Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Sep 30.
Published in final edited form as: Mol Cell. 2008 Sep 5;31(5):641–649. doi: 10.1016/j.molcel.2008.08.012

Activation of 12/23-RSS-Dependent RAG Cleavage by hSWI/SNF Complex in the Absence of Transcription

Hansen Du 1, Haruhiko Ishii 2, Michael J Pazin 1, Ranjan Sen 1,*
PMCID: PMC4589277  NIHMSID: NIHMS68988  PMID: 18775324

SUMMARY

Maintenance of genomic integrity during antigen receptor gene rearrangements requires (1) regulated access of the V(D)J recombinase to specific loci and (2) generation of double-strand DNA breaks only after recognition of a pair of matched recombination signal sequences (RSSs). Here we recapitulate both key aspects of regulated recombinase accessibility in a cell-free system using plasmid substrates assembled into chromatin. We show that recruitment of the SWI/SNF chromatin-remodeling complex to both RSSs increases coupled cleavage by RAG1 and RAG2 proteins. SWI/SNF functions by altering local chromatin structure in the absence of RNA polymerase II-dependent transcription or histone modifications. These observations demonstrate a direct role for cis-sequence-regulated local chromatin remodeling in RAG1/2-dependent initiation of V(D)J recombination.

INTRODUCTION

Genes that encode B and T lymphocyte antigen receptors are assembled by somatic DNA rearrangements. This process, known as V(D)J recombination, is initiated by lymphocyte-specific RAG1 and RAG2 proteins that generate double-strand DNA breaks at recombination signal sequences (RSS) associated with rearrangeable gene segments (Dudley et al., 2005; Schatz, 2004). Subsequent processing and religation of broken DNA ends is carried out by ubiquitously expressed nonhomologous end-joining enzymes (Roth, 2003). While lymphoid-restricted expression of RAG1 and RAG2 provides one level of specificity, additional constraints at the level of substrate DNA are required to discriminate between the seven antigen receptor loci in the genome. The conceptual basis for understanding tissue and developmental stage specificity of gene rearrangements was proposed by Alt and colleagues in the form of the accessibility hypothesis (Yancopoulos and Alt, 1985). The crux of this model is that access of RAG proteins is restricted to only the appropriate antigen receptor locus in a given cell lineage and developmental stage. For example, RAG proteins can catalyze double-strand DNA breaks at immunoglobulin (Ig) genes in B cells, but not at T cell receptor (TCR) genes, because only the Ig genes are available as recombinase substrates in this lineage. Conversely, TCR genes are only available to RAG proteins in the T lineage.

cis-regulatory sequences that were originally identified as transcriptional enhancers are a major determinant of tissue specificity of V(D)J recombination. The earliest evidence for this came from analysis of transgenic recombination substrates that were recombinationally inert in the absence of enhancers, but recombined in the appropriate cell lineage in presence of an enhancer (Capone et al., 1993; Fernex et al., 1995; Lauzurica and Krangel, 1994; Okada et al., 1994). Conversely, enhancer deletion from endogenous genes attenuates V(D)J recombination (Bouvier et al., 1996; Sleckman et al., 1997). Transcriptional promoters within antigen receptor loci also serve as accessibility control elements (ACEs) for V(D)J recombination (Cobb et al., 2006). Two well-characterized examples are the Dβ1 promoter of the TCRβ locus and the TEA promoter located 5′ of Jα gene segments in the TCRα locus. Germline deletion of either promoter reduces recombination of nearby gene segments (Dudley et al., 2005; Villey et al., 1996; Whitehurst et al., 2000), despite the continued presence of associated enhancers. In general, ACE activity of promoters works locally, while enhancers work at longer distances (Bouvier et al., 1996; Sleckman et al., 1997), rather like the role of these elements in transcription. While the importance of promoters and enhancers for V(D)J recombination is well established, the biochemical basis for how they enable RAG protein access to appropriate loci is less clear.

RAG accessibility was connected to chromatin structure in the earliest studies (Yancopoulos et al., 1986). A growing compendium of experimental evidence now supports this idea. One line of evidence stems from identification of developmentally regulated covalent histone modifications that correlate with recombinogenic potential. The best characterized of these modifications is histone acetylation, which is invariably higher at gene segments that are poised to recombine (Krangel, 2003; Sen and Oltz, 2006). Conversely, histone H3 methylation at lysine 9, a marker of inactive chromatin, correlates with recombinational inactivity (Johnson et al., 2004; Morshead et al., 2003). A second line of evidence comes from targeting chromatin-modifying enzymes to stably transfected recombination substrates. Using a RAG-inducible cell line model, Oltz and colleagues demonstrated that the ATP-dependent chromatin-remodeling enzyme BRG1 can substitute for the ACE activity of a transcriptional promoter (Osipovich et al., 2007). Conversely, recruitment of a H3K9 methyl transferase, G9a, overrides the presence of an enhancer and blocks recombination (Osipovich et al., 2004). Finally, nucleosome positioning by the RSS sequence has also been proposed to regulate RAG access to DNA (Baumann et al., 2003).

Several biochemical studies have addressed the role of nucleosomes in RAG1/2 accessibility to substrate DNA. A common feature to emerge from these studies is that 12- or 23-RSS-containing DNA that is assembled into mononucleosomes is largely refractory to cleavage by RAG1/2 compared with naked DNA (Golding et al., 1999; Kwon et al., 1998, 2000; McBlane and Boyes, 2000; Nightingale et al., 2007). Nucleosomal repression can be relieved to varying extents by altered phasing, or use of hyperacetylated histones. The SWI/SNF chromatin-remodeling complex cooperated with acetylated nucleosomes to increase RAG cleavage (Kwon et al., 2000), particularly at the 12-RSS. However, the effects of histone acetylation were less evident when RSS-containing DNA was assembled into nucleosomal arrays using ribosomal RNA genes to precisely position nucleosomes on a linear DNA fragment (Patenge et al., 2004). Despite some unresolved discrepancies, these studies laid the groundwork for mechanistic analyses of RAG1/2 accessibility in the chromatin context.

RSSs come in two types. The 12-RSS comprises a highly conserved heptamer sequence that is separated from a recognizable, but less conserved, nonamer sequence by a 12 bp spacer, while in the 23-RSS the heptamer and nonamer elements are separated by 23 bp. A hallmark of the RAG1/2 reaction at accessible loci is coupling of double-strand breaks to joint recognition of RSSs that contain 12 and 23 bp spacers. The reaction has been proposed to proceed via initial nicking of the 12 bp RSS followed by conversion of the nick to a double-strand break only in the presence of a 23 bp RSS (Curry et al., 2005; Jones and Gellert, 2002). The requirement for cleavage that is coupled to 12- and 23-RSS recognition minimizes genomic instability due to random RAG1/2-induced DNA breaks. Taken together, cis-sequence-dependent accessibility changes and 12/23-dependent coupled cleavage are key regulatory features of V(D)J recombination.

