Abstract
Embryo cryopreservation remains an important technique to enhance the reconstitution and distribution of animal populations with high genetic merit. One of the major detrimental factors to this technique is the damage caused by oxidative stress. Melatonin is widely known as an antioxidant with multi-faceted ways to counteract the oxidative stress. In this paper, we investigated the role of melatonin in protecting rabbit embryos during preimplantation development from the potential harmful effects of oxidative stress induced by in vitro culture or vitrification. Rabbit embryos at morula stages were cultured for 2 hr with 0 or 10−3 M melatonin (C or M groups). Embryos of each group were either transferred to fresh culture media (CF and MF groups) or vitrified/devitrified (CV and MV groups), then cultured in vitro for 48 hr until the blastocyst stage. The culture media were used to measure the activity of antioxidant enzymes: glutathione-s-transferase (GST) and superoxide dismutase (SOD), as well as the levels of two oxidative substrates: lipid peroxidation (LPO) and nitric oxide (NO). The blastocysts from each group were used to measure the expression of developmental-related genes (GJA1, POU5F1 and Nanog) and oxidative-stress-response-related genes (NFE2L2, SOD1 and GPX1). The data showed that melatonin promoted significantly (P<0.05) the blastocyst rate by 17% and 12% in MF and MV groups compared to their controls (CF and CV groups). The GST and SOD activity significantly increased by the treatment of melatonin in fresh or vitrified embryos, while the levels of LPO and NO decreased (P<0.05). Additionally, melatonin considerably stimulated the relative expression of GJA1, NFE2L2 and SOD1 genes in MF and MV embryos compared to CF group. Furthermore, melatonin significantly ameliorated the reduction of POU5F1 and GPX1 expression induced by vitrification. The results obtained from the current investigation provide new and clear molecular aspects regarding the mechanisms by which melatonin promotes development of both fresh and vitrified rabbit embryos.
Introduction
Livestock systems occupy about 30% of the planet's ice-free terrestrial surface area [1] and are a significant global asset with a value of at least $1.4 trillion. Several disease outbreaks and climate challenges threaten livestock permanence. Embryo cryopreservation is an essential tool that could be used to reconstitute livestock populations, particularly in endangered species and/or spread valuable genetic resources. Vitrification is an economical method for embryo cryopreservation that permits the rapid cooling without ice crystal formation [2–5]. However, vitrification carries the risk of exposure to oxidative stress derived by excessive free radicals [6–8]. The oxidative stress induced by vitrification could be due to suppression of embryos’ a defensive capacity against reactive oxygen species (ROS) [9]. Normally, the production of oxidant molecules like ROS is counterbalanced by antioxidants such as glutathione and vitamins C and E, as well as by enzymes such as catalase, superoxide dismutase, and glutathione peroxidase that convert ROS to less-damaging molecules [10]. Overproduction of ROS induced by vitrification is detrimental for the embryos due to different types of cell injuries, including membrane lipid peroxidation, impaired intracellular milieu, disturbed metabolism, amino acid and nucleic acid oxidation, adenosine triphosphate (ATP) depletion, mitochondrial dysfunction, apoptosis and necrosis [11–14]. These negative consequences of oxidative stress suppressed gene expression involved in in vitro embryo development. Expression of genes responsible for compaction and cell-to-cell adhesion, such as GJA1 (CX43), were found to be decreased when embryos produced in vitro compared with in vivo [15,16]. Also, low expression of GJA1 in blastocyst was associated with the low quality and survival after cryopreservation [17]. It was evidenced that POU5F1/Oct4 is essential for early development of mouse and human embryos [18,19]. Low expression of OCT3/4 genes in in vitro-produced blastocysts is associated with the low pluripotency [20] and/or reduction in ICM cells [21]. It was also reported that POU5F1 and Nanog genes are key regulators in proliferation and differentiation in preimplantation embryos [22]. Nanog gene was also reported to be an important gene for pluripotency and maintaining the stem cell state in rodent embryonic stem cells [23,24].
Melatonin (N-aceyl-5-methoxytryptamine) is produced mainly by the pineal gland and has an important role in controlling ROS [25]. One reason melatonin is such an effective antioxidant is that it does not act through a single mechanism, instead functions in a multifactorial manner to counteract oxidative stress. For example, melatonin acts as a direct scavenger of toxic oxygen derivatives and has the ability to reduce the formation of reactive species [26,27]. It also stimulates the gene expression or activity of other antioxidant enzymes and thus prevents the damage that may occur as a result of oxidative stress [28]. Many researchers confirmed that melatonin enhances in vitro development of embryos in mouse [29–32], porcine [33–35], ovine [14,36], bovine [37–39], buffalo [40] and rabbits [41]. The beneficial effects of melatonin on embryonic development were attributed to its ability to down regulate the expression of pro-apoptic genes (BAX and Caspase–3), up regulate the expression of an anti-apoptic gene (Bcl–2), and neutralize the effects of ROS [26,42,43]. In addition, it was found that treatment with melatonin in porcine parthenogenetic blastocysts increased the expression of OCT4 gene [44].
Few studies were carried out concerning protective effects of melatonin on cryopreserved and thawed embryos. For example, Abecia et al. [36] reported that melatonin improved the survival of thawed ovine embryos, increased the rate of hatched embryos and reduced the rate of degenerated embryos at the end of in vitro culture. Recently, Succu et al. [14] found a positive effect for 10−9 M melatonin on the development of vitrified ovine embryos during post-warming culture. In addition, Dehghani-Mohammadabadi et al. [13] concluded that melatonin at 10−12 M increased the cleavage rate, blastulation, and number of ICM and TE cells, and in contrast, decreased the apoptic index in mice vitrified embryos. These data suggest that melatonin may be particularly effective for increasing cryotolerance of vitrified embryos during thawing and in vitro manipulation. However, most of these studies focused on morphological aspects of embryo development and gaps remain to understand the extraordinary effect of melatonin at intracellular or molecular levels. Therefore, this study was carried out to investigate the beneficial effects of melatonin on preimplantation development of fresh and vitrified rabbit embryos at morphological and molecular levels.
Materials and Methods
Chemicals
Except when mentioned specifically, melatonin and other experimental reagents were purchased from Sigma-Aldrich (S.A., Egypt).
Animals and ethics statement
A total of 30 nulliparous rabbit does and 10 bucks belonging to the Red Baladi breed [45] were purchased from the rabbit farm stations of Animal Production Research Institute (APRI, Cairo, Egypt). All does and bucks were housed during the study period in a semi-closed rabbitry housing system (Agricultural Experiment Station, Faculty of Agriculture, Cairo University) and kept in batteries of individual cages (60x50x35 cm), supplied with feeding hoppers made of galvanized steel sheets and nipples for automatic drinker. They were maintained under the same standard environmental conditions with light alternating on a cycle of 16 light hours and 8 dark hours, fed with the same commercial diet (18.4% CP, 3.1% ether extract, 12.7% crude fibre and 2.600 kcal DE/kg) and had free access to water. All the experimental protocols were approved by the Research Ethics Committee at the Faculty of Agriculture, Cairo University.
