |
The boldface letters for PfDXR indicate the functional part of the sequence in the EGS. The other letters indicate the sequence needed for RNase P recognition in eukaryotic cells. The number in superscript next to the sequence indicate binding site on the transcript.
Fig. S1.
Wild-type (3D7) parasite growth examined by flow cytometry. Luciferase-expressing parasites were treated with 1 and 2 µM Ctrl-VMO and luciferase-VMO, (A) 72 h (one cycle) and (B) 96 h (two cycles) later parasite growth was examined by flow cytometry. (C) 3D7 parasite growth following PfPMT-VMO (D) and PfCRT-VMO treatment was examined by flow cytometry. The gating used on flow data is indicated in the flow plot. R indicates ring stage whereas T indicates trophozoite-stage infected RBC. The experiment was repeated three times. The result represents data from a representative experiment; error bars indicate the SD of the average from three biological replicates.
Gene-Specific Transcript Expression Is Reduced After VMO Treatment.
To assess the possible use of VMO conjugates in down-regulation of P. falciparum gene expression, two VMO conjugates were designed to target splicing of PfPMT and PfCRT RNAs, encoding the phosphoethanolamine methyltransferase and digestive vacuole transporter of the parasite, respectively (35, 36). The sequences of PfCRT and PfPMT VMOs are shown in Table 1. These VMOs were designed to bind to the first exon–intron junction in each gene’s pre-mRNA to prevent splicing, resulting in accumulation of unspliced RNAs. Parameters for morpholino design were similar to those described for Luc-VMO. Both VMOs were conjugated to a dendritic molecular transporter with guanidine headgroups to facilitate delivery. The possible outcomes of the VMO treatment on the parasite endogenous transcript are illustrated in Fig. 1 B and C. PCR analyses using primers specific to the first intron region were performed to compare levels of unspliced transcripts between control and treated parasites (Fig. 1 B and C). Levels of steady-state mRNA were determined by using primer pairs specific to exon regions. A highly synchronized culture of P. falciparum was treated with the VMOs for 6 h after which total RNA was isolated for cDNA preparation. Real-time PCR analysis showed 24 and 60% reduction in PfPMT and PfCRT steady-state mRNA levels, respectively (Fig. 1 E and G), whereas the levels of unspliced transcripts (Fig. 1 F and H) were 38% higher in both PfPMT-VMO or PfCRT-VMO–treated parasites compared with parasites treated with Ctrl-VMO. The observed decrease in the steady-state mRNA levels could be due to nonsense-mediated mRNA decay of mis-spliced transcripts (37). PCR amplification using primers 3F and 3R yielded two bands in PfPMT-VMO–treated parasites corresponding to unspliced and spliced forms whereas only a single band corresponding to the spliced form was detected in Ctrl-VMO–treated parasites (Fig. 1I). Primers 3F and 3R bind to the first and fourth exon, and the amplification product from genomic DNA includes all three introns, resulting in a 647-base product. Using these primers, a fully spliced mRNA yields a 227-base product, whereas an unspliced RNA containing the first intron following treatment with PfPMT-VMO results in a 372-base product. The absence of unspliced PfPMT RNA products in untreated or PfCRT-VMO–treated parasites indicates that PfPMT-VMO mediates gene-specific inhibition of splicing of its target RNA.
VMOs Targeting Splicing of PfPMT and PfCRT Inhibit Parasite Growth.
Previous genetic studies have shown that the loss of PfCRT results in parasite death whereas disruption of PfPMT results in a major developmental defect during P. falciparum intraerythrocytic asexual development (30, 32). To examine the effect of VMOs targeting PfPMT or PfCRT on parasite development, cultures of the P. falciparum 3D7 clone were examined in the presence of Ctrl-VMO, PfCRT-VMO, or PfPMT-VMO after one or two cycles of treatment. A major delay in development could be seen in cultures of parasites treated with PfPMT-VMO compared with parasites treated with Ctrl-VMO with most parasites arrested at the trophozoite stage. PfCRT-VMO treatment resulted in deformed parasites with large digestive vacuoles (Fig. 2A), a phenotype reminiscent of the effect of cysteine protease inhibitors (38). Using transgenic parasites expressing a luciferase reporter to monitor parasite development, PfPMT-VMO and PfCRT-VMO were effective in reducing luciferase activity by two- to three-fold compared with Ctrl-VMO after one or two cycles of treatment (Fig. 2 B and C). This effect was further confirmed by flow cytometry (Fig. S1 C and D). Optimal parasite inhibition was observed with 1.25 µM PfPMT-VMO and 1.75 µM PfCRT-VMO (Fig. 2 B–E).