Here we recapitulate these two important aspects of regulated RAG1/2 accessibility in a cell-free system. Using plasmids assembled into chromatin, we demonstrate (1) regulatory sequence-dependent increase of RAG1/2 accessibility and (2) 12/23-dependent coupled cleavage of chromatin substrates. Our regulatory sequence consisted of multimerized Gal4 binding sites to which Gal4-VP16 fusion protein was recruited as the activating transcription factor; this approach was predicated on earlier studies that show that the VP16 transactivation domain activates V(D)J recombination in vivo (Sikes et al., 1999). Gal4-VP16 binding was required close to both RSSs for efficient RAG1/2 cleavage and worked by programming local chromatin remodeling. These effects were independent of RNA polymerase II-mediated transcription and histone modifications, suggesting that localized chromatin alterations directly facilitate initiation of V(D)J recombination by RAG proteins.

RESULTS

Gal-4-VP16 Binding Near Both RSSs Is Required for 12/23-Dependent RAG Cutting

To recapitulate constraints placed on V(D)J recombination by chromatin structure, we used Drosophila melanogaster embryo (S190) extracts to assemble 12-RSS- and 23-RSS-containing plasmids into chromatin and used them as substrates in coupled-cleavage assays. The plasmids were distinguished by the length of the intervening spacer, or by the presence of Gal4 binding sites near one, or both, RSSs (Figure 1A). Chromatin assembly was followed by incubation with transcriptional activators according to the scheme shown in Figure 1B. Thereafter, a portion of the assembly reaction was treated with micrococcal nuclease to confirm chromatin assembly (Figure 1C), or with DNase I to follow DNA binding of Gal4 derivatives. The remaining assembly reaction was treated with recombinant MBP-RAG1 and GSTRAG2 core fusion proteins. We determined RAG cleavage efficiency using Southern blots to detect the fragment released as a result of 12- and 23-RSS-dependent coupled cleavage. Chromatin assembly severely inhibited RAG cleavage of all test plasmids (Figure 1D, compare lanes 2, 5, 8, and 11 to 1,4, 7, and 10), which was partially restored only in the substrate that contained Gal4 binding sites close to both RSSs (Figure 1D, compare lanes 8 and 9 to 11 and 12) and only in the presence of Gal4-VP16. Thus, efficient RAG cleavage in vitro required activating sequences adjacent to both RSSs and an activator, paralleling observations in vivo in B cells (Sikes et al., 2002).

Figure 1. 12- and 23-RSS-Dependent RAG Cleavage of Nucleosome-Assembled Plasmids.

Figure 1

Open in a new tab

(A) Plasmids that contain 12- and 23-RSS (indicated by solid and open triangles, respectively) in deletion orientation. pLPd-Δ has a shorter spacer between the two RSSs and was used as an internal control in RAG cleavage assays. pLPd-G4 and pLPd-(G4)2 contain one or two sets of five tandem GAL4 sites located close to the 12- or 23-RSS, respectively. RAG1/2-induced coupled cleavage results in cuts at the vertical sides of the RSS triangles and release of the intervening DNA of sizes as indicated. This fragment was detected by Southern blots using a HincII-HindIII (392 bp) fragment as a probe.

(B) Chromatin assembly in Drosophila embryo S190 extracts was followed by transcription factor binding in the presence or absence of hSWI/SNF for 30 min. A portion of the reaction was used for RAG cleavage by supplementing the assembly reaction with purified MBP-RAG1, GST-RAG2 core, and HMG2 proteins obtained as described in the Experimental Procedures. After RAG1/2 cleavage, the DNA was purified, fractionated through 1.1% agarose gels, and transferred to nylon membranes, and the cleavage product was detected by hybridization to the probe described in (A). The remainder of the assembly reaction was treated with micrococcal nuclease to confirm chromatin assembly, or with DNase I to analyze transcription factor DNA binding or the generation of DNase I-hypersensitive sites as described.

(C) DNA purified from micrococcal nuclease treated assembly reactions was fractionated through 1.1% agarose gels and visualized by ethidium bromide staining. Lane 1, 100 bp DNA ladder; lanes 2–3, chromatin samples digested with decreasing concentrations of micrococcal nuclease.

(D) Deletion substrates indicated above the gel were used for RAG cleavage before (lanes 1, 4, 7, and 10) or after chromatin assembly (lanes 2, 5, 8, and 11). Gal4-VP16 was added to a subset of reactions for 30 min prior to RAG cleavage (lanes 3, 6, 9, and 12). The numbers below the lanes show the level of RAG cleavage of assembled DNA in the presence of Gal4-VP16 normalized to that in its absence for each plasmid substrate. A typical experiment of several independent experiments is shown.

To determine whether enhanced RAG cleavage required the VP16 portion of the fusion protein, we used recombinant Gal4-DNA binding domain (Gal4-DBD) in this assay. Unlike Gal4-VP16, Gal4-DBD did not increase RAG cleavage (Figure 2A, lanes 2 and 3). The average of several such experiments is shown in Figure 2B. The inability to enhance RAG cleavage was not due to reduced DNA binding by Gal4-DBD (Figure 2C, lanes 2 and 3). Moreover, Gal4-DBD binding induced DNase I-hypersensitive sites near each RSS that were indistinguishable from those induced by Gal4-VP16 (Figure 2D, lanes 2 and 3). We concluded that the VP16 transactivation domain was essential to increase RAG cleavage in vitro; moreover, the increase was not a trivial consequence of differential DNA binding by the two proteins, or differences in their ability to modify chromatin structure as evidenced by the generation of DNase I-hypersensitive sites. These observations suggest that Gal4-VP16 recruits an activity present in S190 extracts to enhance RAG cleavage.

Figure 2. hSWI/SNF Enhances Gal4-VP16-Dependent RAG1/2 Cleavage In Vitro.

Figure 2

Open in a new tab

(A) pLPd-(G4)2 and pLPd-Δ (internal control) were assembled into nucleosomes using S190 extracts. Separate aliquots of the assembly reaction were incubated with Gal4-VP16 or Gal4-DBD in the presence or absence of hSWI/SNF as indicated above the figure, followed by RAG1/2 cleavage. The DNA fragments released after RAG cleavage were detected by Southern blotting and are labeled to the left of the figure.

(B) Signal intensities of RAG cleavage products of test plasmids were normalized to the internal control (pLPd-Δ) after phosphorimager quantitation. The efficiency of RAG cleavage (y axis) between conditions is represented after normalization to that of pLPd-(G4)2 alone (lane 1), which is arbitrarily set to 1. The numbers below each bar corresponds to lane numbers in (A). Error bars represent the standard deviation between three independent experiments derived using TTEST (Microsoft Office Excel, 2003).

(C) DNase I footprinting analyses of assembly reactions that contain different combinations of transcription factors and hSWI/SNF complex. An aliquots of each sample was digested with DNase I, and the purified DNA was analyzed by primer extension. The first four lanes are di-deoxy sequencing reactions. The bracket shows the region protected from DNase I digestion by Gal4-derivative binding near the 12-RSS; similar results were obtained with Gal4 binding sites near the 23-RSS. Representative data from one of five experiments is shown.

(D) Induction of DNase I-hypersensitive sites by Gal4 fusion proteins. Chromatin assembly was carried out under conditions indicated above the gel, followed by DNase I digestion. Purified DNA was digested with DraI located 3′ of the 23-RSS and at two additional sites within 1 kb. The products were separated by agarose gel electrophoresis and transferred to nylon membranes, which were hybridized to an oligonucleotide probe between the 23-RSS and the first DraI site. Hypersensitive sites at the 12-RSSs (top) and 23-RSSs (bottom) are indicated by triangles. Data shown are representative of five independent experiments.

