Skip to main content
Emerging Infectious Diseases logoLink to Emerging Infectious Diseases
letter
. 2015 Oct;21(10):1874–1875. doi: 10.3201/eid2110.141848

Human Infections with Pseudoterranova cattani Nematodes, Chile

Thomas Weitzel 1,2,3, Hiromu Sugiyama 1,2,3, Hiroshi Yamasaki 1,2,3, Cristian Ramirez 1,2,3, Reinaldo Rosas 1,2,3, Rubén Mercado 1,2,3,✉
PMCID: PMC4593429  PMID: 26402377

To the Editor: Anisakidosis is an emerging foodborne zoonosis caused by nematode larvae of the Anisakinae subfamily, which includes the genera Anisakis, Pseudoterranova, and Contracecum (1). In natural cycles, anisakid larvae are transmitted to marine mammals or piscivorous birds when they eat raw saltwater fish or squid. In the human incidental host, larvae attach to the mucosa of the gastrointestinal tract, causing clinical features ranging from asymptomatic carriage to severe abdominal pain with complications, such as gastric perforation (2). Microscopical diagnosis is hampered by the lack of distinguishing morphologic characteristics in larval stages (1). Recently, molecular genetic techniques have shown that the main species, Anisakis simplex and Pseudoterranova decipiens, are in fact species groups with distinct geographic and biologic characteristics (3,4). The P. decipiens complex consists of at least 6 sibling species (Technical Appendix Table). We report 4 human infections with P. cattani diagnosed during 2012–2014.

The case-patients were adults 22–59 years of age; 2 were female, and all lived in Santiago, Chile. Additional anamnestic and clinical data were available for 3 patients: all spontaneously regurgitated the parasites without having other gastrointestinal complaints. All 3 reported eating ceviche, a dish made of raw marine fish marinated in lemon juice. One patient reported a tingling sensation and coughs before the expulsion of a highly motile larva (Video). This patient was awaiting oral surgery after a bicycle accident and had eaten the last raw fish dish 2 weeks previously. Initially, parasites were identified by morphologic criteria. Larvae were 20 mm long, were of whitish to reddish color, and had 3 anterior lips (Technical Appendix Figure 1). Because of the presence of an anteriorly directed cecum (Technical Appendix Figure 2), they were assigned to Pseudoterranova species.

Video.

Video

Download video file (4.3MB, mp4)

Actively mobile larva of Pseudoterranova cattani after oral expulsion.

For further molecular identification, DNA samples were extracted by using a DNeasy Blood and Tissue Kit (QIAGEN K.K., Tokyo, Japan). The rRNA gene containing 2 internal transcribed spacer (ITS) regions was amplified by PCR using primers NC5 and NC2, as previously described (5). PCR products were sequenced by using a BigDye Terminator Cycle Sequencing Kit (Applied Biosystems Inc., Foster City, CA, USA) on an automated sequencer (ABI3100, Applied Biosystems). Sequence similarities were determined by a BLAST search of DDBJ (http://blast.ddbj.nig.ac.jp/top-j.html). The GENETYX-WIN program version 7.0 (Software Development Co., Tokyo, Japan) facilitated sequence alignment and comparison. Within the 4 ITS sequences of amplicons obtained, all were 100% identical, and alignment with the other P. cattani sequence differed only in 1 nt. ITS sequences of 2 isolates are available in GenBank (accession nos. KF781284 and KF781285). All P. cattani sequences showed a previously described deletion of ≈14 bases (Table), which is not observed in other members of the P. decipiens species complex (5).

Table. Alignment (comparison) of nucleotide sequences of the ITS1 gene of Pseudoterranova cattani and the Chilean specimen and P. decipiens*.

Isolate ITS1 sequence at 240–270 nt GenBank accession no.
Pc1 CTCTGTT--------------AACGCAGAGT AJ413981
CL#3 CTCTGTT--------------AACGCAGAGT KF781284
PdCa1 CTCTGTTTTGGTTTCAACGCTAACGCAGAGT AJ413979

*CL#3, specimen from Chile; Pc1; ITS, internal transcribed spacer. Pc1, P. cattani; PdCa1, P. decipiens.

This study identified P. cattani as a parasite capable of infecting humans. The definitive natural host of this parasite is the South American sea lion, Otaria byronia. At least 4 species of coastal fish were described as intermediate or paratenic hosts, including popular Chilean food fish species, such as Merluccius gayi, Genypterus maculatus, and Cilus gilberti (6). The spectrum of species causing human pseudoterranovosis is uncertain because most cases were reported as P. decipiens (sensu lato) or Pseudoterranova sp. Only recently, 1 case of P. azarasi infection has been documented in a patient from Japan (7). Although comparative studies are lacking, Pseudoterranova larvae seem to be less invasive and cause milder symptoms than Anisakis larvae (2,8). In the cases reported here, larvae were spontaneously expelled without further symptoms, except in 1 patient who reported the typical feature of noninvasive pseudoterranovosis, also described as “tingling throat syndrome” (8), a foreign body sensation accompanied by cough and retching. In Chile, ≈30 human cases have been reported, all diagnosed as P. decipiens or Pseudoterranova sp. by morphologic criteria (9,10). Most patients described mild oropharyngeal complaints and cough. More severe manifestations similar to parasitic pharyngitis caused by Fasciola hepatica or Linguatula serrata seem to be absent, although 1 patient had symptoms of asphyxia (9). The extent to which these cases in Chile were caused by P. cattani is uncertain because molecular diagnosis was not performed. The length of stay and location within the human gastrointestinal tract of Pseudoterranova larvae are unknown, but as indicated by 1 case in our report, lack of symptoms for up to 2 weeks is possible.