Fig. 2.
PfPMT-VMO and PfCRT-VMO conjugates inhibit parasite growth. (A) 3D7 parasites were treated with 1.75 µM of control-VMO, PfPMT-VMO, or PfCRT-VMO. Four representative images of Giemsa-stained smears after two cycles posttreatment are shown. (B–E) Luciferase-expressing parasites were treated with 1.25 or 1.75 µM of Ctrl-VMO, PfPMT-VMO, or PfCRT-VMO, and luciferase activity was determined after one or two cycles of intraerythrocytic development. Growth as percentage of luciferase activity of PfPMT-VMO– (B and C) or PfCRT-VMO– (D and E) treated parasites normalized to Ctrl-VMO is shown. The experiment was carried out three times. The result represents data from a representative experiment; error bars indicate the SD of the average from three biological replicates.
PfCRT-VMO Enhances Susceptibility of the Chloroquine-Resistant Dd2 to Chloroquine.
Previous studies have shown that specific mutations in the PfCRT gene render P. falciparum resistant to chloroquine and other 4-aminoquinolines (35). The ability to reverse the resistance phenotype through direct inhibition of PfCRT expression or by blocking drug transport activity is highly desirable. The growth of the chloroquine-resistant Dd2 strain (IC50-131nM) was examined using flow cytometry in the absence or presence of PfCRT-VMO. As shown in Fig. 3A, no inhibition of parasite growth was observed after one 48-h cycle. However, after two cycles, PfCRT-VMO caused 30% growth inhibition at 2 µM and 50% inhibition at 3 µM compared with Ctrl-VMO (Fig. 3B). Because resistant alleles of PfCRT impart chloroquine resistance, reduced levels of mutated PfCRT protein should result in increased sensitivity to the drug. Dd2 parasites were therefore treated with Ctrl-VMO and PfCRT-VMO in the absence or presence of 50 nM chloroquine. As shown in Fig. 3, an approximate twofold increase in sensitivity of Dd2 to chloroquine was detected in the presence of PfCRT-VMO. Compared with Ctrl–VMO, in the absence of chloroquine, PfCRT-VMO inhibited parasite growth by 29%, whereas in the presence of chloroquine growth inhibition reached 53% (Fig. 3 C and D).
Fig. 3.
PfCRT-VMO enhances sensitivity of Dd2 parasites to chloroquine. Dd2 parasites were treated with 1, 2, or 3 µM of Ctrl-VMO or PfCRT-VMO. Parasite inhibition was assessed by flow cytometry. Parasite growth in the presence of PfCRT-VMO was normalized to Ctrl-VMO as shown after one cycle (A) and two cycles (B). The effect of PfCRT-VMO on Dd2 sensitivity to chloroquine (CQ) was examined by treating Dd2 parasites with 2 µM Ctrl-VMO or PfCRT-VMO in the absence or presence of 50 nM CQ (C). Parasite growth was examined by flow cytometry. The percentage inhibition was obtained by calculating the difference between Ctrl-VMO and PfCRT-VMO treatments in the absence or presence of CQ as a percentage of Ctrl-VMO treatment. (D) A representative flow plot comparing different treatments is shown. The presence of PfCRT-VMO increases parasite sensitivity to CQ, whereas a similar effect is not seen with Ctrl-VMO. The experiment was performed three times. The result represents data from a single experiment with the error bars indicative of the SD of the average from three biological replicates. The level of significance in the graph is indicated with an asterisk (*P < 0.01). R: ring-stage parasites; T: trophozoite-stage parasites.
Antimalarial Activity of PfDXR-PPMO Is Reversed by Isopentenyl Pyrophosphate.
The P. falciparum gene 1-deoxy d-xylulose 5-phosphate reductoisomerase (PfDXR) is essential for intraerythrocytic development and encodes an enzyme in the nonmevalonate pathway important for the synthesis of isoprenoids and targeted by the drug fosmidomycin (31). Because the loss of PfDXR can be complemented by addition of isopentenyl pyrophosphate (IPP), targeting this gene represents a unique way to validate the specificity of MO-mediated downregulation. An EGS for PfDXR was selected from the coding sequence of the gene on the basis of its ability to form a precursor tRNA-like structure when it binds to the target RNA using previously described methods (Table 1) (14). Potential Ribonuclease P cleavage sites within this sequence were determined (15, 39) (Fig. 4 A and B). Once these sites were identified, specific EGSs complementary to the selected sites were prepared and the mRNA–EGS complexes were again assayed to validate the choices. DXR130 was successful as an EGS: the mRNA in the DXR mRNA–DXR130 EGS complex was cleaved specifically as designed. The selected EGS (DXR–130EGS) was subsequently conjugated to a cell-penetrating l-arginine–rich peptide to produce PfDXR-PPMO (13) (Materials and Methods). Real-time PCR analyses on ring-stage parasites treated with PfDXR-PPMO showed a dose-dependent decrease in the PfDXR transcript following treatment with PfDXR-PPMO with 1 and 5 µM resulting in 32 and 48% decreases in transcript levels, respectively (Fig. 4C).