Gal4-VP16 Increases RAG Cleavage by Recruiting Chromatin-Remodeling Activity

As a prototypic transcriptional transactivation domain, VP16 interacts with multiple chromatin-related components, such as SWI/SNF and SAGA complexes (Neely et al., 1999; Vignali et al., 2000) as well as components of the RNA polymerase II (Pol II) transcriptional machinery (Chi et al., 1995; Roberts and Green, 1994). Because S190 extracts contain very little Pol II activity, we investigated whether Gal4-VP16 function in our assay was mediated by chromatin-remodeling factors. For this we included purified human SWI/SNF complex in the RAG cleavage assay. We found that hSWI/SNF complex further increased RAG cleavage in reactions that contained Gal4-VP16 (Figures 2A and 2B, lanes 1, 4, and 5) but not those that contained Gal4-DBD (Figures 2A and 2B, lanes 1–3) or no added transcription factor (Figures 2A and 2B, lane 6). The hSWI/SNF complex did not alter DNA binding by Gal4 derivatives (Figure 2C) or chromatin structure as assessed by DNase I hypersensitivity (Figure 2D). These observations indicate that Gal4-VP16 recruited hSWI/SNF remodeling activity to enhance RAG cleavage in vitro. We infer that, in the absence of exogenous SWI/SNF, Gal4-VP16 recruits endogenous remodeling activities present in the S190 extract.

Because we did not detect differences in the formation of DNase I-hypersensitive sites between Gal4-DBD and Gal4-VP16, we used restriction enzyme accessibility to monitor local structural alterations. After chromatin assembly and transcription factor binding, reaction aliquots were treated with increasing concentration of BamHI, an enzyme that cuts between Gal4 binding sites and the 12-RSS (Figure 3). Following digestion, the DNA was purified and linearized with AlwNI; the released AlwNI/BamHI fragments were detected by Southern blotting. Gal4-DBD binding increased BamHI cutting compared to a reaction that contained no added transcription factor, consistent with its ability to induce DNase I hypersensitivity (Figure 3, lanes 1–6, note the ratio of linearized DNA to the released fragment). However, BamHI digestion was further increased in the presence of Gal4-VP16 (Figure 3, lanes 6 and 9, and averaged from three experiments in Figure 3B). These observations indicate that Gal4-VP16, but not Gal4-DBD, induces additional structural changes beyond those detected by DNase I hypersensitivity. We suggest that these local structural changes at each RSS are responsible for increased RAG1/2 accessibility to chromatin substrates.

Figure 3. Gal4-VP16 Increases Restriction Endonuclease Access to RSS.

Figure 3

Open in a new tab

(A) Chromatin assembly was carried out using S190 extracts followed by incubation with Gal4-DBD (lanes 4–6) or Gal4-VP16 (lanes 7–9). After transcription factor binding, aliquots were treated with increasing concentrations of BamHI, which cuts at a site between the Gal4-binding sites and the 12-RSS as indicated on the top line. Purified DNA was then cut to completion with AlwNI and fractionated by agarose gel electrophoresis, and the BamHI-AlwNI fragment was detected by Southern blotting using the indicated probe. Data shown are representative of three independent experiments.

(B) The ratio of BamHI cut to uncut DNA (y axis) was averaged for three experiments at the enzyme concentration corresponding to lanes 3, 6, and 9 of (A) (indicated on the x axis). Error bars represent the standard deviation between experiments derived using TTEST (Microsoft Office Excel, 2003).

Enhanced 12/23-Dependent Cleavage of Inversion Substrates In Vitro

The preceding experiments utilized plasmids in which the relative orientation of the RSSs generates a so-called “deletion” substrate. In this orientation, the DNA between the two sites of cleavage is lost from the genome upon completion of recombination. V(D)J recombination also occurs by inversion of the intervening DNA between the two cleavage sites. To determine whether RAG accessibility requirements for inversion substrates were similar to those for deletion substrates, we generated a set of plasmids (Figure 4A). RAG cutting was comparable between unassembled deletion and inversion substrates (Figure S1).

Figure 4. Analysis of V(D)J Recombination Inversion Substrates In Vitro.

Figure 4

Open in a new tab

(A) Inversion substrates were generated as described in the Experimental Procedures. Except for the orientation of 12-RSS, all other parts of the substrate plasmids are the same as the deletion substrates. The sizes of the fragments released after RAG cleavage change slightly compared to plasmids described in Figure 1 as noted.

(B) Inversion substrates and internal control (pLPi-Δ) were assembled into chromatin using S190 extracts, incubated with Gal4 derivatives in the presence or absence of hSWI/SNF, and subjected to RAG cleavage. The released fragment was detected by Southern blotting as described in Figures 1 and 2. Data shown are representative of three independent experiments.

RAG accessibility of chromatin reconstituted inversion substrates paralleled the observations with deletion substrates (Figure 4B). Gal4-VP16 induced 12/23-dependent cleavage by itself, which was further increased by additional SWI/SNF complex (Figure 4B, lanes 1, 4, and 5); in contrast, Gal4-DBD did not increase RAG1/2 accessibility (Figure 4B, lanes 1–3). DNase I footprinting and hypersensitive site assays confirmed that differences in the RAG1/2 reaction were not due to differential binding of Gal4 derivatives (data not shown). Furthermore, directing SWI/SNF to only one of the two RSSs was not sufficient to enhance RAG cleavage over baseline (Figure S2). These observations indicate that RAG accessibility requirements in the in vitro system are the same for both deletion and inversion substrates.

Regulated RAG Accessibility Using Recombinant Chromatin

The effects of Gal4-VP16 in S190 extracts without additional hSWI/SNF complex suggested a role for other extract-derived factors in enhancing RAG cleavage. To rule out participation of uncharacterized activities from S190 extracts, we reconstituted RAG cleavage using recombinant ACF, topoisomerase I, and NAP-1 to assemble chromatin (Fyodorov and Kadonaga, 2003) (Figure 5A, left panel; Figures S3A and S3B). In this system both Gal4-DBD and Gal4-VP16 generated DNase I-hypersensitive sites (Figure 5A, right panel, lanes 1, 2, and 4), but neither influenced RAG cleavage in the absence of hSWI/SNF (Figure 5B, lanes 1, 2, and 4). We inferred that chromatin-remodeling activity of ACF was insufficient to increase RAG accessibility to the RSSs. Inclusion of SWI/SNF complex in these reactions increased RAG cleavage in the presence of Gal4-VP16 but not Gal4-DBD (Figure 5B, lanes 1, 3, and 5 and quantitated in Figure 5C) without affecting DNA binding or the ability to generate DNase I-hypersensitive sites by Gal4 derivatives (Figure 5A, right panel, and data not shown). We conclude that SWI/SNF recruitment by VP16 increases RAG accessibility for 12/23-dependent coupled cleavage.

Figure 5. 12- and 23-RSS-Dependent RAG1/2 Cleavage Using Recombinant Proteins.

Figure 5

Open in a new tab

(A) pLPd-(G4)2 and pLPd-Δ were assembled into chromatin using ACF purified from SF9 cells, NAP1 and topoisomerase I (expressed in bacteria), and Drosphila histones. Chromatin assembly was verified by micrococcal nuclease digestion (left panel). After assembly the chromatin was incubated with transcription factors and hSWI/SNF as required. Induction of DNase I-hypersensitive sites (right panel) at the 12- and 23-RSSs (top and bottom triangles, respectively) was assessed as described in the Figure 2 legend. Data shown are representative of three independent experiments.