Embryo recovery
Females were synchronized for the receptivity by an intramuscular injection with 20 IU eCG (Folligon, Intervet, Netherland) 60 hr before insemination. Does were inseminated with semen from adult males of the same breed as described by Lavara et al. [46]. Seventy two hours later, does were sacrificed by intravenous injection of a 1% solution of sodium thiobarbital and embryos were immediately collected by uterine flushing at room temperature (20–25°C). Flushing media consisted of DPBSCa (0.132 g calcium chloride/ 1 liter of Dulbecco’s phosphate-buffered saline), supplemented with 2 g Bovine Serum Albumin (BSA) and 10 ml antibiotics (10,000 units penicillin-G and 10 mg streptomycin per ml, penicillin-streptomycin solution 100X, BioShop Canada Inc.).
Treatments and embryo culture
Only normal recovered embryos (compact morula with intact mucin coat and zona pellucida) from each female were cultured in vitro for 2 hr in a one-well embryo culture dish (NUNC A/S, Thermo Fischer Scientific, Roskilde Site, Denmark), containing 3 ml culture media (TCM199 + 20% fetal bovine serum + 1% antibiotics) supplemented with 10−3 M of melatonin (M) or without melatonin supplementation to serve as control (C). Afterwards, embryos of each group were either transferred to fresh culture media and collected as fresh blastocysts (CF and MF groups), or directly vitrified/devitrified according to the methodology previously described by Mehaisen et al. [5] and cultured in vitro until blastocyst stage (CV and MV groups). Embryo culture was conducted in a 4-well embryo culture dish (10 embryos per well contained 1 ml of culture media; NUNC A/S, Thermo Fischer Scientific, Roskilde Site, Denmark) at 38.5°C, 5% CO2 and saturated humidity. Following 48 hr in culture media, the developmental ability of each group was calculated as the percentage of embryos that reached either the hatched or expanded blastocyst stages. Thereafter, developed blastocysts from each group were directly collected for evaluating gene expression profile, while the remaining culture media were used for measuring the activity of antioxidant enzymes and the levels of oxidative substrates released by the embryos.
Antioxidant enzymes activity and oxidative substrates levels
After embryo culture, 4 samples of culture media, 1 ml each, from each group were immediately frozen at -20°C for later analysis. The activity of two antioxidant enzymes: glutathione-s-transferase (GST) and superoxide dismutase (SOD), as well as levels of two oxidative substrates: lipid peroxidation (LPO) and nitric oxide (NO), were analyzed using colorimetric assay kits (K263-100 for GST, K335-100 for SOD, K739-100 for LPO and K262-200 for NO; BioVision, Inc., Milpitas, USA). The standard curves and calculations were performed following the kits protocol for each analysis then all values were related to the number of embryos developed to blastocyst stage in each sample.
The activity of GST enzyme was determined according to methods described by Habig et al. [47]. Briefly, 50 μl of each sample was added to 55 μl reaction mixture contained 49 μl GST assay buffer (pH 6.5), 1 μl 1-chloro–2,4-dinitrobenzene (CDNB) solution and 5 μl glutathione (GSH). The increase in absorbance at 340 nm was recorded for 5 min using automatic scanning spectrophotometer. The SOD enzyme activity was assayed by monitoring the inhibition of photochemical reduction of xanthine oxidase (XO) according Beyer and Fridovich [48] approach. In brief, Samples of 20 μl were mixed with 200 μl of WST–1 working solution and 20 μl of enzyme working solution then incubated at 37°C for 20 min. One unit of SOD activity was defined as the amount of enzyme required to cause 50% inhibition of the reduction of XO as monitored at 450 nm.
The LPO levels were determined by measuring the level of thiobarbituric acid reacting substances (TBARS) according to methods described by Farombi et al. [49] with modification. Briefly, 10 μl of sample was mixed with 500 μl of 10% trichloroacetic acid (TCA) containing 0.01 ml 5% (w/v) butylatedhydroxytoluene (BHT) and 500 μl of 0.75% TBA in 0.1 M HCl. The mixture was heated at 95°C for 60 min and after cooling centrifuged for 10 min at 10,000 g. The absorbance of Malondialdehyde (MDA) in the supernatant was determined using an automatic scanning spectrophotometer at 532 nm. The levels of NO were detected by colorimetric analysis in a simple two-step process [50]. In the first step, 85 μl of the sample was mixed with 5 μl of the Nitrate Reductase and 5 μl of the enzyme cofactor then incubated at room temperature for 1 hr to convert nitrate to nitrite. In the second step, 5 μl of the enhancer was added to each sample and incubated for 10 min, followed by 50 μl Griess Reagent R1 (containing phosphoric acid) and 50 μl Griess Reagent R2 (containing NED, N-(1-Naphthyl)ethylenediamine dihydrochloride). The azochromophore color amount developed from the last step was detected using automatic scanning spectrophotometer at 540 nm.
RNA isolation and quantitative real-time PCR
At the end of embryo culture, 30 blastocysts from each group (three replicates, 10 embryos each) were transferred from culture media into cryogenic vials (Corning Incorporated, Corning, NY, USA) and directly plunged into liquid nitrogen (LN2) for later analysis. Total RNA isolation was performed using the Arcturs® PicoPure® RNA isolation kit (Applied Biosystems, Carlsbad, USA) per manufacturer's instruction. Genomic DNA contamination was removed by performing column DNA digestion using RNase-free DNase (Qiagen GmbH, Hilden, Germany). RNA was eluted in 11 μl of elution buffer. The RNA from each replicate was reverse transcribed using 1 mM oligo (dT) primers and the Rever-AidcDNA synthesis kit (Thermo Fisher Scientific, Heidelberg, Germany) per manufacturer’s recommendations. Sequence-specific primers (Table 1) for the real-time PCR were designed using the Primer-blast web interface (http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) and each pair of primers was tested to achieve efficiencies close to 1.
