γ-Resorcylate Catabolic-Pathway Genes in the Soil Actinomycete Rhodococcus jostii RHA1

Abstract

The Rhodococcus jostii RHA1 gene cluster required for γ-resorcylate (GRA) catabolism was characterized. The cluster includes tsdA, tsdB, tsdC, tsdD, tsdR, tsdT, and tsdX, which encode GRA decarboxylase, resorcinol 4-hydroxylase, hydroxyquinol 1,2-dioxygenase, maleylacetate reductase, an IclR-type regulator, a major facilitator superfamily transporter, and a putative hydrolase, respectively. The tsdA gene conferred GRA decarboxylase activity on Escherichia coli. Purified TsdB oxidized NADH in the presence of resorcinol, suggesting that tsdB encodes a unique NADH-specific single-component resorcinol 4-hydroxylase. Mutations in either tsdA or tsdB resulted in growth deficiency on GRA. The tsdC and tsdD genes conferred hydroxyquinol 1,2-dioxygenase and maleylacetate reductase activities, respectively, on E. coli. Inactivation of tsdT significantly retarded the growth of RHA1 on GRA. The growth retardation was partially suppressed under acidic conditions, suggesting the involvement of tsdT in GRA uptake. Reverse transcription-PCR analysis revealed that the tsd genes constitute three transcriptional units, the tsdBADC and tsdTX operons and tsdR. Transcription of the tsdBADC and tsdTX operons was induced during growth on GRA. Inactivation of tsdR derepressed transcription of the tsdBADC and tsdTX operons in the absence of GRA, suggesting that tsd gene transcription is negatively regulated by the tsdR-encoded regulator. Binding of TsdR to the tsdR-tsdB and tsdT-tsdR intergenic regions was inhibited by the addition of GRA, indicating that GRA interacts with TsdR as an effector molecule.

INTRODUCTION

Gamma-resorcylate (GRA; 2,6-dihydroxybenzoate) is used for the synthesis of agricultural chemicals (1). Resorcinol is widely used for adhesives in automobile tires, wood products, and UV absorbers. GRA decarboxylase catalyzes a reversible conversion between GRA and resorcinol. Because GRA decarboxylase is important for industrial applications, GRA decarboxylases from Gram-negative bacteria, including Rhizobium sp. strain MTP-10005, Agrobacterium tumefaciens WU-0108, and Pandoraea sp. strain 12B-2, have been characterized (2–4). Resorcinol and resorcylates occur in nature as secondary metabolites in plants and fungi (5–7), and it is important to understand the enzymatic system that catabolizes GRA via resorcinol. The GRA catabolic pathway has been characterized in the strain MTP-10005 (8); GRA is initially converted by GRA decarboxylase to resorcinol, which is hydroxylated by resorcinol 4-hydroxylase, an enzyme in the resorcinol catabolic pathway (Fig. 1A). The resulting hydroxyquinol is degraded to maleylacetate by hydroxyquinol 1,2-dioxygenase-mediated ortho-ring cleavage, and maleylacetate is further metabolized by the β-ketoadipate pathway. The same resorcinol catabolic pathway is present in Corynebacterium glutamicum ATCC 13032 (9). However, the resorcinol 4-hydroxylase of MTP-10005 is different from that of ATCC 13032; MTP-10005 contains a two-component NADH-dependent enzyme, whereas ATCC 13032 contains a single-component NADPH-dependent enzyme (8, 9). A NADH-dependent enzyme was partially purified from Rhodococcus sp. strain BPG-8, but this enzyme has not been characterized further (10). Furthermore, GRA decarboxylase genes have not been identified in Gram-positive bacteria.

FIG 1.

Organization of GRA catabolism genes and the GRA catabolic pathway in R. jostii RHA1. (A) The proposed GRA catabolic pathway in RHA1. GRA is degraded to hydroxyquinol via resorcinol by GRA decarboxylase (TsdA) and resorcinol 4-hydroxylase (TsdB). Hydroxyquinol is converted to β-ketoadipate via β-hydroxy-cis,cis-muconate and maleylacetate by hydroxyquinol 1,2-dioxygenase (TsdC) and maleylacetate reductase (TsdD). β-Hydroxy-cis,cis-muconate might be converted to maleylacetate spontaneously. Based on amino acid sequence similarities, the tsdX, tsdT, and tsdR genes encode a putative hydrolase, an MFS transporter, and an IclR-type transcriptional regulator, respectively. (B) Organization of GRA catabolism genes. The open arrows indicate the tsd genes involved in GRA catabolism. The double-headed arrows below the tsd genes represent the estimated locations of the RT-PCR products (see Fig. S1 in the supplemental material). The thin lines immediately above the tsd genes indicate the regions deleted in the tsd gene mutants. The thick bars at the top specify the fragments used as probes for Southern hybridization to select the deletion mutant clones (see Fig. S3 in the supplemental material). Abbreviations for restriction enzymes: Bg, BglII; Kp, KpnI; Ps, PstI; Sa, SalI; Sc, SacII; and Sm, SmaI.