(B and C) Following transcription factor binding, the substrates were treated with RAG1/2, and cleavage products were visualized by Southern blotting. Data shown are representative of three independent experiments whose average is shown in (C). Quantitation was carried out as described in Figure 2B. Numbers below the bars correspond to lane numbers in (B). Error bars represent the standard deviation between three independent experiments derived using TTEST (Microsoft Office Excel, 2003).

(D–F) Deletion substrates were assembled into chromatin using recombinant histone octamer and S190 extracts. Assembly was verified by micrococcal nuclease (Mnase) digestion (D), and after incubation with transcription factors and hSWI/SNF as indicated, RAG1/2 cleavage assays were performed (E). The fragment released after 12/23 coupled cleavage was visualized by Southern blotting as described in Figure 2B. pLPd-Δ served as the normalizing control. A representative experiment out of four is shown. All four are averaged in (F) with error bars representing standard deviation between experiments derived using TTEST (Microsoft Office Excel, 2003).

In the experiments described above, we used purified Drosophila cell histones to assemble chromatin. Such preparations were likely to have varying levels of covalently modified histones. To determine the contribution of chromatin remodeling per se to regulate RAG accessibility in the absence of histone modifications, we used recombinant histones (Figure S3C) for chromatin assembly (Figure 5D). RAG1/2 cleavage in the presence, or absence, of added activator was assessed by Southern blotting. We observed maximal stimulation of 12/23 coupled cleavage in the presence of Gal4-VP16 and purified SWI/SNF (Figure 5E, quantitated in 5F); Gal4-DBD did not increase cleavage by itself, or together with hSWI/SNF. Similar results were obtained with chromatin generated using recombinant histones and recombinant chromatin assembly proteins (date not shown). We conclude that the observed increase of core RAG accessibility is independent of the state of histone modifications. The noncore regions of both RAG proteins have been shown to contribute to V(D)J recombination in vivo (Akamatsu et al., 2003; Dudley et al., 2003; Liang et al., 2002). The N-terminal domain of RAG1, which contains structural motifs as well as E3 ligase activity, may affect protein stability or association (Sadofsky, 2004), while the C-terminal domain of RAG2 binds phosphoinositides (Elkin et al., 2005), core histones (West et al., 2005), and H3K4me3 via a PHD domain (Liu et al., 2007; Matthews et al., 2007). The contribution of these noncore domains to recombination initiation in our in vitro system remains to be evaluated.

The Role of Transcription in the RAG1/2 Cleavage Reaction

Gene segments that rearrange are invariably transcribed in the appropriate lymphoid lineage (Bassing et al., 2002). However, some actively transcribed gene segments can be recombinationally inert (Fernex et al., 1995; Okada et al., 1994; Sikes et al., 2002); conversely, transcriptionally inert gene segments may undergo V(D)J recombination (Angelin-Duclos and Calame, 1998). Furthermore, V(D)J recombination in minichromosomes is not affected by transcription, but subject to DNA methylation-induced changes in chromatin structure (Hsieh and Lieber, 1992; Hsieh et al., 1992). Most recently, introduction of a transcription terminator into the Jα region of the TCRα locus has suggested that RNA synthesis itself may positively regulate V(D)J recombination (Abarrategui and Krangel, 2006). To address the role of transcription in regulating V(D)J recombination, we established conditions to simultaneously assay transcription and 12/23-dependent cleavage on chromatin templates.

Following chromatin assembly and transcription factor binding in the presence or absence of hSWI/SNF, we added transcriptionally competent nuclear extracts (NE) derived from BJAB B lymphoma cells to the reaction (Figure 6A). A major transcription start site from chromatin-assembled templates coincided with the last Gal4 binding site before the 12-RSS (Figure S4A). After further incubation with recombinant RAG proteins, we determined RAG cleavage efficiency. BJAB NE suppressed basal and Gal4-VP16-induced RAG cleavage of substrates assembled into chromatin using S190 extracts (Figure 6B, compare lanes 3–5 with lanes 12–14). The inhibitory effect of BJAB NE on RAG cleavage was partially overcome by treatment of NE with α-amanitin (Figure 6B, lanes 8–10, averaged in Figure 6C), leading to increased RAG1/2 cleavage in the presence of Gal4-VP16 and SWI/SNF that was comparable to that seen in S190 extracts alone. We verified that a-amanitin blocked BJAB NE-dependent RNA polymerase II transcription using RT-PCR (Figures S4B and S4C). We conclude that RNA polymerase II-dependent transcription conferred by BJAB NE inhibits RAG cleavage.

Figure 6. Transcription-Coupled Cleavage of 12- and 23-RSS by RAG1/2 In Vitro.

Figure 6

Open in a new tab

(A) pLPd-(G4)2 plasmid was assembled into chromatin using S190 extracts followed by incubation with Gal4-VP16 and SWI/SNF, as indicated in (B) and (C). Nuclear extracts from BJAB B lymphoma cells were used to initiate transcription for 30 min followed by addition of RAG1, RAG2, and HMG2 for additional 2 hr. RAG1/2 cleavage was assayed by Southern blotting and RNA purified for RT-PCR analysis (Figure S4).

(B) Unassembled plasmids (lanes 1, 2, 6, 7, and 11) or chromatin-assembled plasmids (all other lanes) were used in RAG1/2 cleavage assays according to the experimental design outlined in (A). The control plasmid pLPd-Δ was included just prior to addition of RAG1/2 and was therefore not assembled into chromatin. BJAB extracts were pretreated with 40 μg/ml α-amanitin for 10 min prior to use in the indicated reactions (lanes 7–10). RAG1/2 cleavage products were detected by Southern hybridization (indicated by arrows). Data shown are representative of three independent experiments.

(C) Signal intensities of RAG cleavage products from pLPd-(G4)2 were normalized to that of pLP-Δ after phosphorimager quantitation. The efficiency of RAG cleavage (y axis) between conditions is represented after normalization to the value in lane 3, which is set to 1. Numbers below each bar correspond to the lane numbers of the autoradiogram in (B). Error bars represent the standard deviation between three independent experiments derived using TTEST (Microsoft Office Excel, 2003).

DISCUSSION

We have recapitulated cis-sequence-dependent RAG1/2 access to substrate DNA and 12- and 23-RSS-dependent induction of DNA double-strand breaks using chromatin-assembled templates in a cell-free system. We show that coupled cleavage requires Gal4-VP16 binding close to each RSS, analogous to the in vivo observations of Sikes et al. (1999). Our working hypothesis is that Gal4-VP16 recruitment in our assay more closely mimics the role of promoters, rather than enhancers, as activators of recombination.

We recognize that multimerized Gal4 binding sites lack the complex organization of antigen receptor gene enhancers and promoters. However, analysis of Gal4-VP16 function has proved to be a valuable surrogate for understanding molecular mechanisms of transcription regulation (Chi et al., 1995; Roberts and Green, 1994). We use it here in the same reductionist spirit to study recombination. As in the use of Gal4-VP16 to probe transcriptional mechanisms, earlier studies have shown that the VP16 transactivation domain activates V(D)J recombination in B cells. Thus, this domain carries the necessary attributes of a recombination activator in vivo.