Table 1. Details of primers used for real-time PCR quantitative analysis.
| Gene symbol | Gene full name | GenBank accession number | Primer sequences | Annealing temperature (°C) | Product size (bp) |
|---|---|---|---|---|---|
| GJA1 | Gap Junction Protein, Alpha 1 | NM_001198948 | F:atgagcagtctgcctttcgt | 55 | 228 |
| R:cgttgacaccatcagtttgg | |||||
| POU5F1 | POU Class 5 Homeobox 1 | NM_001099957 | F:gagatttgcaaagcggagac | 55 | 188 |
| R:cggttacagaaccacacacg | |||||
| Nanog | Nanog Homeobox | XM_002712762 | F:gccagtcgtggagtaaccat | 55 | 196 |
| R:tgtgctgtgttctggctttc | |||||
| NFE2L2 | Nuclear Factor, Erythroid 2-Like 2 | XM_002712305 | F:tgaaatcctcccaattcagc | 55 | 228 |
| R:gtgaagactgggctctcgac | |||||
| SOD1 | Superoxide Dismutase 1 | NM_001082627 | F:cacttcgagcagaagggaac | 54 | 184 |
| R:cgtgcctctcttcatccttc | |||||
| GPX1 | Glutathione Peroxidase 1 | NM_001085444 | F:gcttcgagaagttcctggtg | 53 | 218 |
| R:gcgttcctccatttgttttc | |||||
| GAPDH | Glyceraldehyde-3-Phosphate Dehydrogenase | NM_001082253 | F:aggtcatccacgaccacttc | 57 | 202 |
| R:gtgagtttcccgttcagctc | |||||
| H2A | Histone H2A. F/Z variant | NM_001170941 | F:cgcttccaaggatctcaaag | 56 | 211 |
| R:acaatgatggggagaacgag |
qRT-PCR for the 3 replicates of each group has been done in 20 μl reaction volume containing Maxima SYBR Green qPCR Master Mixes with ROX (Thermo Fisher Scientific, Heidelberg, Germany), the cDNA samples and the specific forward and reverse primers in Mx3000P™ real time PCR system (Stratagene). The thermal cycling parameter was set to 95°C for 3 min, 40 cycles at 95°C for 15 s and 60°C for 1 min. After the end of the last cycle, melting curve was generated by starting the fluorescence acquisition at 60°C and taking measurements every 7 s interval until the temperature reached 95°C (S1 Fig). The comparative cycle threshold (CT) method was used to quantify expression levels as described by Bermejo-Alvarez [51].
Statistical analysis
All statistical analyses were performed using IBM SPSS 22.0 Software Package (IBM corp., NY, USA, 2013). A generalized linear model was performed using a binary probit model with binomial distribution to analyze differences in the in vitro development rates in embryo groups (CF, CV, MF and MV). One-way ANOVA was used to determine statistical differences in antioxidant enzymatic activity between embryo groups followed by a multiple pair wise comparison (Duncan’s test). Gene expression data between embryo groups were analyzed using one-way ANOVA, followed by a multiple pairwise comparison using t-tests. Results are expressed as means ± S.E.M. and the significance level was set at P<0.05.
Results
Embryo culture and in vitro development rates
A total of 197 normal embryos at morula stage were recovered and randomly allocated for the treatment groups. Overall data and in vitro developmental rates of fresh and vitrified embryos treated or not treated with melatonin are presented in Table 2. Supplementation of culture media with melatonin for 2 hr significantly promoted the blastocyst rate when compared with fresh control embryos (93% vs. 76% for MF vs. CF, P<0.05). It tended to boost the blastocyst rate in vitrified embryos previously treated with melatonin in comparison with control vitrified embryos (81% blastocyst rate in MV group vs. 69% in CV group, P>0.05). In addition, melatonin enhanced the expanding rate of fresh and vitrified embryos even though improvement was not significant, while vitrification significantly increased the expanding rate in CV and MV groups when compared with CF group (64% and 70% vs. 32%, respectively, P<0.05). On the other hand, the hatchability rate was significantly lower in vitrified embryos compared to fresh embryos (4% and 11% for CV and MV groups vs. 44% for both CF and MF groups, respectively, P<0.05).
Table 2. In vitro development rates of fresh and vitrified rabbit embryos previously cultured with 0 or 10−3 M melatonin.
| Embryo groups | N | *Blastocyst rate (Means ± SE) | *Expanding rate (Means ± SE) | *Hatchability rate (Means ± SE) |
|---|---|---|---|---|
| CF | 50 | 0.76±0.060 b | 0.32±0.066 c | 0.44±0.070 a |
| MF | 55 | 0.93±0.035 a | 0.49±0.067 b | 0.44±0.067 a |
| CV | 45 | 0.69±0.069 b | 0.64±0.071 a b | 0.04±0.031 b |
| MV | 47 | 0.81±0.057 a b | 0.70±0.067 a | 0.11±0.045 b |
a, b values with different letters in the same column are significantly different (P<0.05).
N: number of cultured embryos.
* Calculated as a percentage of cultured embryos.
CF: fresh embryos without melatonin, MF: fresh embryos treated with melatonin, CV: vitrified embryos without melatonin, and MV: vitrified embryos treated with melatonin.
Antioxidant enzymes activity and oxidative substrates levels
Results of antioxidant enzymes activity and the levels of oxidative substrates in culture media of fresh and vitrified embryos supplemented with or without melatonin are shown in Table 3. Melatonin promoted the activation of the antioxidant enzymes in fresh embryos (6.7 vs. 5.1 μM GST/embryo, and 2.1 vs. 0.7 units SOD/embryo in MF vs. CF groups, respectively, P<0.05) and in vitrified embryos (6.3 vs. 4.3 μM GST/embryo, and 1.7 vs. 0.6 units SOD/embryo in MV vs. CV groups, respectively, P<0.05). On the contrary, the levels of oxidative substrates considerably decreased in fresh or vitrified embryo groups treated with melatonin when compared with their controls (LPO: 0.3 vs. 0.7 and 0.5 vs. 1.0 nM/embryo; NO: 0.7 vs. 1.1 and 0.6 vs. 1.4 μM/embryo for MF vs. CF and MV vs. CV groups, respectively, P<0.05).
Table 3. Antioxidant enzymes activity and oxidative substrates levels in culture media of fresh and vitrified rabbit embryos previously cultured with 0 or 10−3 M melatonin.
| Embryo groups | GST μM/embryo | SOD Unit/embryo | LPO nM/embryo | NO μM/embryo |
|---|---|---|---|---|
| CF | 5.1±0.50 b | 0.7±0.13 c | 0.7±0.05 b | 1.1±0.06 a |
| MF | 6.7±0.38 a | 2.1±0.12 a | 0.3±0.03 d | 0.7±0.07 b |
| CV | 4.3±0.28 b | 0.6±0.06 c | 1.0±0.03 a | 1.4±0.15 a |
| MV | 6.3±0.22 a | 1.7±0.15 b | 0.5±0.04 c | 0.6±0.09 b |
a, b, c values with different letters in the same column are significantly different (P<0.05).
CF: fresh embryos without melatonin, MF: fresh embryos treated with melatonin, CV: vitrified embryos without melatonin, and MV: vitrified embryos treated with melatonin.