Fig. 4.
PfDXR-PPMO down-regulates PfDXR gene expression and alters growth of both 3D7 and artemisinin slow-clearance parasites. (A) Schematic representation of the PfDXR transcript and the PfDXR-PPMO–binding site. (B) Cleavage of PfDXR mRNA by E. coli RNase P in vitro. (Lane 1) DXR mRNA; (lane 2) DXR mRNA+ E. coli RNAse P; (lane 3) DXR mRNA+ E. coli RNAse P + DXR 130EGS; (lane 4) DXR mRNA+ E. coli RNAse P + DXR 145EGS; (lane 5) DXR mRNA+ HeLaRNAse P; (lane 6) DXR mRNA+ HeLaRNAse P + DXR 130EGS; (lane 7) DXR mRNA+ HeLaRNAse P + DXR 145EGS. (C) cDNA was made from RNA isolated from PfDXR-PPMO–treated 3D7 parasites. qPCR carried out using PfDXR-specific primers shows a dose-dependent reduction in PfDXR transcript. (D and E) 3D7 parasites were treated with PfDXR-PPMO, SaGyr-PPMO (negative control), and dihydroartemisinin. (E) Representative images of infected red blood cells one cycle posttreatment. (F) Inhibition of artemisinin slow-clearance parasites (ART-SL) by PfDXR-PPMO and dihydroartemisinin (positive control). The experiment was repeated twice, and the error bars indicate SD of the average of experimental values. Significant difference is indicated with an asterisk (**P < 0.001, ***P < 0.0001).
The antimalarial activity of PfDXR-PPMO was also examined by microscopic analysis of Giemsa-stained blood smears as well as by flow cytometry. Dihydroartemisinin (DHA) was used as a positive control, and the Staphylococcus aureus-specific Gyrase-PPMO (SaGyr-PPMO) was used as a negative control. As shown in Fig. 4, PfDXR-PPMO inhibited growth of 3D7 parasites whereas the control SaGyr had no effect (Fig. 4 D and E). To assess the effect of this conjugate on drug-resistant parasites, the sensitivity of the artemisinin slow-clearance strain ART-SL, 4026 to PfDXR-PPMO was examined. This strain, which was isolated at the Thailand–Burma border, has a clearance rate of 8.37 h and a wild-type Kelch sequence (40) and grows slowly and asynchronously. DHA treatment resulted in a further decrease in growth. By 72 h, whereas untreated parasites showed a ring-to-trophozoite ratio of 1:3, DHA-treated parasites had a 1:1 ratio of the two stages. Interestingly, the inhibitory activity of PfDXR-PPMO was similar to that of DHA on the artemisinin slow-clearance strain (Fig. 4F). Flow cytometry analyses showed that PfDXR-PPMO causes 60–70% growth inhibition compared with SaGyr-PPMO at 15 µM (Fig. 5A and Fig. S2A). In the same assay, 1 µM fosmidomycin showed 50% growth inhibition (Fig. 5B).
Fig. 5.
PfDXR-PPMO–mediated inhibition of P. falciparum is complemented by IPP supplementation. 3D7 parasites were treated with PfDXR-PPMO, SaGyr-PPMO (negative control), or fosmidomycin (fos). (A) Parasite growth was examined by flow cytometry after one and two cycles. (B) The effect of fosmidomyin on parasite growth was determined by flow cytometry. (C) 3D7 parasites were treated with fosmidomycin (2 µM), Ctrl-PPMO (SaGyr-PPMO), or PfDXR-PPMO (12.5 µM) in the absence or presence of 200 µM IPP, and parasite growth was examined by flow cytometry. (D) 3D7 parasites were treated with fosmidomycin (1 µM), PfDXR-PPMO + fos (1 µM), or SaGyr-PPMO + fos (1 µM) in the presence or absence of IPP. Percentage growth was calculated compared with untreated controls. The experiment was repeated twice, and the error bars indicate SD of the average of experimental values. The level of significance in the graph is indicated with an asterisk (*P < 0.01, ** P < 0.001).