Gal4-VP16 functions by recruiting the chromatin-remodeling complex SWI/SNF to substrate DNA, leading to local alterations of chromatin structure. While hSWI/SNF has been shown to increase RAG1/2-induced hairpin formation of RSS-containing mononucleosomal DNA, we now provide evidence for its role in 12- and 23-RSS-dependent coupled cleavage in vitro. Biochemical studies of the SWI/SNF complex indicate that it remodels chromatin (1) by “loosening” DNA nucleosome contacts reflected in loss of the 10 bp repeat unit observed after DNase I digestion (Kwon et al., 1994); (2) by nucleosome sliding, whereby some parts of the DNA are unwound from the nucleosome and therefore may be free to interact with another nucleosome (Kassabov et al., 2003; Martens and Winston, 2003; Schnitzler et al., 1998); and (3) by nucleosome eviction, in which the histone octamer is transferred to other available DNA (Gutierrez et al., 2007). In our studies VP16-mediated utilization of SWI/SNF did not produce gross alterations in chromatin structure that could be sensed by DNase I digestion. Rather, the VP16 transactivation domain appears to alter local chromatin structure as indicated by increased BamHI digestion in the vicinity of the RSS. We therefore favor the interpretation that altered nucleosomal contacts and/or limited sliding are more likely to be the basis for enhanced RAG cleavage, rather than nucleosome eviction.

Recently, Oltz and colleagues provided definitive evidence that BRG1, the catalytic subunit of the SWI/SNF complex, can substitute for PDβ to activate V(D)J recombination of stably transfected substrates (Osipovich et al., 2007). However, BRG1 recruitment to the substrate also activated transcription and histone H3 acetylation, making it difficult to distinguish whether increased recombination was the result of chromatin remodeling, histone acetylation, transcription, or a combined effect of all these changes. We have separated out the effects of chromatin remodeling from associated changes in the in vitro system. We consider it unlikely that Gal4-VP16-induced RAG activity is due to increased histone acetylation because neither the purified hSWI/SNF complex nor the recombinant chromatin assembly proteins contain any known histone acetyl transferases (Marmorstein and Roth, 2001; Mohrmann and Verrijzer, 2005). Moreover, the effect of hSWI/SNF was also evident with chromatin assembled using recombinant histones. We also found that SWI/SNF-dependent increase in RAG1/2 cleavage occurred in the absence of RNA polymerase II-mediated transcription. Indeed, forcing transcripts through the region decreased rather than increased RAG cleavage. We suggest, therefore, that SWI/SNF plays a direct role in V(D)J recombination. Our observations do not rule out a role for additional transcription-induced chromatin changes at endogenous loci, such as those mediated by HATs or remodeling activities that accompany elongating RNA polymerase. Rather, the difference between an accessible and an inaccessible locus for V(D)J recombination probably reflects the cumulative effect of cis-sequence-mediated direct recruitment of chromatin remodeling and modifying activities as well as transcription-induced changes that mutually reinforce each other to generate tissue-specific chromatin structure that is compatible with recombination.

EXPERIMENTAL PROCEDURES

Plasmids

pLPi, provided by Drs. David Schatz and Leon Ptaszek (Yale University), contains a 12-RSS (GGTTTTTGTTCAGGGCTGTATCACTGTG) and a 23-RSS (GGTTTTTGTAAAGGCTTCCCATAGAATTGAATCACTGTG), inserted into pBluescript II SK(+). Plasmid pLPi-G4 contains five Gal4 binding sites inserted at the XhoI site close to the 12-RSS. pLPi-(G4)2 was obtained by inserting five Gal4 binding sites into the HindIII site upstream 23-RSS in pLPi-G4. Plasmid pLPi-Δ was derived from pLPi by deleting a HincII fragment between the RSSs. To construct deletion substrates pLPd, pLPd-G4, pLPd-(G4)2, and pLPd-Δ, we changed the orientation of the 12-RSS. All relevant regions of the plasmids were sequenced to confirm RSS orientations and location of Gal4 binding sites.

Proteins

Murine core RAG1 fused to maltose binding protein (MBP) was expressed in bacteria and purified using amylase affinity chromatography as described previously (Rodgers et al., 1999). Murine core RAG2 protein fused to glutathione S-transferase (GST) was expressed in 293T cells and purified by glutathione affinity chromatography as described previously (Spanopoulou et al., 1996). Murine HMG2 protein lacking the C-terminal acidic region and containing an amino-terminal polyhistidine region and protein kinase A phosphorylation site was purified as described previously (Eastman et al., 1999). Expression vectors for Gal4-DBD and Gal4-VP16 were kind gifts from Dr. Jerry Workman (Stowers Institute, KS). GAL4-DBD and GAL4-VP16 protein purification was performed according to the published procedure (Reece et al., 1993). Flag-tagged hSWI/SNF was purified as described previously (Sif et al., 1998; Xue et al., 2000) with some modifications. Nuclear extract from HeLa-Ini1-11 was incubated with anti-Flag M2 affinity gel at 4°C for 3 hr. Beads were then washed extensively with wash buffer (20 mM HEPES [pH 7.9], 200 mM NaCl, 0.1% NP40, and 0.1 mM PMSF). After the final wash, bound proteins were eluted with wash buffer containing 100 μg/ml Flag peptide. The proteins were analyzed by SDS-PAGE and silver staining. Xenopus laevis recombinant histones (H3, H4, H2A, and H2B) were individually expressed and purified as described (Luger et al., 1997). Histone octamers were assembled and purified by gel filtration using Superdex 200.

Chromatin Assembly

Chromatin was assembled with plasmid DNA, Drosophila core histones, and S190 assembly extract derived from Drosophila embryos, essentially as described previously (Kamakaka et al., 1993). For assembly in a reconstituted system, Drosophila topoisomerase, ACF, and NAP-1 were purified and used as previously described (Fyodorov and Kadonaga, 2003). Gal4-DBD, or Gal4-VP16, was added prior to assembly in the reconstituted system.

Nuclease Analysis of Chromatin

Nuclease analysis of chromatin was done essentially as described (Ishii et al., 2004). After micrococcal nuclease digestion, the purified DNA was separated by electrophoresis and visualized by ethidium bromide staining. For footprinting analysis, 50 ng DNase I-digested DNA was used for primer extension with a 32P-labeled primer (5′-ATACGACTCACTATAGGGCGAATTGGAGC-3′). The samples were then analyzed by electrophoresis through 6% denaturing gels followed by autoradiography. For indirect end-labeling analysis, 50 ng of DNA was digested to completion with DraI. The DNA was separated through 1.1% agarose gels followed by transfer to a nylon membrane and hybridized to a 32P-labeled oligonucleotide probe (5′-AAGTGCTCATCATTGGAAAACGTTCTTC-3′). For restriction enzyme digestion, 10 or 20 units of BamHI was added to 25 μl aliquots of assembled chromatin and incubated at 28°C for 30 min. All DNA samples were then digested with AlwNI, before electrophoretic separation and Southern blot analysis. Band intensities were quantitated by phosphorimager analysis, followed by statistics using TTEST in Microsoft Office Excel (2003) with two-tailed distribution and two-sample equal variance.