GST: glutathione-s-transferase, SOD: superoxide dismutase, LPO: lipid peroxidation, and NO: nitric oxide.
Gene expression analysis
Results of quantitative real-time PCR for the examined developmental-related genes GJA1, POU5F1 and Nanog in fresh and vitrified embryos after melatonin supplementation to culture media are illustrated in Fig 1. Vitrification induced significant high expression of GJA1 gene by 3.67 fold (P<0.05) compared to fresh embryos (CF). Furthermore, media supplemented with melatonin resulted in significant stimulation of the GJA1 gene expression in fresh and vitrified embryos (P<0.05). The GJA1 gene was highly expressed in MV (8.72-fold), CV (3.67-fold), and MF (2.79-fold) groups compared to the CF group. The current data shows that the expression of POU5F1 and Nanog genes exibits different patterns. POU5F1 gene expression increased by 3.88 fold in MF embryos group while it decreased by 4.31 and 1.07 fold in CV and MV embryo groups compared to CF group (P<0.05). On the other hand, the expression of Nanog gene was considerably higher in MV group (7.32-fold, P<0.05) than in other embryo groups, while MF or CV groups did not show any significant difference in Nanog gene expression compared to CF embryos group (Fig 1).
Fig 1. Expression of developmental-related genes in fresh and vitrified rabbit embryos previously cultured with 0 or 10−3 M melatonin.
CF: fresh embryos without melatonin, MF: fresh embryos treated with melatonin, CV: vitrified embryos without melatonin, and MV: vitrified embryos treated with melatonin; a, b, c Bars with different superscripts are significantly different (P< 0.05).
The expression of oxidative-stress-response-related genes NFE2L2, SOD1 and GPX1 by qRT-PCR in fresh and vitrified embryos after melatonin supplementation to culture media are represented in Fig 2. In general, fresh embryos cultured in media supplemented with melatonin showed a significant high expression of NFE2L2, SOD1 and GPX1 genes in comparison with control embryos (P<0.05). Furthermore, NFE2L2 and SOD1 genes display similar pattern in responding to vitrification or melatonin treatment. A substantial increase in NFE2L2 expression was found in MF, CV and MV groups (1.86, 8.03, and 12.65 fold, respectively) when compared to CF group (P<0.05). Also, the expression of SOD1 gene significantly increased in MF, CV and MV groups by 4.45, 4.05, and 6.87 fold, respectively, compared to CF group (P<0.05). A total of 2.12 fold increase was observed in expression of GPX1 gene in MF embryos in comparison with CF embryos. While a reduction in GPX1 expression was observed in both vitrified embryo groups in comparison with CF group (P<0.05); the decrease was markedly observed in CV and MV groups (10.78 and 2.05 fold, respectively) compared to CF group (Fig 2).
Fig 2. Expression of oxidative-stress-response-related genes in fresh and vitrified rabbit embryos previously cultured with 0 or 10−3 M melatonin.
CF: fresh embryos without melatonin, MF: fresh embryos treated with melatonin, CV: vitrified embryos without melatonin, and MV: vitrified embryos treated with melatonin; a, b, c, d Bars with different superscripts are significantly different (P< 0.05).
Discussion
Previous studies mainly discussed the melatonin’s effects on the morphological variations regarding the in vitro embryo development, such as cleavage rate, blastocyst rate, hatched blastocyst rate and blastocyst cell number [26,36,52], while few studies were carried out to investigate melatonin effects at cellular and molecular levels in fresh and vitrified embryos, and rabbits were rarely used as animal models. The clear description of embryo development and functional genomic tools in rabbits make them particularly suitable and an important animal model for research for humans and other species [53].
The physiological concentrations of melatonin in plasma of rabbits were previously estimated by radioimmunoassay (RIA) as 22.7 pg/ml [54], that is approximately equivalent to 10−10 M. In our previous work [41], we used a concentration of melatonin close to physiological levels (10−9 M) and higher concentrations (10−6 M and 10−3 M) to study its effect on development of rabbit embryos recovered at different stages. It is concluded from this study that a 10−3 M concentration of melatonin for morulae embryos recovered from rabbit does at 72 hr post-insemination is optimal. In the present study, supplementation of culture media with 10−3 M melatonin also improved the in vitro development rate of rabbit embryos (Table 2). We found that blastocyst rate significantly increased by 17% to reach 93% in the MF group compared to 76% in the CF group. The positive effects of the lower doses (10−7–10−12 M) of melatonin on blastocyst formation and in vitro development were also observed in embryos of other species [14,26,32,35,38]. When embryos vitrified, the blastocyst rate decreased to 69% but it tended to increase again to 81% when vitrified embryos were previously treated with melatonin, even though the difference were not statistically significant (Table 2). However, the current study showed that melatonin treatment did not affect the hatchability or expanding of blastocysts like vitrification did itself; hatchability rates ranged between 4–11% vs. 44% and expanding rates ranged between 64–70% vs. 32–49% in vitrified vs. fresh embryos, respectively (P<0.05). The results of the current study are consistent with previous findings which indicated that timing of blastocoel cavity re-expansion after vitrification/warming and in vitro culture is associated with the capacity of embryos to restore vitrification injuries, and it is a reliable marker of the development capacity of vitrified embryos [55].
A primary function of melatonin is to serve as a potent-free radical scavenger and a broad-spectrum antioxidant [42,56–58]. The current research extended the points of melatonin investigation on embryo in vitro development to include the activity of many antioxidant enzymes. Therefore, LPO and NO levels as oxidative substrates, as well as the activity of GST and SOD as antioxidant enzymes, were evaluated in all experimental groups. In the CV group, low blastocyst rate synchronized with low hatchability was observed after thawing and culture (Table 2). In the same group, the highest level of LPO was recorded (P<0.05), indicating that these embryos were extremely sensitive to damage induced by vitrification and the high formation of LPO and NO released from damaged cells [59]. As shown in Table 3, melatonin significantly increased the activities of GST by 1.6 and 2.0 μM/embryo and SOD by 1.4 and 1.1 unit/embryo in MF and MV groups (P<0.05), respectively, compared to their controls. On the contrary, melatonin significantly diminished LPO by 0.4 and 0.5 nM/embryo and reduced NO by 0.4 and 0.8 μM/embryo in culture media of fresh and vitrified groups (P<0.05) compared to their controls, respectively. It has been known that SOD and GST antioxidant enzymes have an important role in catalyzing the conversion of superoxide to hydrogen peroxide (H2O2) and catalyzing the reduction of peroxide-containing compounds that may otherwise be toxic to the embryos, resulting in reduction of LPO and NO [60,61]. These observations could explain the damage reduction in embryos cultured with melatonin in MF and MV groups, showing a higher competence of these embryos for development to blastocyst stage than CF and CV embryos (Table 2).