These cases demonstrate that P. cattani is an incidental human parasite causing oropharygeal pseudoterranovosis. To better understand the epidemiology and clinical relevance of these emerging fishborne zoonotic infections, molecular diagnostic techniques need to be more widely applied, especially in regions where raw fish is part of the regular diet, such as in many parts of South America.

Technical Appendix

Sibling species within the Pseudoterranova decipiens species complex and their geographic distribution; P. cattani larva with 3 anterior lips; anterior part of P. cattani larva showing anteriorly directed cecum.

14-1848-Techapp-s1.pdf (151KB, pdf)

Acknowledgments

We thank M. Muto and S. Ichimura for technical assistance.

This work was supported in part by Fondo Nacional de Desarrollo Cientifico y Tecnologico grant 1121035 to R.M. and grants-in-aids for Scientific Research from the Ministry of Health, Labour and Welfare, Japan to H.S. and H.Y. (no. H24-25-Shinko-Ippan-014).

Footnotes

Suggested citation for this article: Weitzel T, Sugiyama H, Yamasaki H, Ramirez C, Rosas R, Mercado R. Human infections with Pseudoterranova cattani, Chile [letter]. Emerg Infect Dis. 2015 Oct [date cited]. http://dx.doi.org/10.3201/eid2110.141848

1

These authors contributed equally to this article.

References

  • 1.Chai JY, Darwin Murrell K, Lymbery AJ. Fish-borne parasitic zoonoses: status and issues. Int J Parasitol. 2005;35:1233–54. 10.1016/j.ijpara.2005.07.013 [DOI] [PubMed] [Google Scholar]
  • 2.Hochberg NS, Hamer DH. Anisakidosis: perils of the deep. Clin Infect Dis. 2010;51:806–12 . 10.1086/656238 [DOI] [PubMed] [Google Scholar]
  • 3.Mattiucci S, Nascetti G. Advances and trends in the molecular systematics of anisakid nematodes, with implications for their evolutionary ecology and host–parasite co-evolutionary processes. Adv Parasitol. 2008;66:47–148. 10.1016/S0065-308X(08)00202-9 [DOI] [PubMed] [Google Scholar]
  • 4.Mattiucci S, Cipriani P, Webb SC, Paoletti M, Marcer F, Bellisario B, et al. Genetic and morphological approaches distinguish the three sibling species of the Anisakis simplex species complex, with a species designation as Anisakis berlandi n. sp. for A. simplex sp. C (Nematoda: Anisakidae). J Parasitol. 2014;100:199–214. 10.1645/12-120.1 [DOI] [PubMed] [Google Scholar]
  • 5.Zhu XQ, D’Amelio S, Palm HG, Paggi L, George-Nascimento M, Gasser RB. SSCP-based identification of members within the Pseudoterranova decipiens complex (Nematoda: Ascaridoidea: Anisakidae) using genetic markers in the internal transcribed spacers of ribosomal DNA. Parasitology. 2002;124:615–23. 10.1017/S0031182002001579 [DOI] [PubMed] [Google Scholar]
  • 6.George-Nascimento M, Urrutia X. Pseudoterranova cattani sp. nov. (Ascaridoidea: Anisakidae), a parasite of the South American sea lion Otaria byronia De Blainville from Chile. Rev Chil Hist Nat. 2000;73:93–8. 10.4067/S0716-078X2000000100010 [DOI] [Google Scholar]
  • 7.Arizono N, Miura T, Yamada M, Tegoshi T, Onishi K. Human infection with Pseudoterranova azarasi roundworm. Emerg Infect Dis. 2011;17:555–6. 10.3201/eid1703.101350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sakanari JA, McKerrow JH. Anisakiasis. Clin Microbiol Rev. 1989;2:278–84 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Torres P, Jercic MI, Weitz JC, Dobrew EK, Mercado R. Human pseudoterranovosis, an emerging infection in Chile. J Parasitol. 2007;93:440–3. 10.1645/GE-946R.1 [DOI] [PubMed] [Google Scholar]
  • 10.Jofré ML, Neira OP, Noemí HI, Cerva CJL. Pseudoterranovosis and sushi [in Spanish]. Rev Chilena Infectol. 2008;25:200–5. 10.4067/S0716-10182008000300010 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Technical Appendix

Sibling species within the Pseudoterranova decipiens species complex and their geographic distribution; P. cattani larva with 3 anterior lips; anterior part of P. cattani larva showing anteriorly directed cecum.

14-1848-Techapp-s1.pdf (151KB, pdf)

Articles from Emerging Infectious Diseases are provided here courtesy of Centers for Disease Control and Prevention

RESOURCES