RAG Cleavage Assay

For RAG cleavage reaction, 10 μl chromatin, or naked DNA (50 ng), was combined with 15 μl RAG mix (containing approximately 30–50 ng each of RAG1 and RAG2 proteins, 30 ng HMG2, and 2.5 μg BSA with 10 mM HEPES [pH 7.5], 2 mM MgCl2, 16.7 μM ZnSO4, 33 mM potassium glutamate, 3.3 mM DTT) for 2 hr at 37°C. The reaction was terminated by addition of 100 μl stop solution (20 mM EDTA [pH 8], 200 mM NaCl, 1% SDS, 0.25 mg/ml glycogen, and 125 μl/ml proteinase K), followed by incubation at 37°C for 30 min. The DNA was isolated and separated through 1.1% agarose gels, transferred to nylon membranes, and hybridized to random prime-labeled DNA fragment depicted in Figure 1. The cleaved DNA was visualized and quantified as described above.

In Vitro Transcription Assay

We optimized conditions to measure transcription activity and RAG cleavage simultaneously. Twenty microliters assembled DNA, or naked DNA, was mixed with 30 μl Trans-RAG buffer (10 mM HEPES [pH 7.5], 2 mM MgCl2, 16.7 μM ZnSO4, 2.5 μg BSA with 33 mM potassium glutamate, 3.3 mM DTT, 1 mM rNTPs with or without 0.2 μg BJAB nuclear extract). After a further 30 min incubation at 28°C, 10 μl aliquot was mixed with 6 μl R buffer and 9 μl RAG reaction mixture, incubated at 37°C for 2 hr. Where needed, the reaction mix lacking DNA or RAG proteins was pretreated with α-amanitin (40 μg/ml) for 10 min. RNA was purified (RNeasy Micro Kit, QIAGEN) to assess transcriptional activity.

Supplementary Material

1

ACKNOWLEDGMENTS

We thank Drs. David Schatz and Leon Ptaszek (Yale University Medical School) for providing recombination substrates, Jerry Workman (Stowers Research Institute, KS) for providing expression plasmids for Gal4-derivatives, Jim Kadonaga (UCSD) for expression rectors for recombinant ACF-based chromatin assembly system, and Weidong Wang (NIA/NIH) for help and advice on hSWI/SNF purification. We appreciate the time and effort of Drs. David Schatz (Yale Medical School), Sebastian Fugmann (NIA/NIH), and Dinah Singer (NCI/NIH) to comment on the manuscript, and Valerie Martin for editorial assistance. This work was supported in the initial stages by NIH grant (GM38925) to R.S. and currently by the Intramural Research Program of the National Institute on Aging (Baltimore, MD).

Footnotes

SUPPLEMENTAL DATA

The Supplemental Data include four figures and can be found with this article online at http://www.molecule.org/cgi/content/full/31/5/641/DC1/.