Rhodococcus jostii RHA1 was originally isolated from lindane-contaminated soil and cometabolizes polychlorinated biphenyls through the biphenyl metabolic pathway (11, 12). The strain RHA1 is able to grow on GRA as a sole source of carbon and energy. In this study, the GRA catabolic-pathway gene cluster including the GRA decarboxylase and resorcinol 4-hydroxylase genes in R. jostii RHA1 was characterized. The results uncovered GRA catabolism, including regulatory and uptake systems, in a Gram-positive bacterium.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. R. jostii RHA1 and its mutant derivatives were routinely grown at 30°C in 0.2× Luria-Bertani (LB) medium or W minimal salt medium (13) containing 10 mM GRA or 10 mM succinate. Escherichia coli strains were grown in LB medium at 30°C or 37°C. If necessary, ampicillin and kanamycin were added to the medium at concentrations of 100 and 25 mg/liter, respectively.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Relevant characteristic(s)a	Source or reference
Strains
R. jostii
RHA1	Wild type	11
DTA	RHA1 derivative; ΔtsdA	This study
DTB	RHA1 derivative; ΔtsdB	This study
DTR	RHA1 derivative; ΔtsdR	This study
DTT	RHA1 derivative; ΔtsdT	This study
DTX	RHA1 derivative; ΔtsdX	This study
E. coli
DH5α	λ− ϕ80dlacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rK− mK−) supE44 thi-1 gyrA relA1	45
BL21(DE3)	F− ompT hsdSB(rB− mB−) gal dcm (DE3); T7 RNA polymerase gene under the control of the lacUV5 promoter	46
BL21	F− ompT hsdSB(rB− mB−) gal dcm	46
Plasmids
pT7Blue	Cloning vector; Apr T7 promoter	Novagen
pET21a	Expression vector; Apr T7 promoter	Novagen
pET16b	Expression vector; Apr T7 promoter	Novagen
pColdI	Expression vector; Apr cspA promoter	TaKaRa Bio
pK19mobsacB	oriT sacB Kmr	47
pETSDA	pET21a with a 1.4-kb fragment containing tsdA	This study
pETSDC	pET21a with a 0.9-kb fragment containing tsdC	This study
pETSDD	pET21a with a 1.1-kb fragment containing tsdD	This study
pETBNR4	pET16b with a 0.9-kb PCR-amplified fragment containing tsdR	This study
pCISDB	pColdI with a 1.6-kb PCR-amplified fragment containing tsdB	This study
pKA	pK18mobsacB with a 1.2-kb fragment containing N- and C-terminal regions of tsdA for deletion	This study
pKB	pK19mobsacB with a 1.8-kb fragment containing N- and C-terminal regions of tsdB for deletion	This study
pKR	pK19mobsacB with a 1.3-kb fragment containing N- and C-terminal regions of tsdR for deletion	This study
pKT	pK19mobsacB with a 1.3-kb fragment containing N- and C-terminal regions of tsdT for deletion	This study
pKX	pK19mobsacB with a 1.2-kb fragment containing N- and C-terminal regions of tsdX for deletion	This study

^aAp^r and Km^r, resistance to ampicillin and kanamycin, respectively.

DNA manipulations, nucleotide sequencing, and sequence analysis.

DNA manipulations, including total DNA isolation and electroporation, and nucleotide sequencing were performed as previously described (14). Analysis of nucleotide sequences was carried out as previously described (15). The genome sequence of RHA1, whose BioProject accession number is PRJNA13693, was used to find GRA catabolism genes at the RHA1 genome database (http://www.rhodococcus.ca/index.jsp). Analysis of transmembrane helices was performed with the TMHMM tool (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and the HMMTOP tool (http://www.enzim.hu/hmmtop/).

Expression of tsd genes in E. coli.

The coding regions of tsdA, tsdC, tsdD, and tsdR were independently amplified by PCR using the primer pairs NdetsdA_F plus NdetsdA_R, NdetsdC_F plus NdetsdC_R, NdetsdD_F plus NdetsdD_R, and NdetsdR_F plus NdetsdR_R, respectively (Table 2). Each forward primer contained an NdeI site at the start codon of the corresponding target gene. The amplified fragments were separately cloned in pT7Blue to generate the NdeI fragment containing the entire target gene. The NdeI fragment containing either the tsdA, tsdC, or tsdD gene was individually cloned in the expression vector, pET21a. The NdeI-KpnI fragment containing the tsdR gene was inserted in pET16b. The resultant plasmids were introduced into E. coli BL21(DE3), and the transformants were grown at 30°C. Expression of each gene was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) when the absorbance at 600 nm (A₆₀₀) of the culture reached 0.5. Four hours after induction, cells were harvested by centrifugation at 5,000 × g at 4°C for 10 min and resuspended in 50 mM Tris-HCl buffer (pH 7.5). The cells were then disrupted with an ultrasonic disintegrator (UD-201; Tomy Seiko Co., Tokyo, Japan) and centrifuged at 15,000 × g at 4°C for 15 min. The resulting supernatant was collected and used as the crude extract in enzyme assays.

TABLE 2.

Primer sequences used in this study

Primer	Sequence (5′-3′)
RT-PCR analysis
Internal region of tsdX
ingX_F	GGTAGTGCAGTCTTGCTCCG
ingX_R	TCATCCACGGTGAACTTTCC
Intergenic region of tsdT and tsdX
intTX_F	GGATCCCAGACCGCAGCCATGTGG
intTX_R	AAGCTTACGTGGTCATGTCTGTGGCC
Intergenic region of tsdR and tsdT
intRT_F	AAGGCTAGACACTCGGCACGAACGC
intRT_R	GGATCCTAGATCGCGAGGTCGAAGC
Internal region of tsdR
ingR_F	GATCCCACTGCAGATGCC
ingR_R	AGATGGTTGCTACACCCTGC
Intergenic region of tsdR and tsdB
uptsdR_F	CCATGCGCACATTCCAGAA
uptsdR_R	GCGCAGTGATTCGATGCC
Intergenic region of tsdB and tsdA
RSD1_F	TGTACACCAGATGGTTCGCCGC
RSD1_R	AACATCACGCGCTCCGAGCC
Intergenic region of tsdA and tsdD
lwtsdA_F	GGTACCTGATGTTCTCGACCGACTGGC
lwtsdA_R	GGATCCAATCGGCAACGAGTCGGTGAGG
Intergenic region of tsdD and tsdC
intDC_F	GCACAGACCCACGCAATCC
intDC_R	CTCGTTCGTCAAGGATGTCGG
Internal region of tsdC
ingC_F	AGGAATTCATCCTGCTGTCG
ingC_R	GGGTGACAGCTACCTCGAGT
Construction of gene expression plasmidsa
NdetsdA_F	AACATATGCAGGGCAAGATCGC (NdeI)
NdetsdA_R	TTCTCGGTCTCGCCGAGGATCG
NdetsdD_F	AGTCGCATATGCGGCCCTTCGTCC (NdeI)
NdetsdD_R	TGGTCATGCGGATCCTCCTTACG
NdetsdC_F	TAAGGAGGATCCATATGACCACG (NdeI)
NdetsdC_R	TTCTGGATCCCGAGGTCAGCTGC
NdetsdR_F	CATATGACGACCTCCGCGGATTCCG (NdeI)
NdetsdR_R	GCATGCCTGGTACCGTGAGGAGCGATGGAATCG (KpnI)
INF_tsdbcoldI_F	TCGAAGGTAGGCATATGTCTGCCTTCGCACAGCC
INF_tsdbcoldI_R	GTACCGAGCTCCATATCAGGCCGTGGGCGCCGG
EMSAs
Probe_RT_F	TGGGTGCGCGACTCATGG
Probe_RT_R	TGAGCGATTCCATCGCTC
Probe_RB_F	CGGGAAACCACCTTATGG
Probe_RB_R	CAGACATGCCGTTATTCC