Under conditions of cryopreservation, embryos that be blastulae or expand early, show a higher survival and probability of producing live births and therefore are considered to be more viable than embryos showing delayed blastulation or expanding [20]. When an expression analysis covering genes representative of essential events during development was applied, these embryos differed in expression of developmentally important genes [20,62]. The quantitative real-time PCR for examined developmental-related genes in our experimental groups were also studied and revealed important indications. The relative expression of GJA1 gene (known as Connexin CX43 gene) was significantly up-regulated by treatment of melatonin in fresh (2.79-fold in MF vs. 1-fold in CF) and vitrified (8.72-fold in MV vs. 3.67-fold in CV) embryos (Fig 1). However, we observed that GJA1 gene was over expressed in vitrified embryos, showing the highest expression in MV group when compared with other groups (Fig 1). Referring to differences in morphological aspects between embryo groups (Table 2), the expression of GJA1 seems to be inconsistent with the blastocyst formation and hatchability rates in the current study. These results are in line with Cruz et al. [63] finding, who reported that lower expression of GJA1 gene (CX43) does not correspond to morphological or functional differences of blastocyst types. In addition, Houghton et al. [64] concluded that the absence of Cx43 does not prevent implantation or disrupt prenatal development, and the capacity of preimplantation embryos to develop in the absence of Cx43 could be explained by the presence of any of the additional connexins, such as Cx30, Cx31, Cx40 and Cx45 [65]. These data raise the possibility that gap junctional coupling is not an essential aspect of preimplantation development, despite indication from other study that gap junction assembly is developmentally a regulated event [66]. The high expression of GJA1 gene in the MV group could be explained by the role of gap junctional coupling in amplifying the effects of oxidative stress, especially during vitrification and post-warming in vitro culture, and its role in transmission of cell death signals [67]. Alternatively, the supplementation of melatonin itself to the MV group may be another reason for the high incidence of GJA1 gene expression which is necessary in protecting cells from apoptotic cell death [68]. On the other hand, previous reports indicated that POU5F1 (also known as Oct4 gene) has a role in pluripotency and developmental competence of preimplantation embryos [20]. In the present study, a significant reduction in expression of POU5F1 was found in vitrified embryos compared to fresh embryos. However, previous culture of these embryos with melatonin significantly improved the relative expression of POU5F1 by 3.88-fold in fresh embryos and ameliorated the reduction induced by vitrification by 3.24-fold in vitrified embryos when compared to their controls (Fig 1). The over-expression of POU5F1 gene occurred by melatonin in the MF and MV groups was consistently correlated with a high expression in blastocyst rates in the same groups compared to the other groups (Table 2). The beneficial effects of melatonin on cleavage and blastocyst formation rates, and the total cell numbers in blastocysts were previously demonstrated in porcine embryos [44]. They also found a positive correlation of melatonin with expression of pluripotency marker (Oct4 gene). Our results also agree with recent results obtained by Wang et al. [38] who concluded that melatonin promoted blastocyst yield and accelerated in vitro bovine embryo development. They also added that melatonin improved the quality of blastocysts that was indexed by an elevated cryotolerance and the up-regulated expressions of developmentally important genes. Nanog is one of the earliest expressed set of genes known to control stemness, self-renewal and development of embryonic cells [69], however, Nanog expression could be detected only in inner-cell mass (ICM) of expanded blastocysts [70]. In the present study, the expression of Nanog gene was significantly higher in the MV group (7.32-fold, P<0.05) than in other embryo groups (Fig 1). The highest expanding rates recorded in vitrified embryos treated with melatonin in our study (Table 2) may explain why Nanog expression was higher in MV embryos when compared to the other groups [70]. While vitrification inflicted selective damage to the inner cell mass of embryos and decreased viability after transfer to recipients [71], the presence of melatonin increased the embryo cryotolerance to vitrification deleterious effects [38] as revealed in our study by enhancing the expression of GJA1 and Nanog genes as well as ameliorating the reduction of POU5F1 gene expression in MV group in comparison with CV group (Fig 1).
The previously reported increase in antioxidant enzyme activity caused by melatonin in our study could be explained by the increased levels of mRNA for the examined oxidative-stress-response-related genes. In fresh embryos, the treatment with melatonin significantly increased the relative expression of NFE2L2 (1.86-fold), SOD1 (4.45-fold) and GPX1 (2.12-fold) when compared to control embryos (Fig 2). Our results are in agreement with that obtained by Wang et al. [39] who reported that SOD1 and GPX4 mRNAs were significantly higher in melatonin-treated bovine embryos than that in controls. Similar results of SOD up-regulation expression by melatonin treatment of murine embryos were also previously reported [32]. According to previous reports [72,73], an inactive form of the NFE2L2 (also known as Nrf2) gene is abundant and sequestered to cytoplasm of blastocysts under low oxidative stress conditions. During vitrification, embryos are exposed to severe oxidative stress and have been more sensitive to oxidative stress [8,74]. Under such high oxidative conditions, an inactive form of Nrf2 is released from the cytoplasm into the nucleus where it can activate its target antioxidant genes by binding to their antioxidant response elements [72,73]. In the present study, embryo vitrification induced a significant increase in expression of NFE2L2 to 8.03-fold and 12.65-fold in CV and MV groups, respectively (Fig 2). The up-regulation increase of NFE2L2 transcript during vitrification was reported to protect embryo from induced oxidative stress through preservation of intracellular redox states and is essential to maintain normal embryonic development [75]. Therefore, the transcript abundance of NFE2L2 with the low hatchability rate in vitrified embryos in the present study may be attributed to the high apoptosis induced in vitrified embryos [76]. However, NFE2L2 profile significantly increased in the presence of melatonin in vitrified embryos, indicating the importance of NFE2L2 to restore embryos to be more tolerant to oxidative stress and more competent for development [73]. In parallel to NFE2L2, the SOD1 gene continued to be highly expressed in vitrified embryos (4.05-fold and 6.87-fold in CV and MV groups, respectively). Similar results were obtained by Jahromi et al. [77] who reported an increase in Mn-SOD expression in vitrified/thawed mouse oocytes compared with the control. The enrichment of nuclear Nrf2 protein is accompanied by more abundant antioxidant gene transcripts including SOD1 in competent blastocysts, and subsequently resulted in reduced ROS accumulation [73]. On the other hand, the relative expression of GPX1 significantly decreased after vitrification to 10.78-fold and 2.05-fold in CV and MV groups, respectively (Fig 2). GPX enzymes are essential for the glutathione redox cycle as a major source of protection against low levels of oxidant stress, whereas other antioxidant enzymes, such as catalase, become more significant in protecting against severe oxidant stress [78]. The high affinity and saturation of H2O2 that have GPX than other antioxidant enzymes [79,80] may explain the low expression of GPX1 in the CV group and the way it restores to higher levels in the MV and MF groups. We also observed that reduction in GPX1 and POU5F1 expression in vitrified groups (Figs 1 and 2) could be related to the lower hatchability rate in vitrified embryos than fresh embryos (Table 2). This result suggests that although GPX has a pivotal role in cell antioxidant protection during high O2 tension [81], its expression may decrease due to the decrease in embryo quality and developmental potential [82].