Fig. S2.
Effect of SaGyr and PfDXR-PPMO in the growth of 3D7 parasites. (A) A representative flow plot comparing the effect of SaGyr-PPMO and PfDXR-PPMO on parasite growth at 15 µM. Dihydroethidium was used for nuclear staining. The gating used is shown for infected RBCs (iRBCs). (B) A representative flow for combination treatment of PfDXR-PPMO or SaGyr-PPMO with fosmidomycin is shown. Dihydroethidium was used for nuclear staining. The experiment was repeated twice.
The specificity of PfDXR-PPMO–mediated inhibition was further demonstrated by the use of IPP (31). Similar to fosmidomycin, PfDXR-PPMO–mediated parasite inhibition was abrogated in the presence of IPP (Fig. 5 C and D and Fig. S2B). An additive effect in parasite inhibition was observed following treatment with fosmidomycin and PfDXR-PPMO but not fosmidomycin and Ctrl-PPMO. As expected, addition of IPP alleviated parasite inhibition mediated by fosmidomycin and PfDXR-PPMO (Fig. 5D and Fig. S2B).
Discussion
Strategies aimed to down-regulate expression of genes may provide the ultimate approach to probing the function of all of the genes expressed by P. falciparum during its life cycle within human erythrocytes. Here we demonstrate the use of different morpholino-based targeting strategies to down-regulate expression of three P. falciparum genes. This is also the first time, to our knowledge, that an octaguanidine group has been used to deliver morpholino oligomer conjugates to P. falciparum. The presence of specific unspliced transcripts in the parasite indicates that it can be delivered to the nucleus of the parasite. Efficient parasite inhibition of wild type and the chloroquine-resistant Dd2 strain was obtained with PfCRT-VMO designed to alter splicing of PfCRT. This conjugate further enhanced sensitivity of this strain to chloroquine. It is noteworthy that modulating PfCRT levels in 7G8, another chloroquine-resistant strain, also resulted in a similar increase in chloroquine sensitivity (41). Similarly, using PPMO-mediated degradation of target mRNA, we have shown successful down-regulation of PfDXR and increased sensitivity of the parasites to fosmidomycin.
The ability of PfDXR-PPMO to down-regulate gene expression and to inhibit parasite growth was achieved at higher concentrations compared with VMO conjugates. This could be due to differences in the efficiency of the delivery moiety (cell-penetrating peptide in the PPMO conjugates versus the octaguanidine-based dendrimer in the VMO conjugates). However, due to differences in the target sequence, conjugate formulation and approaches used for down-regulation, the potency of VMO and PMO cannot be accurately compared.
Studies in vivo using mixtures of VMO conjugates showed toxicity due to hybridization between morpholinos leading to blood clots. Injections of VMO diluted in saline alleviated toxicity and also eliminated any hybridization potential within or between different VMOs, thus serving as a possible solution to the toxicity problem (34). Because we also observed toxicity at high concentrations, it is best to use these VMOs within the 1–3 µM range.
At times, the presence of unconjugated peptides in the PPMO preparation resulted in nonspecific parasite growth inhibition as was observed with the SaGyr PPMO control (Fig. 5). The nonspecific effect of peptides was not seen in the presence of 15 µM conjugates or free peptides. However, concentrations higher than that due to carryover of unconjugated peptide resulted in toxicity.
Although PPMO- and VMO-mediated gene regulation has great potential for functional analysis and specific and selective inhibition of parasite growth, the delivery moiety and synthesis methods that result in consistently active conjugates must be optimized.
A great advantage of the methodology described here is the continued function of the MOs after three-point, noncontiguous mutations in the target RNA (42). Four mutations did not work. These facts make a possible therapy more valuable than current strategies where a single mutation in a gene affecting drug resistance converts parasites from drug sensitive to drug resistant or vice versa.
Materials and Methods
Cell Culture and Materials.
P. falciparum strains 3D7, Dd2, and 3D7 expressing Renilla luciferase were used. The artemisinin slow clearance strain 4026 was obtained from hyperparasitemia patients on the Thailand–Burma border by Francois Nosten (Shoklo Malaria Research Unit), Maesot, Thailand (40). The strain has a clearance rate of 8.37 h with a WT Kelch status.