^aEngineered restriction sites are underlined, and the corresponding restriction enzymes are shown in parentheses.

The coding region of tsdB was amplified by PCR using INF_tsdbcoldI-F and -R and a primer pair (Table 2). To generate the tsdB expression plasmid, pCISDB, the PCR products were cloned into pColdI using the in-fusion cloning methodology (16). E. coli BL21 cells harboring pCISDB were grown in 100 ml of LB medium containing ampicillin (Ap) at 37°C until the A₆₀₀ reached 0.5, and the culture was placed at 15°C for 30 min and cultivated again at 15°C for 24 h after the addition of 0.1 mM IPTG. After the incubation, the crude extracts were prepared as described above.

Purification of His-tagged proteins.

To remove nucleic acids, streptomycin sulfate was added to the crude extracts to a final concentration of 1%. The lysate was kept on ice for 10 min and centrifuged at 15,000 × g for 15 min. The supernatant was applied to a Ni-Sepharose 6 Fast Flow column (GE Healthcare, Buckinghamshire, United Kingdom) previously equilibrated with buffer A, consisting of 50 mM Tris-HCl (pH 7.5), 500 mM NaCl, and 100 mM imidazole. Proteins were allowed to bind for 1 min at 4°C while rotating, followed by washing five times in 5 ml of buffer A. His-tagged proteins were eluted with 5 ml of buffer B, consisting of 50 mM Tris-HCl (pH 7.5), 500 mM NaCl, and 500 mM imidazole, and the fractions were pooled and concentrated.

Enzyme assays. (i) GRA decarboxylase.

A reaction mixture of 1 ml consisting of 50 mM Tris-HCl buffer (pH 7.3), 100 μM GRA, and the crude extract (50 μg of protein) was incubated at 30°C. GRA decarboxylase activity was monitored using a DU-7500 spectrophotometer (Beckman Coulter, Fullerton, CA). For gas chromatography-mass spectrometry (GC-MS) analysis, the reaction mixture consisting of 50 mM Tris-HCl buffer (pH 7.3), 1 mM GRA, and the crude extract (500 μg of protein/ml) was incubated at 30°C. The reaction mixture was then acidified, extracted with ethyl acetate, and trimethylsilylated with the TMSI-H reagent (hexamethyldisilazane-trimethylchlorosilane-pyridine [2:1:10]; GL Science Inc., Tokyo, Japan) as described previously (17).

(ii) Resorcinol 4-hydroxylase.

Resorcinol 4-hydroxylase was assayed by a method similar to that previously reported (9). A reaction mixture composed of 1 ml of 50 mM Tris-HCl buffer (pH 8.0) containing 1 mM resorcinol, 200 μM NAD(P)H, 10 μM flavin adenine dinucleotide (FAD), 10 μg/ml catalase, and 100 μg of the purified His-tagged TsdB protein was incubated at 30°C. The enzyme activity was determined spectrophotometrically by monitoring the decrease in absorbance at 340 nm derived from the consumption of NAD(P)H. The specific activity was calculated from the initial rates by using molar extinction coefficients of 6,600 and 5,070 M⁻¹ cm⁻¹ for NADH and NADPH, respectively.

(iii) Hydroxyquinol 1,2-dioxygenase.

Hydroxyquinol 1,2-dioxygenase was assayed by a method similar to that previously reported (5, 18). The enzyme activity was determined spectrophotometrically by monitoring the conversion of hydroxyquinol (287 nm) to maleylacetate (243 nm) at 30°C, using a 1-ml mixture consisting of 100 μM hydroxyquinol and the crude extract (100 μg of protein) in 50 mM Tris-HCl buffer (pH 7.5).

(iv) Maleylacetate reductase.

Maleylacetate reductase activity was measured spectrophotometrically by monitoring the decrease in the absorbance at 340 nm derived from the consumption of NADH at 30°C, as previously described (18). Prior to the enzyme assay, a reaction mixture of 980 μl consisting of 100 μM hydroxyquinol and the crude extract containing hydroxyquinol 1,2-dioxygenase (50 μg of protein) in 50 mM Tris-HCl buffer (pH 8.0) was incubated at 30°C for 5 min to ensure the complete conversion of hydroxyquinol to the substrate, maleylacetate. The crude extract (50 μg of protein) and 200 μM NADH were subsequently added to this mixture to obtain a final volume of 1 ml, incubated at 30°C, and monitored for absorbance at 340 nm. A molar extinction coefficient of 6,600 M⁻¹ cm⁻¹ was used for NADH (19). One unit of maleylacetate reductase activity was defined as the amount of enzyme that consumed 1 μmol of NADH per minute under the assay conditions used.