REFERENCES

  1. Abarrategui I, Krangel MS. Regulation of T cell receptor-alpha gene recombination by transcription. Nat. Immunol. 2006;7:1109–1115. doi: 10.1038/ni1379. [DOI] [PubMed] [Google Scholar]
  2. Akamatsu Y, Monroe R, Dudley DD, Elkin SK, Gartner F, Talukder SR, Takahama Y, Alt FW, Bassing CH, Oettinger MA. Deletion of the RAG2 C terminus leads to impaired lymphoid development in mice. Proc. Natl. Acad. Sci. USA. 2003;100:1209–1214. doi: 10.1073/pnas.0237043100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Angelin-Duclos C, Calame K. Evidence that immunoglobulin VHDJ recombination does not require germ line transcription of the recombining variable gene segment. Mol. Cell. Biol. 1998;18:6253–6264. doi: 10.1128/mcb.18.11.6253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bassing CH, Swat W, Alt FW. The mechanism and regulation of chromosomal V(D)J recombination. Cell. 2002;109(Suppl):S45–S55. doi: 10.1016/s0092-8674(02)00675-x. [DOI] [PubMed] [Google Scholar]
  5. Baumann M, Mamais A, McBlane F, Xiao H, Boyes J. Regulation of V(D)J recombination by nucleosome positioning at recombination signal sequences. EMBO J. 2003;22:5197–5207. doi: 10.1093/emboj/cdg487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bouvier G, Watrin F, Naspetti M, Verthuy C, Naquet P, Ferrier P. Deletion of the mouse T-cell receptor beta gene enhancer blocks alphabeta T-cell development. Proc. Natl. Acad. Sci. USA. 1996;93:7877–7881. doi: 10.1073/pnas.93.15.7877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Capone M, Watrin F, Fernex C, Horvat B, Krippl B, Wu L, Scollay R, Ferrier P. TCR beta and TCR alpha gene enhancers confer tissue-and stage-specificity on V(D)J recombination events. EMBO J. 1993;12:4335–4346. doi: 10.1002/j.1460-2075.1993.tb06118.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chi T, Lieberman P, Ellwood K, Carey M. A general mechanism for transcriptional synergy by eukaryotic activators. Nature. 1995;377:254–257. doi: 10.1038/377254a0. [DOI] [PubMed] [Google Scholar]
  9. Cobb RM, Oestreich KJ, Osipovich OA, Oltz EM. Accessibility control of V(D)J recombination. Adv. Immunol. 2006;91:45–109. doi: 10.1016/S0065-2776(06)91002-5. [DOI] [PubMed] [Google Scholar]
  10. Curry JD, Geier JK, Schlissel MS. Single-strand recombination signal sequence nicks in vivo: evidence for a capture model of synapsis. Nat. Immunol. 2005;6:1272–1279. doi: 10.1038/ni1270. [DOI] [PubMed] [Google Scholar]
  11. Dudley DD, Sekiguchi J, Zhu C, Sadofsky MJ, Whitlow S, DeVido J, Monroe RJ, Bassing CH, Alt FW. Impaired V(D)J recombination and lymphocyte development in core RAG1-expressing mice. J. Exp. Med. 2003;198:1439–1450. doi: 10.1084/jem.20030627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dudley DD, Chaudhuri J, Bassing CH, Alt FW. Mechanism and control of V(D)J recombination versus class switch recombination: similarities and differences. Adv. Immunol. 2005;86:43–112. doi: 10.1016/S0065-2776(04)86002-4. [DOI] [PubMed] [Google Scholar]
  13. Eastman QM, Villey IJ, Schatz DG. Detection of RAG protein-V(D)J recombination signal interactions near the site of DNA cleavage by UV cross-linking. Mol. Cell. Biol. 1999;19:3788–3797. doi: 10.1128/mcb.19.5.3788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Elkin SK, Ivanov D, Ewalt M, Ferguson CG, Hyberts SG, Sun ZY, Prestwich GD, Yuan J, Wagner G, Oettinger MA, Gozani OP. A PHD finger motif in the C terminus of RAG2 modulates recombination activity. J. Biol. Chem. 2005;280:28701–28710. doi: 10.1074/jbc.M504731200. [DOI] [PubMed] [Google Scholar]
  15. Fernex C, Capone M, Ferrier P. The V(D)J recombinational and transcriptional activities of the immunoglobulin heavy-chain intronic enhancer can be mediated through distinct protein-binding sites in a transgenic substrate. Mol. Cell. Biol. 1995;15:3217–3226. doi: 10.1128/mcb.15.6.3217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fyodorov DV, Kadonaga JT. Chromatin assembly in vitro with purified recombinant ACF and NAP-1. Methods Enzymol. 2003;371:499–515. doi: 10.1016/S0076-6879(03)71037-4. [DOI] [PubMed] [Google Scholar]
  17. Golding A, Chandler S, Ballestar E, Wolffe AP, Schlissel MS. Nucleosome structure completely inhibits in vitro cleavage by the V(D)J recombinase. EMBO J. 1999;18:3712–3723. doi: 10.1093/emboj/18.13.3712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gutierrez JL, Chandy M, Carrozza MJ, Workman JL. Activation domains drive nucleosome eviction by SWI/SNF. EMBO J. 2007;26:730–740. doi: 10.1038/sj.emboj.7601524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hsieh CL, Lieber MR. CpG methylated minichromosomes become inaccessible for V(D)J recombination after undergoing replication. EMBO J. 1992;11:315–325. doi: 10.1002/j.1460-2075.1992.tb05054.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hsieh CL, McCloskey RP, Lieber MR. V(D)J recombination on minichromosomes is not affected by transcription. J. Biol. Chem. 1992;267:15613–15619. [PubMed] [Google Scholar]
  21. Ishii H, Sen R, Pazin MJ. Combinatorial control of DNase I-hypersensitive site formation and erasure by immunoglobulin heavy chain enhancer-binding proteins. J. Biol. Chem. 2004;279:7331–7338. doi: 10.1074/jbc.M308973200. [DOI] [PubMed] [Google Scholar]
  22. Johnson K, Pflugh DL, Yu D, Hesslein DG, Lin KI, Bothwell AL, Thomas-Tikhonenko A, Schatz DG, Calame K. B cell-specific loss of histone 3 lysine 9 methylation in the V(H) locus depends on Pax5. Nat. Immunol. 2004;5:853–861. doi: 10.1038/ni1099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jones JM, Gellert M. Ordered assembly of the V(D)J synaptic complex ensures accurate recombination. EMBO J. 2002;21:4162–4171. doi: 10.1093/emboj/cdf394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kamakaka RT, Bulger M, Kadonaga JT. Potentiation of RNA polymerase II transcription by Gal4–VP16 during but not after DNA replication and chromatin assembly. Genes Dev. 1993;7:1779–1795. doi: 10.1101/gad.7.9.1779. [DOI] [PubMed] [Google Scholar]
  25. Kassabov SR, Zhang B, Persinger J, Bartholomew B. SWI/ SNF unwraps, slides, and rewraps the nucleosome. Mol. Cell. 2003;11:391–403. doi: 10.1016/s1097-2765(03)00039-x. [DOI] [PubMed] [Google Scholar]
  26. Krangel MS. Gene segment selection in V(D)J recombination: accessibility and beyond. Nat. Immunol. 2003;4:624–630. doi: 10.1038/ni0703-624. [DOI] [PubMed] [Google Scholar]
  27. Kwon H, Imbalzano AN, Khavari PA, Kingston RE, Green MR. Nucleosome disruption and enhancement of activator binding by a human SW1/SNF complex. Nature. 1994;370:477–481. doi: 10.1038/370477a0. [DOI] [PubMed] [Google Scholar]
  28. Kwon J, Imbalzano AN, Matthews A, Oettinger MA. Accessibility of nucleosomal DNA to V(D)J cleavage is modulated by RSS positioning and HMG1. Mol. Cell. 1998;2:829–839. doi: 10.1016/s1097-2765(00)80297-x. [DOI] [PubMed] [Google Scholar]
  29. Kwon J, Morshead KB, Guyon JR, Kingston RE, Oettinger MA. Histone acetylation and hSWI/SNF remodeling act in concert to stimulate V(D)J cleavage of nucleosomal DNA. Mol. Cell. 2000;6:1037–1048. doi: 10.1016/s1097-2765(00)00102-7. [DOI] [PubMed] [Google Scholar]
  30. Lauzurica P, Krangel MS. Temporal and lineage-specific control of T cell receptor alpha/delta gene rearrangement by T cell receptor alpha and delta enhancers. J. Exp. Med. 1994;179:1913–1921. doi: 10.1084/jem.179.6.1913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Liang HE, Hsu LY, Cado D, Cowell LG, Kelsoe G, Schlissel MS. The “dispensable” portion of RAG2 is necessary for efficient V-to-DJ rearrangement during B and T cell development. Immunity. 2002;17:639–651. doi: 10.1016/s1074-7613(02)00448-x. [DOI] [PubMed] [Google Scholar]
  32. Liu Y, Subrahmanyam R, Chakraborty T, Sen R, Desiderio S. A plant homeodomain in RAG-2 that binds Hypermethylated lysine 4 of histone H3 is necessary for efficient antigen-receptor-gene rearrangement. Immunity. 2007;27:561–571. doi: 10.1016/j.immuni.2007.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Luger K, Rechsteiner TJ, Flaus AJ, Waye MM, Richmond TJ. Characterization of nucleosome core particles containing histone proteins made in bacteria. J. Mol. Biol. 1997;272:301–311. doi: 10.1006/jmbi.1997.1235. [DOI] [PubMed] [Google Scholar]