Parasites were cultured by the method of Trager and Jensen (43) by using a gas mixture of 3% (vol/vol) O2, 3% (vol/vol) CO2, and 94% (vol/vol) N2. Complete medium used for propagation of P. falciparum cultures consists of RPMI medium 1640 supplemented with 30 mg/L hypoxanthine (Sigma), 25 mM Hepes (Sigma), 0.225% NaHCO3 (Sigma), 0.5% Albumax I (Life Technologies), and 10 μg/mL gentamycin (Life Technologies). Blasticidin S was purchased from Invitrogen.
To synchronize parasites asynchronous P. falciparum cultures were treated with 5% (wt/vol) Sorbitol (Sigma) for 10 min at 37 °C followed by wash with complete RPMI.
Synthesis of VMO Conjugates.
The VMO conjugates were synthesized by Genetools. The sequence of the MOs targeting splicing or translation was designed in collaboration with Genetools customer support and the company’s oligos design website. For translation-blocking MO, the software examines the first 25 bases of processed mRNA including the start codon and slides upstream until the requirement of an optimal MO is met that includes limited self-complementarity, 40–60% GC content, and no more than 3 contiguous G. For splice-blocking MO, exon–intron junctions were considered. The octaguanidine group was covalently conjugated to MO to prepare the VMO conjugates.
Synthesis of PPMO Conjugates.
The sequence to be targeted in DXR mRNA was selected using methods previously described (15, 39). A segment of DXR mRNA containing the 5′ end was transcribed in vitro and then end-labeled by T4 polynucleotide kinase in the presence of (α-32P) ATP. An aliquot of a random EGS library [rEGSx RNA (39)] was incubated with the labeled mRNA and assayed with Escherichia coli RNase P (M1 RNA and C5 protein) to determine possible sites of cleavage. Specific EGSs complementary to the selected sites were synthesized. The peptide YARVRRRGPRGYARVRRRGPRR was conjugated to a MO with the same sequence as the EGS to generate the PPMO (13).
Analysis of Gene Expression by Quantitative PCR.
The VMOs at 1 µM and PPMOs at 1 and 5 µM were added to ring-stage synchronized cultures at 10% parasitemia (2% hematocrit), and the cultures were incubated for 6 h at 37 °C. Total RNA extraction from untreated and treated parasite cultures was performed as previously described (44), and the concentration of RNA was determined using nanodrop. RNA samples were treated with 1 unit of RQ1 DNase (Promega), and the absence of DNA contamination was checked by real-time PCR. cDNA was then synthesized from total RNA using iScript cDNA synthesis kit (Bio-Rad). Real-time PCR was carried out using IQ SYBR green supermix (Biorad) using the real-time PCR system Bio-Rad [CFX (26)-96]. Data were analyzed using the comparative critical threshold (ΔΔCt) method in which the amount of target RNA was compared with Pf-β-actin1, which served as an internal control as previously described (45). Primers used for quantitative PCR (qPCR) are listed in Table S1.
Table S1.
Sequences of primer oligonucleotides used in the text
| No. | Primer | Sequence (exon bases in capital and intron bases in lowercase) |
| 1 | PfPMT-1F | TCAATATACGGATGAAGgtgct |
| 2 | PfPMT-1R | acatacaaaaatataatcatcgcatt |
| 2 | PfPMT-2F | TGCTGATATTCTTACTGCTTGC |
| 4 | PfPMT-2R | TTTTCTGGACCAGCCATCAT |
| 5 | PfPMT-3F | ACTCTGATAAAACATTCCTGGAAAA |
| 6 | PfPMT-3R | CCGTGAGTATGTGCTCCGTA |
| 7 | PfCRT-1F | TTTAGTACAAGAAGGAAgtaag |
| 8 | PfCRT-1R | cgtgagccatctgttaaggtc |
| 9 | PfCRT-2F | GGAGCATGGAAAACCTTCGC |
| 10 | PfCRT-2R | TCTCTTACAACATCACCGGCT |
| 11 | PfCRT-3F | GACGAGCGTTATAGAGAATTAGA |
| 12 | PfCRT-3R | AGTTGTGAGTTTCGGATGTT |
| 13 | PfDXR-F | ACATCAAAATGTGTTTCCATTG |
| 14 | PfDXR-R | AATTGGTTTCTTTATTGCACCA |
| 15 | Pf-β-actin1-F | AAAGAAGCAAGCAGGAATC |
| 16 | Pf-β-actin1-R | TGGTGCAAGGGTTGTAA |
Luciferase Assay.