Construction of disruption mutants.

Each tsd gene was disrupted by deleting its central region using the sacB counterselection system essentially as previously described (20, 21). The N-terminal and C-terminal portions of tsdA were tandemly inserted in pK18mobsacB. Those of tsdB, tsdR, tsdT, and tsdX were independently inserted in tandem in pK19mobsacB. Each of the resulting plasmids was introduced into RHA1 to let it integrate into the wild-type gene locus in the chromosome by homologous recombination. The corresponding deletion mutant was selected as a sucrose-tolerant derivative generated by additional homologous recombination that eliminated the part of the target gene and the vector sequence containing sacB. The expected gene disruption was confirmed by Southern hybridization analysis using three 0.6-kb PCR fragments as probes amplified by the lwtsdA_F and lwtsdA_R primer pair, the intRT_F and intRT_R primer pair, and the intTX_F and intTX_R primer pair (Table 2). The probes were labeled using a digoxigenin (DIG) system (Roche, Mannheim, Germany).

Reverse transcription (RT)-PCR analysis.

The cells of RHA1 and the tsdR mutant were grown in W minimal salt medium supplemented with 10 mM GRA or succinate at 30°C. When the A₆₀₀ reached approximately 0.8, the cells were harvested by centrifugation at 5,000 × g at 4°C for 10 min. Total RNA was isolated with Isogen (Nippon Gene, Toyama, Japan) and treated with DNase I (Roche). Single-stranded cDNA was synthesized from 6.0 μg of total RNA with 100 U of ReverTra Ace reverse transcriptase (Toyobo Co. Ltd., Osaka, Japan) with random nonamer primers in a 30-μl reaction mixture. The cDNA mixture of 2.0 μl was used to perform PCR amplification in a 50-μl mixture using specific primers (Table 2) and 1.25 U of PrimeStar GXL DNA polymerase (TaKaRa Bio Inc., Otsu, Japan) under the following conditions: 98°C for 5 min plus 25 cycles of 98°C for 10 s, 57°C for 15 s, and 68°C for 30 s. A control without reverse transcriptase was used for each reaction to verify the absence of genomic DNA contamination. PCR-amplified samples were electrophoresed on a 2.0% agarose gel and visualized with ethidium bromide.

Electrophoretic mobility shift assays (EMSAs).

DNA fragments containing the tsdR-tsdB and tsdT-tsdR intergenic regions were prepared by PCR with specific primer pairs (Table 2). The 3′ ends of the probe fragments were labeled with DIG-11-ddUTP using the 2nd-generation DIG gel shift kit (Roche), according to the manufacturer's instructions. A binding reaction was performed at 20°C for 20 min in a 10-μl reaction mixture containing 50 ng of the purified His-tagged TsdR (His-TsdR), 1 nM DIG-labeled probe, 1 μg of poly(dI-dC), 0.1 μg of poly-l-lysine, 20 mM HEPES (pH 7.6), 1 mM EDTA, 10 mM (NH₄)₂SO₄, 1 mM dithiothreitol, 0.2% (wt/vol) Tween 20, and 30 mM KCl. To investigate the association of TsdR with GRA, His-TsdR was incubated with 100 μM GRA at 20°C for 10 min. DIG-labeled probe was then added to the mixture and incubated for 10 min. Gel electrophoresis and the detection of signals were performed as described previously (22).

Analytical methods.

The protein concentration was determined by the method of Bradford (23). The sizes of the proteins expressed in E. coli and the purity of the enzyme preparation were examined by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-PAGE). The proteins in the gels were stained with Coomassie brilliant blue R-250. GC-MS analysis was performed using a model 5971A instrument equipped with an Ultra-2 capillary column (50 m by 0.2 mm; Agilent Technologies Co., Palo Alto, CA). The analytical conditions were the same as those described previously (17). High-performance liquid chromatography (HPLC) analysis was performed with an Acquity Ultra Performance LC (Waters, Milford, MA) equipped with a TSKgel ODS-140HTP column (100 mm by 2.1 mm; Tosoh, Tokyo, Japan). The mobile phase was 1% (vol/vol) acetonitrile in water containing 0.1% (vol/vol) phosphoric acid, and the flow rate was 0.5 ml/min.

Nucleotide sequence accession number.

The genome sequence of RHA1 has been submitted to GenBank under accession no. CP000431.

RESULTS

Identification of GRA catabolism genes.

A tBLASTn homology search of the genome sequence of RHA1 was performed using the amino acid sequence of GRA decarboxylase (GraF; BAD54753) of Rhizobium sp. strain MTP-10005 as the query; ro01859 was identified as the most closely related gene sequence in the genome database of RHA1. The deduced amino acid sequence of ro01859 had an overall identity of 81% with GraF (Table 3), and this gene was named tsdA (for two,six-dihydroxybenzoate degradation genes). The deduced amino acid sequences of six open reading frames in the vicinity of tsdA showed similarities with GRA catabolic-pathway genes (Fig. 1A). The gene products of tsdC, tsdD, tsdB, tsdR, and tsdT showed similarities with hydroxyquinol 1,2-dioxygenase, maleylacetate reductase, resorcinol 4-hydroxylase, an IclR-type transcriptional regulator, and a major facilitator superfamily (MFS) transporter, respectively (Fig. 1B and Table 3). Therefore, these six genes are most likely involved in GRA catabolism. The tsdX product had 33 and 29% identity to putative hydrolases of unknown function in Streptomyces and Nocardioides, respectively.

TABLE 3.