  34. Marmorstein R, Roth SY. Histone acetyltransferases: function, structure, and catalysis. Curr. Opin. Genet. Dev. 2001;11:155–161. doi: 10.1016/s0959-437x(00)00173-8. [DOI] [PubMed] [Google Scholar]
  35. Martens JA, Winston F. Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Curr. Opin. Genet. Dev. 2003;13:136–142. doi: 10.1016/s0959-437x(03)00022-4. [DOI] [PubMed] [Google Scholar]
  36. Matthews AG, Kuo AJ, Ramon-Maiques S, Han S, Champagne KS, Ivanov D, Gallardo M, Carney D, Cheung P, Ciccone DN, et al. RAG2 PHD finger couples histone H3 lysine 4 trimethylation with V(D)J recombination. Nature. 2007;450:1106–1110. doi: 10.1038/nature06431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. McBlane F, Boyes J. Stimulation of V(D)J recombination by histone acetylation. Curr. Biol. 2000;10:483–486. doi: 10.1016/s0960-9822(00)00449-8. [DOI] [PubMed] [Google Scholar]
  38. Mohrmann L, Verrijzer CP. Composition and functional specificity of SWI2/SNF2 class chromatin remodeling complexes. Biochim. Biophys. Acta. 2005;1681:59–73. doi: 10.1016/j.bbaexp.2004.10.005. [DOI] [PubMed] [Google Scholar]
  39. Morshead KB, Ciccone DN, Taverna SD, Allis CD, Oettinger MA. Antigen receptor loci poised for V(D)J rearrangement are broadly associated with BRG1 and flanked by peaks of histone H3 dimethylated at lysine 4. Proc. Natl. Acad. Sci. USA. 2003;100:11577–11582. doi: 10.1073/pnas.1932643100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Neely KE, Hassan AH, Wallberg AE, Steger DJ, Cairns BR, Wright AP, Workman JL. Activation domain-mediated targeting of the SWI/SNF complex to promoters stimulates transcription from nucleosome arrays. Mol. Cell. 1999;4:649–655. doi: 10.1016/s1097-2765(00)80216-6. [DOI] [PubMed] [Google Scholar]
  41. Nightingale KP, Baumann M, Eberharter A, Mamais A, Becker PB, Boyes J. Acetylation increases access of remodelling complexes to their nucleosome targets to enhance initiation of V(D)J recombination. Nucleic Acids Res. 2007;35:6311–6321. doi: 10.1093/nar/gkm650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Okada A, Mendelsohn M, Alt F. Differential activation of transcription versus recombination of transgenic T cell receptor beta variable region gene segments in B and T lineage cells. J. Exp. Med. 1994;180:261–272. doi: 10.1084/jem.180.1.261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Osipovich O, Milley R, Meade A, Tachibana M, Shinkai Y, Krangel MS, Oltz EM. Targeted inhibition of V(D)J recombination by a histone methyltransferase. Nat. Immunol. 2004;5:309–316. doi: 10.1038/ni1042. [DOI] [PubMed] [Google Scholar]
  44. Osipovich O, Milley Cobb R, Oestreich KJ, Pierce S, Ferrier P, Oltz EM. Essential function for SWI-SNF chromatin-remodeling complexes in the promoter-directed assembly of Tcrb genes. Nat. Immunol. 2007;8:809–816. doi: 10.1038/ni1481. [DOI] [PubMed] [Google Scholar]
  45. Patenge N, Elkin SK, Oettinger MA. ATP-dependent remodeling by SWI/SNF and ISWI proteins stimulates V(D)J cleavage of 5 S arrays. J. Biol. Chem. 2004;279:35360–35367. doi: 10.1074/jbc.M405790200. [DOI] [PubMed] [Google Scholar]
  46. Reece RJ, Rickles RJ, Ptashne M. Overproduction and single-step purification of GAL4 fusion proteins from Escherichia coli. Gene. 1993;126:105–107. doi: 10.1016/0378-1119(93)90596-u. [DOI] [PubMed] [Google Scholar]
  47. Roberts SG, Green MR. Activator-induced conformational change in general transcription factor TFIIB. Nature. 1994;371:717–720. doi: 10.1038/371717a0. [DOI] [PubMed] [Google Scholar]
  48. Rodgers KK, Villey IJ, Ptaszek L, Corbett E, Schatz DG, Coleman JE. A dimer of the lymphoid protein RAG1 recognizes the recombina tion signal sequence and the complex stably incorporates the high mobility group protein HMG2. Nucleic Acids Res. 1999;27:2938–2946. doi: 10.1093/nar/27.14.2938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Roth DB. Restraining the V(D)J recombinase. Nat. Rev. Immunol. 2003;3:656–666. doi: 10.1038/nri1152. [DOI] [PubMed] [Google Scholar]
  50. Sadofsky MJ. Recombination-activating gene proteins: more regulation, please. Immunol. Rev. 2004;200:83–89. doi: 10.1111/j.0105-2896.2004.00164.x. [DOI] [PubMed] [Google Scholar]
  51. Schatz DG. V(D)J recombination. Immunol. Rev. 2004;200:5–11. doi: 10.1111/j.0105-2896.2004.00173.x. [DOI] [PubMed] [Google Scholar]
  52. Schnitzler G, Sif S, Kingston RE. Human SWI/SNF interconverts a nucleosome between its base state and a stable remodeled state. Cell. 1998;94:17–27. doi: 10.1016/s0092-8674(00)81217-9. [DOI] [PubMed] [Google Scholar]
  53. Sen R, Oltz E. Genetic and epigenetic regulation of IgH gene assembly. Curr. Opin. Immunol. 2006;18:237–242. doi: 10.1016/j.coi.2006.03.008. [DOI] [PubMed] [Google Scholar]
  54. Sif S, Stukenberg PT, Kirschner MW, Kingston RE. Mitotic inactivation of a human SWI/SNF chromatin remodeling complex. Genes Dev. 1998;12:2842–2851. doi: 10.1101/gad.12.18.2842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sikes ML, Suarez CC, Oltz EM. Regulation of V(D)J recombination by transcriptional promoters. Mol. Cell. Biol. 1999;19:2773–2781. doi: 10.1128/mcb.19.4.2773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Sikes ML, Meade A, Tripathi R, Krangel MS, Oltz EM. Regulation of V(D)J recombination: a dominant role for promoter positioning in gene segment accessibility. Proc. Natl. Acad. Sci. USA. 2002;99:12309–12314. doi: 10.1073/pnas.182166699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Sleckman BP, Bardon CG, Ferrini R, Davidson L, Alt FW. Function of the TCR alpha enhancer in alphabeta and gammadelta T cells. Immunity. 1997;7:505–515. doi: 10.1016/s1074-7613(00)80372-6. [DOI] [PubMed] [Google Scholar]
  58. Spanopoulou E, Zaitseva F, Wang FH, Santagata S, Baltimore D, Panayotou G. The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell. 1996;87:263–276. doi: 10.1016/s0092-8674(00)81344-6. [DOI] [PubMed] [Google Scholar]
  59. Vignali M, Steger DJ, Neely KE, Workman JL. Distribution of acetylated histones resulting from Gal4–VP16 recruitment of SAGA and NuA4 complexes. EMBO J. 2000;19:2629–2640. doi: 10.1093/emboj/19.11.2629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Villey I, Caillol D, Selz F, Ferrier P, de Villartay JP. Defect in rearrangement of the most 5′ TCR-J alpha following targeted deletion of T early alpha (TEA): implications for TCR alpha locus accessibility. Immunity. 1996;5:331–342. doi: 10.1016/s1074-7613(00)80259-9. [DOI] [PubMed] [Google Scholar]
  61. West KL, Singha NC, De Ioannes P, Lacomis L, Erdjument-Bromage H, Tempst P, Cortes P. A direct interaction between the RAG2 C terminus and the core histones is required for efficient V(D)J recombination. Immunity. 2005;23:203–212. doi: 10.1016/j.immuni.2005.07.004. [DOI] [PubMed] [Google Scholar]
  62. Whitehurst CE, Schlissel MS, Chen J. Deletion of germline promoter PD beta 1 from the TCR beta locus causes hypermethylation that impairs D beta 1 recombination by multiple mechanisms. Immunity. 2000;13:703–714. doi: 10.1016/s1074-7613(00)00069-8. [DOI] [PubMed] [Google Scholar]
  63. Xue Y, Canman JC, Lee CS, Nie Z, Yang D, Moreno GT, Young MK, Salmon ED, Wang W. The human SWI/SNF-B chromatin-remodeling complex is related to yeast rsc and localizes at kinetochores of mitotic chromosomes. Proc. Natl. Acad. Sci. USA. 2000;97:13015–13020. doi: 10.1073/pnas.240208597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Yancopoulos GD, Alt FW. Developmentally controlled and tissue-specific expression of unrearranged VH gene segments. Cell. 1985;40:271–281. [PubMed] [Google Scholar]
  65. Yancopoulos GD, Blackwell TK, Suh H, Hood L, Alt FW. Introduced T cell receptor variable region gene segments recombine in pre-B cells: evidence that B and T cells use a common recombinase. Cell. 1986;44:251–259. doi: 10.1016/0092-8674(86)90759-2. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS68988-supplement-1.pdf (1.8MB, pdf)

RESOURCES