VMOs were added to a 96-well plate with the final concentration as indicated. A highly synchronized luciferase expressing early ring-stage parasite culture was added to the plate containing conjugate. Plates were incubated for one cycle and two cycles at 37 °C in a gas chamber. The luciferase assay was carried out using Renilla Luciferase assay system (Promega E2820) as described in the assay protocol. Briefly, for data collection, 100 µL of the culture was centrifuged to remove the media. The lysis buffer (30 µL) was added to culture and shaken at room temperature for 15 min. Subsequently, one freeze thaw cycle was used during which lysed culture was stored at −80 °C and thawed at room temperature. After thawing, the culture was kept at room temperature for at least 1 h. Thereafter, 10 µL of the lysate was aliquoted in a luminescence-compatible plate, and 50 µL of the assay buffer was added to the lysate. Plates were read on a Synergy MX Biotek plate reader for luminescence.
Flow Cytometry.
For flow cytometry, cultures were treated as described above. After one and two cycles, 25 µL of culture was aliquoted into a U-bottom 96-well plate. The culture was washed with flow buffer (PBS with 1% FBS and 2 µM EDTA) and stained with Hoechst 33342 (Molecular Probes, R37605) or dihydroethidium (Sigma, R37291) for 25 min followed by washing with flow buffer. A 0.05% gluteraldehyde solution was used for fixing the sample before data collection in the STD-13L flow cytometry machine. Flow Jo was used for data analysis.
Statistical Analysis.
Statistical analyses was carried out in graphpad using unpaired Student’s t test.
Acknowledgments
We thank Drs. Francois Nosten, Tim Anderson, and Michael Ferdig for sharing the artemisinin slow-clearance strain and providing detailed information about the source and genetic properties of the strains. We thank colleagues for discussion. This work was supported by NIH Grants AI109486 and AI116930 (to C.B.M.) and Bill and Melinda Gates Foundation Grants OPP1086229 and OPP1069779 (to C.B.M.).
Footnotes
The authors declare no conflict of interest.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1515864112/-/DCSupplemental.
References
- 1.Baum J, et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic Acids Res. 2009;37(11):3788–3798. doi: 10.1093/nar/gkp239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Wagner JC, Platt RJ, Goldfless SJ, Zhang F, Niles JC. Efficient CRISPR-Cas9-mediated genome editing in Plasmodium falciparum. Nat Methods. 2014;11(9):915–918. doi: 10.1038/nmeth.3063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kolevzon N, Nasereddin A, Naik S, Yavin E, Dzikowski R. Use of peptide nucleic acids to manipulate gene expression in the malaria parasite Plasmodium falciparum. PLoS One. 2014;9(1):e86802. doi: 10.1371/journal.pone.0086802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Augagneur Y, Wesolowski D, Tae HS, Altman S, Ben Mamoun C. Gene selective mRNA cleavage inhibits the development of Plasmodium falciparum. Proc Natl Acad Sci USA. 2012;109(16):6235–6240. doi: 10.1073/pnas.1203516109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Straimer J, et al. Site-specific genome editing in Plasmodium falciparum using engineered zinc-finger nucleases. Nat Methods. 2012;9(10):993–998. doi: 10.1038/nmeth.2143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Balu B, et al. piggyBac is an effective tool for functional analysis of the Plasmodium falciparum genome. BMC Microbiol. 2009;9:83. doi: 10.1186/1471-2180-9-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Goldfless SJ, Wagner JC, Niles JC. Versatile control of Plasmodium falciparum gene expression with an inducible protein-RNA interaction. Nat Commun. 2014;5:5329. doi: 10.1038/ncomms6329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Prommana P, et al. Inducible knockdown of Plasmodium gene expression using the glmS ribozyme. PLoS One. 2013;8(8):e73783. doi: 10.1371/journal.pone.0073783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Summerton J. Morpholino antisense oligomers: The case for an RNase H-independent structural type. Biochim Biophys Acta. 1999;1489(1):141–158. doi: 10.1016/s0167-4781(99)00150-5. [DOI] [PubMed] [Google Scholar]