Identification of tsd gene functions

Gene	Deduced molecular mass (Da)	Representative homolog	Identity (%)b	Accession no.
tsdX	30,568 [279]a	Putative hydrolase from Streptomyces scabiei 87.22	33	CBG71418
ro01863		α/β Hydrolase fold protein from Nocardioides sp. strain JS614	29	ABL79496
tsdT	54,748 [517]	Benzoate transporter (BenK) from A. baylyi ADP1	29	AAC46425
ro01862		4-Hydroxybenzoate transporter (PcaK) from P. putida PRS2000	25	AAA85137
tsdR	28,515 [276]	IclR-type transcriptional regulator from Acidovorax sp. strain JS42	37	ABM40699
ro01861		IclR-type transcriptional regulator (PobR) from A. baylyi ADP1	20	AAC37162
tsdB	57,771 [530]	FAD-dependent monooxygenase (GdmM) from Streptomyces hygroscopicus NRRL 3602	38	ABI93781
ro01860		Resorcinol 4-hydroxylase from C. glutamicum ATCC 13032	33	BAB98551
		3-(3-Hydroxyphenyl)propionate hydroxylase (MhpA) from E. coli K-12	29	CAA70747
tsdA	37,348 [329]	GRA decarboxylase (GraF) from Rhizobium sp. strain MTP-10005	81	BAD54753
ro01859		GRA decarboxylase from Agrobacterium tumefaciens WU-0108	80	BAD61045
		2,3-Dihydroxybenzoate decarboxylase (DhbD) from Aspergillus niger	40	CAK48106
tsdD	37,122 [354]	Maleylacetate reductase (GraC) from Rhizobium sp. strain MTP-10005	62	BAF44524
ro01858		Maleylacetate reductase from A. tumefaciens C58	62	AAK88259
		Maleylacetate reductase from C. glutamicum ATCC 13032	39	BAB98552
tsdC	31,116 [282]	Hydroxyquinol 1,2-dioxygenase (GraB) from Rhizobium sp. strain MTP-10005	55	BAF44523
ro01857		Hydroxyquinol 1,2-dioxygenase from A. tumefaciens C58	53	AAK88258
		Hydroxyquinol 1,2-dioxygenase from C. glutamicum ATCC 13032	44	BAB98553

^aThe values in brackets are the numbers of amino acid residues.

^bPercentages of identity by aligning the deduced amino acid sequences using the EMBOSS alignment tool.

To define the operon structure of the tsd genes, RT-PCR analysis was performed with the total RNA harvested from RHA1 cells grown on GRA or succinate. The total RNA from the cells grown on GRA yielded distinct RT-PCR amplification products with the expected sizes for the intergenic regions of tsdX-tsdT, tsdB-tsdA, tsdA-tsdD, and tsdD-tsdC and the intragenic regions of tsdX and tsdC (see Fig. S1A in the supplemental material). This assay yielded no RT-PCR product for the tsdT-tsdR and tsdR-tsdB regions and the intragenic region of tsdR, whereas the RHA1 total DNA yielded the expected PCR amplification products for these regions. When the cells were grown on succinate, no RT-PCR products were observed, except for the products for 16S rRNA, which was used as a control, and tsdR. These results suggest that the tsd genes constitute three transcriptional units containing the tsdBADC and tsdTX operons and the monocistronic tsdR gene and that transcription of the tsdBADC and tsdTX operons is induced in the presence of GRA.

Identification of tsdA as the GRA decarboxylase gene.

To examine the enzymatic activity of the tsdA gene product, tsdA was expressed under the control of the T7 promoter in E. coli BL21(DE3) cells harboring pETSDA, which contained tsdA in pET21a. Using SDS-PAGE analysis, a 34-kDa protein was specifically observed in the crude extract of E. coli BL21(DE3) cells harboring pETSDA, and its size is approximately consistent with the size (37 kDa) estimated from the deduced amino acid sequence of tsdA (see Fig. S2 in the supplemental material). When GRA was incubated with the crude extract of BL21(DE3) cells carrying tsdA, GRA with maximum absorptions at 243 and 304 nm was converted to a product with a maximum absorption at 270 nm (Fig. 2A). GC-MS analysis of trimethylsilylated extracts from the aliquots of the TsdA reaction mixture revealed the depletion of a compound with a retention time of 22.5 min and accumulation of a compound with a retention time of 11.2 min (Fig. 2B to D). The retention times and mass spectra of these compounds were consistent with the trimethylsilyl (TMS) derivatives of GRA and resorcinol, respectively (data not shown). These results indicate that TsdA catalyzed the decarboxylation of GRA to generate resorcinol.

FIG 2.

Conversion of GRA to resorcinol by TsdA. (A) A reaction mixture containing 100 μM GRA and the crude extract containing TsdA (50 μg of protein/ml) was incubated at 30°C. UV-visible spectra were recorded at the start and after 2, 4, 6, 8, and 10 min of incubation. The dashed (top) and black (bottom) lines represent the results at the start and after 10 min, respectively. The results after 2 to 8 min are indicated by the gray lines in between. Arrows pointing up and down indicate increasing and decreasing absorbance, respectively. (B to D) A reaction mixture containing 1 mM GRA and the crude extract containing TsdA (500 μg of protein/ml) was incubated at 30°C. Gas chromatograms of TMS derivatives of the reaction products at the start (B) and after 30 (C) and 60 (D) min of incubation are shown.

To study the involvement of tsdA in GRA catabolism in RHA1, tsdA was inactivated by generating an internal deletion using a gene replacement technique. The 0.4-kb deletion in the tsdA gene of the resulting mutant strain, DTA, was confirmed by Southern hybridization analysis using the tsdA-tsdD spanning sequence (AD) probe containing a segment of tsdA (see Fig. S3 in the supplemental material). DTA did not grow when inoculated in W medium containing 10 mM GRA as a sole energy and carbon source (see Fig. S4A in the supplemental material). This result suggests that tsdA is essential for the growth of RHA1 on GRA. GC-MS analysis of resting RHA1 and DTA cells revealed that the DTA cells completely lacked TsdA activity, whereas the RHA1 cells depleted almost all GRA in 6 h (Fig. 3A). Therefore, tsdA is required for GRA decarboxylation.