In conclusion, the current data of the present study show that exogenous melatonin enhances the blastocysts rate in fresh and vitrified embryos with multiple mechanisms of improving the embryonic development. One of the most important mechanisms is to modify the expressions of several embryo-developmentally key genes such as GJA1, POU5F1 and Nanog. Another mechanism could use melatonin to induce changes in the production of antioxidant enzymes and oxidative substrates, or to regulate the expression of oxidative-stress-response-related genes such as NFE2L2, SOD1 and GPX1. Thus, the use of melatonin could be a supportive tool, particularly when embryo development is affected by negative factors.
Supporting Information
(TIF)
Data Availability
All relevant data are within the paper and its Supporting Information file.
Funding Statement
This work was supported by the Rabbit Embryo Cryobank Project (RECP, Code: 3-2 p11) and by funds from Cairo University Research Park (CURP). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Steinfeld H, Gerber P, Wassenaar T, Castel V, Rosales M, De Haan C. Livestock’s Long Shadow: Environmental Issues and Options [Internet]. Rome, Italy: FAO; 2006. 10.1007/s10666-008-9149-3 [DOI] [Google Scholar]
- 2. Vicente JS, García-Ximénez F. Osmotic and cryoprotective effects of a mixture of DMSO and ethylene glycol on rabbit morulae. Theriogenology. 1994;42: 1205–1215. 10.1016/0093-691X(94)90869-9 [DOI] [PubMed] [Google Scholar]
- 3. Palasz AT, Mapletoft RJ. Cryopreservation of mammalian embryos and oocytes: recent advances. Biotechnol Adv. 1996;14: 127–149. 10.1016/0734-9750(96)00005-5 [DOI] [PubMed] [Google Scholar]
- 4. Dobrinsky J. Cryopreservation of swine embryos: A chilly past with a vitrifying future. Theriogenology. 2001;56: 1333–1344. 10.1016/S0093-691X(01)00634-3 [DOI] [PubMed] [Google Scholar]
- 5. Mehaisen GMK, Viudes-de-Castro MP, Vicente JS, Lavara R. In vitro and in vivo viability of vitrified and non-vitrified embryos derived from eCG and FSH treatment in rabbit does. Theriogenology. 2006;65: 1279–1291. 10.1016/j.theriogenology.2005.08.007 [DOI] [PubMed] [Google Scholar]
- 6. Lane M, Maybach JM, Gardner DK. Addition of ascorbate during cryopreservation stimulates subsequent embryo development. Hum Reprod. 2002;17: 2686–2693. 10.1093/humrep/17.10.2686 [DOI] [PubMed] [Google Scholar]
- 7. Somfai T, Ozawa M, Noguchi J, Kaneko H, Kuriani Karja NW, Farhudin M, et al. Developmental competence of in vitro-fertilized porcine oocytes after in vitro maturation and solid surface vitrification: effect of cryopreservation on oocyte antioxidative system and cell cycle stage. Cryobiology. 2007;55: 115–126. 10.1016/j.cryobiol.2007.06.008 [DOI] [PubMed] [Google Scholar]
- 8. Tatone C, Di Emidio G, Vento M, Ciriminna R, Artini PG. Cryopreservation and oxidative stress in reproductive cells. Gynecol Endocrinol. 2010;26: 563–567. 10.3109/09513591003686395 [DOI] [PubMed] [Google Scholar]
- 9. Ali AA, Bilodeau JF, Sirard MA. Antioxidant requirements for bovine oocytes varies during in vitro maturation, fertilization and development. Theriogenology. 2003;59: 939–949. 10.1016/S0093-691X(02)01125-1 [DOI] [PubMed] [Google Scholar]
- 10. Pop-Busui R, Sima A, Stevens M. Diabetic neuropathy and oxidative stress. Diabetes Metab Res Rev. 2006;22: 257–273. 10.1002/dmrr.625 [DOI] [PubMed] [Google Scholar]
- 11. Maity P, Bindu S, Dey S, Goyal M, Alam A, Pal C, et al. Melatonin reduces indomethacin-induced gastric mucosal cell apoptosis by preventing mitochondrial oxidative stress and the activation of mitochondrial pathway of apoptosis. J Pineal Res. 2009;46: 314–323. 10.1111/j.1600-079X.2009.00663.x [DOI] [PubMed] [Google Scholar]
- 12. Wang H, Rodriguez OC, Memili E. Mycotoxin Alpha-Zearalenol Impairs the Quality of Preimplantation Porcine Embryos. J Reprod Dev. 2012;58: 338–343. 10.1262/jrd.11-113H [DOI] [PubMed] [Google Scholar]
- 13. Dehghani-Mohammadabadi M, Salehi M, Farifteh F, Nematollahi S, Arefian E, Hajjarizadeh A, et al. Melatonin modulates the expression of BCL-xl and improve the development of vitrified embryos obtained by IVF in mice. J Assist Reprod Genet. 2014;31: 453–461. 10.1007/s10815-014-0172-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Succu S, Pasciu V, Manca ME, Chelucci S, Torres-Rovira L, Leoni GG, et al. Dose-dependent effect of melatonin on postwarming development of vitrified ovine embryos. Theriogenology. 2014;81: 1058–1066. 10.1016/j.theriogenology.2014.01.032 [DOI] [PubMed] [Google Scholar]
- 15. Wrenzycki C, Herrmann D, Keskintepe L, Martins A, Sirisathien S, Brackett B, et al. Effects of culture system and protein supplementation on mRNA expression in pre-implantation bovine embryos. Hum Reprod. 2001;16: 893–901. 10.1093/humrep/16.5.893 [DOI] [PubMed] [Google Scholar]
- 16. Lonergan P, Gutiérrez-Adán A, Rizos D, Pintado B, de la Fuente J, Boland MP. Relative messenger RNA abundance in bovine oocytes collected in vitro or in vivo before and 20 hr after the preovulatory luteinizing hormone surge. Mol Reprod Dev. 2003;66: 297–305. 10.1002/mrd.10357 [DOI] [PubMed] [Google Scholar]
- 17. Rizos D, Gutierrez-Adan A, Perez-Garnelo S, de la Fuente J, Boland MP, Lonergan P. Bovine Embryo Culture in the Presence or Absence of Serum: Implications for Blastocyst Development, Cryotolerance, and Messenger RNA Expression. Biol Reprod. 2003;68: 236–243. 10.1095/biolreprod.102.007799 [DOI] [PubMed] [Google Scholar]