- 10.Guerrier-Takada C, Salavati R, Altman S. Phenotypic conversion of drug-resistant bacteria to drug sensitivity. Proc Natl Acad Sci USA. 1997;94(16):8468–8472. doi: 10.1073/pnas.94.16.8468. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lundblad EW, Altman S. Inhibition of gene expression by RNase P. N Biotechnol. 2010;27(3):212–221. doi: 10.1016/j.nbt.2010.03.003. [DOI] [PubMed] [Google Scholar]
- 12.Wesolowski D, et al. Basic peptide-morpholino oligomer conjugate that is very effective in killing bacteria by gene-specific and nonspecific modes. Proc Natl Acad Sci USA. 2011;108(40):16582–16587. doi: 10.1073/pnas.1112561108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wesolowski D, Alonso D, Altman S. Combined effect of a peptide-morpholino oligonucleotide conjugate and a cell-penetrating peptide as an antibiotic. Proc Natl Acad Sci USA. 2013;110(21):8686–8689. doi: 10.1073/pnas.1306911110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Forster AC, Altman S. External guide sequences for an RNA enzyme. Science. 1990;249(4970):783–786. doi: 10.1126/science.1697102. [DOI] [PubMed] [Google Scholar]
- 15.Guerrier-Takada C, Altman S. Inactivation of gene expression using ribonuclease P and external guide sequences. Methods Enzymol. 2000;313:442–456. doi: 10.1016/s0076-6879(00)13028-9. [DOI] [PubMed] [Google Scholar]
- 16.Augagneur Y, et al. Identification and functional analysis of the primary pantothenate transporter, PfPAT, of the human malaria parasite Plasmodium falciparum. J Biol Chem. 2013;288(28):20558–20567. doi: 10.1074/jbc.M113.482992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Morcos PA. Achieving targeted and quantifiable alteration of mRNA splicing with Morpholino oligos. Biochem Biophys Res Commun. 2007;358(2):521–527. doi: 10.1016/j.bbrc.2007.04.172. [DOI] [PubMed] [Google Scholar]
- 18.Nasevicius A, Ekker SC. Effective targeted gene ‘knockdown’ in zebrafish. Nat Genet. 2000;26(2):216–220. doi: 10.1038/79951. [DOI] [PubMed] [Google Scholar]
- 19.Colin FC, Schrier SL. Spontaneous endocytosis in human neonatal and adult red blood cells: Comparison to drug-induced endocytosis and to receptor-mediated endocytosis. Am J Hematol. 1991;37(1):34–40. doi: 10.1002/ajh.2830370108. [DOI] [PubMed] [Google Scholar]
- 20.Samuel BU, et al. Delivery of antimicrobials into parasites. Proc Natl Acad Sci USA. 2003;100(24):14281–14286. doi: 10.1073/pnas.2436169100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wender PA, Kreider E, Pelkey ET, Rothbard J, Vandeusen CL. Dendrimeric molecular transporters: Synthesis and evaluation of tunable polyguanidino dendrimers that facilitate cellular uptake. Org Lett. 2005;7(22):4815–4818. doi: 10.1021/ol051496y. [DOI] [PubMed] [Google Scholar]
- 22.Wender PA, et al. The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: Peptoid molecular transporters. Proc Natl Acad Sci USA. 2000;97(24):13003–13008. doi: 10.1073/pnas.97.24.13003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Rothbard JB, et al. Conjugation of arginine oligomers to cyclosporin A facilitates topical delivery and inhibition of inflammation. Nat Med. 2000;6(11):1253–1257. doi: 10.1038/81359. [DOI] [PubMed] [Google Scholar]
- 24.Li Y-F, Morcos PA. Design and synthesis of dendritic molecular transporter that achieves efficient in vivo delivery of morpholino antisense oligo. Bioconjug Chem. 2008;19(7):1464–1470. doi: 10.1021/bc8001437. [DOI] [PubMed] [Google Scholar]
- 25.Pérez B, et al. Pseudoexon exclusion by antisense therapy in methylmalonic aciduria (MMAuria) Hum Mutat. 2009;30(12):1676–1682. doi: 10.1002/humu.21118. [DOI] [PubMed] [Google Scholar]
- 26.Wu B, et al. Octa-guanidine morpholino restores dystrophin expression in cardiac and skeletal muscles and ameliorates pathology in dystrophic mdx mice. Mol Ther. 2009;17(5):864–871. doi: 10.1038/mt.2009.38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim S, Radhakrishnan UP, Rajpurohit SK, Kulkarni V, Jagadeeswaran P. Vivo-Morpholino knockdown of alphaIIb: A novel approach to inhibit thrombocyte function in adult zebrafish. Blood Cells Mol Dis. 2010;44(3):169–174. doi: 10.1016/j.bcmd.2009.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Matsuda H, Shi YB. An essential and evolutionarily conserved role of protein arginine methyltransferase 1 for adult intestinal stem cells during postembryonic development. Stem Cells. 