FIG 3.

Degradation of GRA (A) and resorcinol (B) by RHA1 and its mutant derivatives. (A) Resting cells of RHA1 (open circles), DTA (solid circles), DTR (diamonds), and DTX (squares) were incubated with 1 mM GRA. (B) Resting cells of RHA1 (circles) and DTB (squares) were incubated with 1 mM resorcinol. The remaining amount of each substrate was determined by GC-MS analysis. The values represent the averages ± standard deviations of the results of three independent experiments.

Identification of TsdB as a NADH-specific resorcinol 4-hydroxylase.

Although the deduced amino acid sequence of tsdB showed similarity to a resorcinol 4-hydroxylase of C. glutamicum ATCC 13032, the identity between them is exceptionally low (Table 3). To determine whether tsdB is involved in resorcinol hydroxylation, His tag-fused tsdB was expressed in E. coli BL21 cells harboring pCISDB. SDS-PAGE analysis revealed the production of a 59-kDa protein (see Fig. S2 in the supplemental material), consistent with the deduced amino acid sequence. When purified His-tagged TsdB (His-TsdB) was incubated with 1 mM resorcinol in the presence of 200 μM NADH or 200 μM NADPH, consumption of NADH was observed at a specific activity of 0.10 ± 0.01 U/mg of protein. No apparent consumption of NADPH was observed, suggesting that tsdB encodes a NADH-specific single-component resorcinol 4-hydroxylase.

Characterization of the tsdB deletion mutant.

To examine the role of tsdB in GRA catabolism in RHA1, the tsdB gene was inactivated by generating an internal deletion. The 0.8-kb deletion in the tsdB gene of the resulting mutant strain, DTB, was confirmed by Southern hybridization analysis using the AD probe (see Fig. S3 in the supplemental material). DTB did not grow on GRA, suggesting that tsdB is required for GRA catabolism (see Fig. S4B in the supplemental material). When RHA1 resting cells were incubated at 30°C with 1 mM resorcinol, the resorcinol was completely depleted within 18 h (Fig. 3B). In contrast, the resting cells of DTB degraded only 25% of resorcinol over 18 h of incubation. These results suggest that tsdB is involved in resorcinol degradation, which is a part of the GRA catabolic pathway.

Identification of the tsdC and tsdD gene products.

The deduced amino acid sequences of tsdC and tsdD showed similarity to those of hydroxyquinol 1,2-dioxygenase and maleylacetate reductase, respectively (Table 3). To examine the functions of these genes, tsdC and tsdD were individually introduced into and expressed in E. coli BL21(DE3). SDS-PAGE analysis of the extracts of BL21(DE3) cells expressing tsdC and tsdD revealed the production of 31- and 34-kDa proteins, respectively (see Fig. S2 in the supplemental material), consistent with the deduced amino acid sequences. When the crude extract of BL21(DE3) cells carrying tsdC was incubated with 100 μM hydroxyquinol (λ_max = 287 nm), depletion of hydroxyquinol and production of a compound generating a spectrum with a maximum at 243 nm were observed (see Fig. S5 in the supplemental material). Because this spectrum is characteristic of maleylacetate, these results indicate the conversion of hydroxyquinol to maleylacetate (5, 18). No conversion of hydroxyquinol was observed when an extract of BL21(DE3) cells harboring the empty vector pET21a was used (data not shown). Therefore, tsdC encodes hydroxyquinol 1,2-dioxygenase. When an extract of tsdD-expressing BL21(DE3) cells and 200 μM NADH were added to the resulting solution of the above-mentioned reaction with the crude extract containing TsdC, consumption of NADH was observed at a specific activity of 4.54 ± 0.40 U/mg of protein. When the crude extract of BL21(DE3) harboring the empty pET21a vector and 200 μM NADH were added, only weak consumption activity (0.20 ± 0.01 U/mg) was observed. These results suggested that tsdD encodes maleylacetate reductase.

Characterization of the tsdT and tsdX deletion mutants.

BLASTp homology search analysis revealed that tsdX encodes a putative hydrolase. To study its function, an internal region of tsdX was deleted. The deletion of tsdX was confirmed by Southern hybridization using the tsdT-tsdX spanning sequence (TX) probe containing a segment of tsdX (see Fig. S3 in the supplemental material). The resulting mutant strain, DTX, grew similarly to RHA1 in W medium containing GRA as the sole carbon source (see Fig. S4A in the supplemental material). DTX cells grown in LB and suspended in Tris-HCl buffer depleted GRA similarly to RHA1 cells (Fig. 3A). These results suggest that in RHA1 cells, tsdX is not involved in GRA catabolism.

The deduced amino acid sequence of tsdT has approximately 30% identity with the MFS transporter genes encoding a benzoate transporter (BenK) in Acinetobacter baylyi ADP1 (24) and a 4-hydroxybenzoate transporter (PcaK) in Pseudomonas putida PRS2000 (25) (Table 3). To examine the role of tsdT in GRA catabolism, the tsdT gene was inactivated by internal deletion to obtain the mutant strain DTT. The deletion in the tsdT gene of DTT was confirmed by Southern hybridization analysis using the TX probe containing a segment of tsdT (see Fig. S3 in the supplemental material). The growth of DTT on GRA up to 96 h was significantly decreased at pH 7.0 (see Fig. S6 in the supplemental material). Aromatic acids in their undissociated form enter cells by passive diffusion at lower pH (24, 26–28); therefore, the growth of DTT cells was examined at low pH. When the pH of the medium was adjusted to 6.0 or 5.5, the growth retardation of DTT was partially suppressed. These results suggest that tsdT is involved in the uptake of GRA. However, the growth ability of DTT appeared similar to that of the wild type after 96 h of incubation. It is suggested that another transporter(s) that is induced by the intermediate metabolites of the GRA catabolic pathway may compensate for the tsdT deletion.