- 18. Cauffman G, Van de Velde H, Liebaers I, Van Steirteghem A. Oct–4 mRNA and protein expression during human preimplantation development. Mol Hum Reprod. 2005;11: 173–181. 10.1093/molehr/gah155 [DOI] [PubMed] [Google Scholar]
- 19. Kawasumi M, Unno Y, Matsuoka T, Nishiwaki M, Anzai M, Amano T, et al. Abnormal DNA methylation of the Oct–4 enhancer region in cloned mouse embryos. Mol Reprod Dev. 2009;76: 342–350. 10.1002/mrd.20966 [DOI] [PubMed] [Google Scholar]
- 20. Gómez E, Caamaño JN, Bermejo-Alvarez P, Díez C, Muñoz M, Martín D, et al. Gene Expression in Early Expanded Parthenogenetic and In Vitro Fertilized Bovine Blastocysts. J Reprod Dev. 2009;55: 607–614. 10.1262/jrd.09-077M [DOI] [PubMed] [Google Scholar]
- 21. Nganvongpanit K, Müller H, Rings F, Gilles M, Jennen D, Hölker M, et al. Targeted suppression of E-cadherin gene expression in bovine preimplantation embryo by RNA interference technology using double-stranded RNA. Mol Reprod Dev. 2006;73: 153–163. 10.1002/mrd.20406 [DOI] [PubMed] [Google Scholar]
- 22. Hamatani T, Carter MG, Sharov AA, Ko MSH. Dynamics of Global Gene Expression Changes during Mouse Preimplantation Development. Dev Cell. 2004;6: 117–131. 10.1016/S1534-5807(03)00373-3 [DOI] [PubMed] [Google Scholar]
- 23. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, et al. The homeoprotein nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 2003;113: 631–642. 10.1016/S0092-8674(03)00393-3 [DOI] [PubMed] [Google Scholar]
- 24. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003;113: 643–655. 10.1016/S0092-8674(03)00392-1 [DOI] [PubMed] [Google Scholar]
- 25. Tan DX, Chen L, Poeggeler B, Manchester LC, Reiter RJ. Melatonin: a potent, endogenous hydroxyl radical scavenger. Endocr J. 1993;1: 57–60. [Google Scholar]
- 26. Gao C, Han H-B, Tian X-Z, Tan D-X, Wang L, Zhou G-B, et al. Melatonin promotes embryonic development and reduces reactive oxygen species in vitrified mouse 2-cell embryos. J Pineal Res. 2012;52: 305–311. 10.1111/j.1600-079X.2011.00944.x [DOI] [PubMed] [Google Scholar]
- 27. Cruz MHC, Leal CLV, da Cruz JF, Tan D-X, Reiter RJ. Role of melatonin on production and preservation of gametes and embryos: a brief review. Anim Reprod Sci. 2014;145: 150–160. 10.1016/j.anireprosci.2014.01.011 [DOI] [PubMed] [Google Scholar]
- 28. Kotler M, Rodríguez C, Sáinz RM, Antolín I, Menéndez-Peláez A. Melatonin increases gene expression for antioxidant enzymes in rat brain cortex. J Pineal Res. 1998;24: 83–89. 10.1111/j.1600-079X.1998.tb00371.x [DOI] [PubMed] [Google Scholar]
- 29. Ishizuka B, Kuribayashi Y, Murai K, Amemiya A, Itoh MT. The effect of melatonin on in vitro fertilization and embryo development in mice. J Pineal Res. 2000;28: 48–51. 10.1034/j.1600-079x.2000.280107.x [DOI] [PubMed] [Google Scholar]
- 30. Dair EL, Simoes RS, Simões MJ, Romeu LRG, Oliveira-Filho RM, Haidar MA, et al. Effects of melatonin on the endometrial morphology and embryo implantation in rats. Fertil Steril. 2008;89: 1299–1305. 10.1016/j.fertnstert.2007.03.050 [DOI] [PubMed] [Google Scholar]
- 31. Tian X-Z, Wen Q, Shi J-M, Liang-Wang, Zeng S-M, Tian J-H. Effects of melatonin on in vitro development of mouse two-cell embryos cultured in HTF medium. Endocr Res. 2010;35: 17–23. 10.3109/07435800903539607 [DOI] [PubMed] [Google Scholar]
- 32. Wang F, Tian XZ, Zhang L, Tan DX, Reiter RJ, Liu G. Melatonin promotes the in vitro development of pronuclear embryos and increases the efficiency of blastocyst implantation in murine. J Pineal Res. 2013;55: 267–274. 10.1111/jpi.12069 [DOI] [PubMed] [Google Scholar]
- 33. Rodriguez-Osorio N, Kim IJ, Wang H, Kaya A, Memili E. Melatonin increases cleavage rate of porcine preimplantation embryos in vitro. J Pineal Res. 2007;43: 283–288. 10.1111/j.1600-079X.2007.00475.x [DOI] [PubMed] [Google Scholar]
- 34. Kang J-T, Koo O-J, Kwon D-K, Park H-J, Jang G, Kang S-K, et al. Effects of melatonin on in vitro maturation of porcine oocyte and expression of melatonin receptor RNA in cumulus and granulosa cells. J Pineal Res. 2009;46: 22–28. 10.1111/j.1600-079X.2008.00602.x [DOI] [PubMed] [Google Scholar]
- 35. Pang Y-W, An L, Wang P, Yu Y, Yin Q-D, Wang X-H, et al. Treatment of porcine donor cells and reconstructed embryos with the antioxidant melatonin enhances cloning efficiency. J Pineal Res. 2013;54: 389–397. 10.1111/jpi.12024 [DOI] [PubMed] [Google Scholar]
- 36. Abecia JA, Forcada F, Zu O, Zúñiga O. The effect of melatonin on the secretion of progesterone in sheep and on the development of ovine embryos in vitro. Vet Res Commun. 2002;26: 151–158. 10.1023/A:1014099719034 [DOI] [PubMed] [Google Scholar]
- 37. Papis K, Poleszczuk O, Wenta-Muchalska E, Modlinski JA. Melatonin effect on bovine embryo development in vitro in relation to oxygen concentration. J Pineal Res. 2007;43: 321–326. 10.1111/j.1600-079X.2007.00479.x [DOI] [PubMed] [Google Scholar]