2010;28(11):2073–2083. doi: 10.1002/stem.529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lai BS, et al. Molecular target validation, antimicrobial delivery, and potential treatment of Toxoplasma gondii infections. Proc Natl Acad Sci USA. 2012;109(35):14182–14187. doi: 10.1073/pnas.1208775109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Witola WH, et al. Disruption of the Plasmodium falciparum PfPMT gene results in a complete loss of phosphatidylcholine biosynthesis via the serine-decarboxylase-phosphoethanolamine-methyltransferase pathway and severe growth and survival defects. J Biol Chem. 2008;283(41):27636–27643. doi: 10.1074/jbc.M804360200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yeh E, DeRisi JL. Chemical rescue of malaria parasites lacking an apicoplast defines organelle function in blood-stage Plasmodium falciparum. PLoS Biol. 2011;9(8):e1001138. doi: 10.1371/journal.pbio.1001138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sidhu AB, Verdier-Pinard D, Fidock DA. Chloroquine resistance in Plasmodium falciparum malaria parasites conferred by pfcrt mutations. Science. 2002;298(5591):210–213. doi: 10.1126/science.1074045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Salazar E, et al. Characterization of Plasmodium falciparum adenylyl cyclase-β and its role in erythrocytic stage parasites. PLoS One. 2012;7(6):e39769. doi: 10.1371/journal.pone.0039769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ferguson DP, Dangott LJ, Lightfoot JT. Lessons learned from vivo-morpholinos: How to avoid vivo-morpholino toxicity. Biotechniques. 2014;56(5):251–256. doi: 10.2144/000114167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Fidock DA, et al. Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol Cell. 2000;6(4):861–871. doi: 10.1016/s1097-2765(05)00077-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Pessi G, Kociubinski G, Mamoun CB. A pathway for phosphatidylcholine biosynthesis in Plasmodium falciparum involving phosphoethanolamine methylation. Proc Natl Acad Sci USA. 2004;101(16):6206–6211. doi: 10.1073/pnas.0307742101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Danckwardt S, et al. Abnormally spliced beta-globin mRNAs: A single point mutation generates transcripts sensitive and insensitive to nonsense-mediated mRNA decay. Blood. 2002;99(5):1811–1816. doi: 10.1182/blood.v99.5.1811. [DOI] [PubMed] [Google Scholar]
- 38.Prasad R, et al. Blocking Plasmodium falciparum development via dual inhibition of hemoglobin degradation and the ubiquitin proteasome system by MG132. PLoS One. 2013;8(9):e73530. doi: 10.1371/journal.pone.0073530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lundblad EW, Xiao G, Ko JH, Altman S. Rapid selection of accessible and cleavable sites in RNA by Escherichia coli RNase P and random external guide sequences. Proc Natl Acad Sci USA. 2008;105(7):2354–2357. doi: 10.1073/pnas.0711977105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Phyo AP, et al. Emergence of artemisinin-resistant malaria on the western border of Thailand: A longitudinal study. Lancet. 2012;379(9830):1960–1966. doi: 10.1016/S0140-6736(12)60484-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Waller KL, et al. Chloroquine resistance modulated in vitro by expression levels of the Plasmodium falciparum chloroquine resistance transporter. J Biol Chem. 2003;278(35):33593–33601. doi: 10.1074/jbc.M302215200. [DOI] [PubMed] [Google Scholar]
- 42.McKinney J, Guerrier-Takada C, Wesolowski D, Altman S. Inhibition of Escherichia coli viability by external guide sequences complementary to two essential genes. Proc Natl Acad Sci USA. 2001;98(12):6605–6610. doi: 10.1073/pnas.121180398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Trager W, Jensen JB. Human malaria parasites in continuous culture. Science. 1976;193(4254):673–675. doi: 10.1126/science.781840. [DOI] [PubMed] [Google Scholar]
- 44.Kyes S, Pinches R, Newbold C. A simple RNA analysis method shows var and rif multigene family expression patterns in Plasmodium falciparum. Mol Biochem Parasitol. 2000;105(2):311–315. doi: 10.1016/s0166-6851(99)00193-0. [DOI] [PubMed] [Google Scholar]
- 45.Ferreira ID, Rosário VE, Cravo PV. Real-time quantitative PCR with SYBR Green I detection for estimating copy numbers of nine drug resistance candidate genes in Plasmodium falciparum. Malar J. 2006;5:1. doi: 10.1186/1475-2875-5-1. [DOI] [PMC free article] [PubMed] [Google Scholar]