Transcriptional regulation of the tsd operon.

Based on sequence similarity, tsdR encodes a putative IclR-type transcriptional regulator. To examine whether the gene was functional, tsdR was inactivated by internal deletion to obtain the mutant strain DTR. The 0.2-kb deletion in the tsdR gene of DTR was confirmed by Southern hybridization analysis using the tsdR-tsdT spanning sequence (RT) probe containing a segment of tsdR (see Fig. S3 in the supplemental material). DTR and RHA1 had similar growth curves in the presence of GRA (see Fig. S4B in the supplemental material). However, GRA was more rapidly depleted by DTR than by RHA1 (Fig. 3A). These results suggest that the tsdR gene product (TsdR) negatively regulates the tsd genes and is responsible for the induction of these genes. To examine TsdR function, RT-PCR analysis was performed on the regions spanning from tsdT to tsdX and from tsdB to tsdA and the tsdC internal region using total RNA extracted from DTR cells grown on either GRA or succinate. The amplification products obtained using cells grown on succinate were similar to the corresponding products obtained using cells grown on GRA (see Fig. S1B in the supplemental material), indicating derepression of the tsd operons in the absence of GRA. These results indicate that tsdR encodes a transcriptional repressor that regulates the transcription of the tsdBADC and tsdTX operons.

His tag-fused tsdR was expressed in E. coli BL21(DE3) cells harboring pETBNR4. SDS-PAGE analysis revealed the expression of a 31-kDa protein, which is consistent with the deduced amino acid sequence (see Fig. S2 in the supplemental material). Purified His-TsdR was used in EMSAs with DNA probes containing the intergenic regions of tsdR-tsdB and tsdT-tsdR (Fig. 4). The EMSAs revealed that His-TsdR bound to both the tsdR-tsdB and tsdT-tsdR intergenic regions in the absence of GRA (Fig. 4). When 100 μM GRA was added to the reaction mixture, His-TsdR did not bind either the tsdR-tsdB or the tsdT-tsdR intergenic region. These results indicated the direct binding of TsdR with the tsdR-tsdB and tsdT-tsdR intergenic regions, which is inhibited by the direct interaction of TsdR with GRA.

FIG 4.

Binding of His-TsdR to the tsdT-tsdR and tsdR-tsdB intergenic regions. (A) Schematic diagrams of the DNA fragments used in EMSAs. (B) EMSAs of the binding of purified His-TsdR to the tsdT-tsdR and tsdR-tsdB intergenic regions. The positions of the free probe (F) and His-TsdR-DNA complex (CP) are shown. His-TsdR (50 ng) and 100 μM GRA were added as indicated.

DISCUSSION

Although RHA1 has a GRA catabolic pathway similar to that of Rhizobium sp. strain MTP-10005 (8) and a resorcinol catabolic pathway similar to that of C. glutamicum ATCC 13032 (9), the RHA1 resorcinol 4-hydroxylase is notably different from those of both strains. The RHA1 resorcinol 4-hydroxylase (TsdB) is a NADH-specific single-component enzyme, whereas the MTP-10005 enzyme is a two-component enzyme comprising GraA oxygenase and GraD reductase and has no amino acid sequence identity with the RHA1 enzyme. The ATCC 13032 resorcinol 4-hydroxylase (NCgl1111) is a NADPH-specific single-component enzyme. Furthermore, the amino acid sequence identity between TsdB and NCgl1111 is only 33%. Therefore, TsdB is a novel type of enzyme. Although NADH-dependent resorcinol 4-hydroxylase activity was observed in Rhodococcus sp. strain BPG-8 (10), further characterization has not been done. The BPG-8 enzyme may be similar to the RHA1 enzyme. The amino acid sequence of TsdB contains the conserved FAD-binding (GXGXXG) motif spanning the 21st to 26th amino acid residues, suggesting that TsdB uses FAD as an initial acceptor of electrons from NADH.

Transcription of tsdB was activated when cells were grown on GRA, and the tsdB mutant was unable to grow on GRA, suggesting that tsdB is essential for GRA catabolism. However, the tsdB mutant degraded resorcinol weakly, indicating that another gene(s) in RHA1 might function in resorcinol degradation. A BLASTp homology search of the RHA1 genome revealed seven putative tsdB homologs, which have 24 to 28% amino acid sequence identity with TsdB. One or more of these paralogs might degrade resorcinol in the tsdB mutant.

Based on the deduced amino acid sequence similarity, TsdA and GraF belong to the metallodependent hydrolase (amidohydrolase_2) superfamily (29), which includes 2-amino-3-carboxymuconate-6-semialdehyde (ACMS) decarboxylases from bacteria, animals, and humans (30–32). Crystallographic analysis of the ACMS decarboxylase NbaD from Pseudomonas fluorescens indicated that the active-site Zn ion is directly bound by His9, His11, His177, Asp294, and a water molecule that is coordinated by hydrogen bonds with Asp294 and His228 (33). The amino acid residues, with the exception of the residue corresponding to His9 of NbaD, were well conserved in TsdA and GraF. The residue corresponding to His9 was replaced by Glu8, suggesting that the glutamate residues might be involved in the coordination of the Zn ion in TsdA and GraF.

The hydroxyquinol degradation pathway has been observed in Burkholderia cepacia AC1100 (18), Sphingomonas wittichi RW1 (34), and Rhodococcus sp. strain PN1 (35); hydroxyquinol is cleaved by a hydroxyquinol 1,2-dioxygenase to β-hydroxy-cis,cis-muconate, which is spontaneously converted to maleylacetate through keto-enol tautomerization (36, 37). The resulting maleylacetate is then converted to β-ketoadipate by a maleylacetate reductase. The deduced amino acid sequences of tsdC and tsdD showed similarity to those of hydroxyquinol 1,2-dioxygenase and maleylacetate reductase genes, respectively. The crude extract containing TsdC showed the obvious conversion from hydroxyquinol to maleylacetate. When the crude extract containing TsdD was added to the TsdC reaction mixture, NADH consumption activity was observed. These results strongly suggested that hydroxyquinol is converted to β-ketoadipate by the sequential activities of TsdC and TsdD. The RHA1 TsdC contains conserved Tyr162, Tyr193, His217, and His219 residues, which correspond to the residues that were observed to coordinate an Fe(III) ion in the active site in a crystallographic study of the hydroxyquinol 1,2-dioxygenase in Nocardioides simplex 3E (38).

Comparison of tsd gene transcription in RHA1 and the tsdR mutant indicates that transcription of the tsdBADC and tsdTX operons is induced by the tsdR-encoded transcriptional repressor during growth on GRA. RT-PCR analysis revealed that transcription of tsdR is lower during growth on GRA than on succinate. These results suggest that tsdR transcription is autoregulated. The amino acid sequence similarity indicates that TsdR belongs to the IclR family of transcriptional regulators. Autorepression of IclR-type regulators has been observed with PobR, an activator of the p-hydroxybenzoate pathway in A. baylyi ADP1 (38); PcaR, an activator of the β-ketoadipate pathway in P. putida PRS2000 (39); and CatR, a repressor of the catechol 1,2-cleavage pathway in Rhodococcus erythropolis CCM2595 (40). TsdR may undergo autorepression, similar to these IclR-type transcriptional regulators (41). When the tsdR gene was deleted, the GRA degradation activity and the transcription of tsd catabolism operons were derepressed, even in the absence of GRA. However, the growth rate of the mutant strain on GRA was nearly equivalent to that of the wild-type strain, suggesting that the rate-limiting step for growth on GRA is the β-ketoadipate catabolic system, which might function downstream of the tsd gene-encoded enzyme system in the GRA catabolic pathway.

The EMSAs indicated that TsdR binds to both the tsdR-tsdB and tsdT-tsdR intergenic regions. In the tsdR-tsdB region, an imperfect inverted repeat with eight palindromic nucleotides (underlined), GTGTGGTTGCAATCACAC, was observed. Among eight imperfect inverted repeats observed in the tsdT-tsdR region, the inverted repeat with six palindromic nucleotides (underlined), TGTGACTCGCGTCATA, was most similar to the inverted repeat in the tsdR-tsdB region. These inverted-repeat sequences have no similarity to those bound by other IclR-type regulators, including PobR and PcaR (42). The binding of TsdR to the tsdR-tsdB and tsdT-tsdR regions was inhibited by addition of GRA, and transcription of the tsdTX and tsdBADC operons was upregulated during growth on GRA. These results indicate that TsdR represses transcription of the tsdTX and tsdBADC operons, and this repression is inhibited by the direct interaction of TsdR with GRA.

The deduced amino acid sequence of tsdT is similar to the aromatic acid-H⁺ symporter (AAHS) family of MFS transporters; in these transporters, the conserved charged amino acid motif (D/E)GX(D/E) in the first transmembrane region is required for substrate transport (43, 44). TsdT contains the EGFD motif at amino acids 31 to 34. Furthermore, the TMHMM and HMMTOP software analyses predicted 12 transmembrane helices in TsdT, which is a typical feature of MFS members (43). The growth of the tsdT mutant was at a significantly low level for 96 h. The growth deficiency of the tsdT mutant was partially suppressed under acidic conditions (see Fig. S6 in the supplemental material). At low pH, GRA most likely exists in the form of undissociated molecules and is transported through the membrane by passive diffusion, similar to other aromatic acids (24, 26–28). This feature might underlie the growth of the tsdT mutant on GRA at low pH. These results suggest that tsdT functions as a transporter in GRA catabolism. Because no additional mutation in the mutant tsdT locus was detected, the growth of the tsdT mutant after 96 hours of incubation appears to be due to the expression of a tsdT-homologous gene(s). A tsdT homolog, ro02998, with 24% identity is clustered with tsdC and tsdD homologs, ro02997 and ro02996, respectively. Expression of ro02998 might have compensated for the defective tsdT.

The organization of the tsd genes in RHA1 is similar to that of the gra genes in MTP-10005, except for the transporter and resorcinol 4-hydroxylase genes (see Fig. S7 in the supplemental material). The tsdT transporter gene in RHA1 is located separate from the tsdBADC catabolic-enzyme genes, whereas the graK transporter in MTP-10005 is located downstream of the graDAFCBE genes. Furthermore, these strains have different regulatory genes. RHA1 contains the IclR-type regulatory gene tsdR, whereas MTP-10005 contains a MarR-type regulatory gene. The resorcinol 4-hydroxylase is encoded by tsdB in RHA1 and by graA and graD in MTP-10005. The gene organization of the resorcinol catabolism genes in ATCC 13032 is similar to that in RHA1 (see Fig. S7 in the supplemental material), but the gene corresponding to tsdA is located neither in the resorcinol catabolism gene cluster nor in the genome of ATCC 13032. The regulatory gene in ATCC 13032 is not IclR type but TetR type. These observations suggest that RHA1 contains a novel organization of the GRA catabolism genes.

In conclusion, the novel GRA catabolism gene cluster in the Gram-positive bacterium R. jostii RHA1 was characterized in this study. The results suggest that GRA is transformed via resorcinol, hydroxyquinol, and maleylacetate to β-ketoadipate by the sequential action of the tsdA, tsdB, tsdC, and tsdD gene products. This GRA catabolic pathway includes the novel transcriptional regulator gene tsdR, which might provide insight into the evolution of regulatory systems for GRA catabolism genes. The elucidation of such regulatory mechanisms requires further analysis.