- 38. Wang F, Tian XZ, Zhou Y, Tan DX, Zhu S, Dai Y, et al. Melatonin improves the quality of in vitro produced (IVP) bovine embryos: implications for blastocyst development, cryotolerance, and modifications of relevant gene expression. PLoS One. 2014;9: e93641 10.1371/journal.pone.0093641 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Wang F, Tian XZ, Zhang L, Gao C, He C, Fu Y, et al. Beneficial effects of melatonin on in vitro bovine embryonic development are mediated by melatonin receptor 1. J Pineal Res. 2014;56: 333–342. 10.1111/jpi.12126 [DOI] [PubMed] [Google Scholar]
- 40. Manjunatha BM, Devaraj M, Gupta PSP, Ravindra JP, Nandi S. Effect of taurine and melatonin in the culture medium on buffalo in vitro embryo development. Reprod Domest Anim. 2009;44: 12–16. 10.1111/j.1439-0531.2007.00982.x [DOI] [PubMed] [Google Scholar]
- 41. Mehaisen GMK, Saeed AM. In vitro development rate of preimplantation rabbit embryos cultured with different levels of melatonin. Zygote. 2013;23: 111–115. 10.1017/S0967199413000415 [DOI] [PubMed] [Google Scholar]
- 42. Reiter RJ, Tan D-X, Manchester LC, Paredes SD, Mayo JC, Sainz RM. Melatonin and reproduction revisited. Biol Reprod. 2009;81: 445–456. 10.1095/biolreprod.108.075655 [DOI] [PubMed] [Google Scholar]
- 43. Mohseni M, Mihandoost E, Shirazi A, Sepehrizadeh Z, Bazzaz JT, Ghazi-Khansari M. Melatonin may play a role in modulation of bax and bcl–2 expression levels to protect rat peripheral blood lymphocytes from gamma irradiation-induced apoptosis. Mutat Res—Fundam Mol Mech Mutagen. 2012;738–739: 19–27. 10.1016/j.mrfmmm.2012.08.006 [DOI] [PubMed] [Google Scholar]
- 44. Choi J, Park S-M, Lee E, Kim J-H, Jeong Y-I, Lee J-Y, et al. Anti-apoptotic effect of melatonin on preimplantation development of porcine parthenogenetic embryos. Mol Reprod Dev. 2008;75: 1127–1135. 10.1002/mrd.20861 [DOI] [PubMed] [Google Scholar]
- 45. Khalil MH. The Baladi Rabbits (Egypt) In: Khalil M. H., Baselga M., editors. Rabbit genetic resources in Mediterranean countries. Zaragoza: CIHEAM; 2002. pp. 41–50 (Options Méditerranéennes : Série B, n. 38). Available: http://om.ciheam.org/article.php?IDPDF=2600008 [Google Scholar]
- 46.Lavara R, Lavara F, Vicente JS, Moce E. Use of different diluents with a low number of spermatozoa by insemination dose in rabbit. 7th World Rabbit Congress. Valencia, Spain: UPV; 2000. pp. 173–177. Available: http://world-rabbit-science.com/WRSA-Proceedings/Congress-2000-Valencia/Papers/Reproduction/R15-Lavara.pdf
- 47. Habig WH, Pabst MJ, Jakoby WB. Glutathione S transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem. 1974;249: 7130–7139. Available: http://www.jbc.org/content/249/22/7130.full.pdf [PubMed] [Google Scholar]
- 48. Beyer WF, Fridovich I. Assaying for superoxide dismutase activity: Some large consequences of minor changes in conditions. Anal Biochem. 1987;161: 559–566. 10.1016/0003-2697(87)90489-1 [DOI] [PubMed] [Google Scholar]
- 49. Farombi E, Thanteng J, Agboola A, Nwankwo J, Emerole G. Chemoprevention of 2-Acetylaminofluorene-induced Hepatotoxicity and Lipid Peroxidation in Rats by Kolaviron-A Garcinia Kola Seed Extract. Food Chem Toxicol. 2000;38: 535–541. 10.1016/S0278-6915(00)00039-9 [DOI] [PubMed] [Google Scholar]
- 50. Li RC, Row BW, Kheirandish L, Brittian KR, Gozal E, Guo SZ, et al. Nitric oxide synthase and intermittent hypoxia-induced spatial learning deficits in the rat. Neurobiol Dis. 2004;17: 44–53. 10.1016/j.nbd.2004.05.006 [DOI] [PubMed] [Google Scholar]
- 51. Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P, Gutierrez-Adan A. Sex determines the expression level of one third of the actively expressed genes in bovine blastocysts. Proceedings of the National Academy of Sciences of the United States of America. USA; 2010. pp. 3394–3399. 10.1073/pnas.0913843107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Shi J-M, Tian X-Z, Zhou G-B, Wang L, Gao C, Zhu S-E, et al. Melatonin exists in porcine follicular fluid and improves in vitro maturation and parthenogenetic development of porcine oocytes. J Pineal Res. 2009;47: 318–323. 10.1111/j.1600-079X.2009.00717.x [DOI] [PubMed] [Google Scholar]
- 53. Fischer B, Chavatte-Palmer P, Viebahn C, Santos A, Duranthon V. Rabbit as a reproductive model for human health. Reproduction. 2012;144: 1–10. 10.1530/REP-12-0091 [DOI] [PubMed] [Google Scholar]
- 54. Noguchi H, Kitazumi K, Mori M, Shiobara Y, Shiba T. Full Paper Effect of Zaleplon, a Non-benzodiazepine Hypnotic, on Melatonin Secretion in Rabbits. J Pharmacol Sci. 2003;93: 204–209. 10.1254/jphs.93.204 [DOI] [PubMed] [Google Scholar]
- 55. Leoni GG, Berlinguer F, Succu S, Bebbere D, Mossa F, Madeddu M, et al. A new selection criterion to assess good quality ovine blastocysts after vitrification and to predict their transfer into recipients. Mol Reprod Dev. 2008;75: 373–382. 10.1002/mrd.20754 [DOI] [PubMed] [Google Scholar]
- 56. Hardeland R. Antioxidative protection by melatonin: multiplicity of mechanisms from radical detoxification to radical avoidance. Endocrine. 2005;27: 119–130. 10.1385/ENDO:27:2:119 [DOI] [PubMed] [Google Scholar]
- 57. Bonnefont-Rousselot D, Collin F, Jore D, Gardès-Albert M. Reaction mechanism of melatonin oxidation by reactive oxygen species in vitro. J Pineal Res. 2011;50: 328–335. 10.1111/j.1600-079X.2010.00847.x [DOI] [PubMed] [Google Scholar]
- 58. Galano A, Tan DX, Reiter RJ. On the free radical scavenging activities of melatonin’s metabolites, AFMK and AMK. J Pineal Res. 2013;54: 245–257. 10.1111/jpi.12010 [DOI] [PubMed] [Google Scholar]
- 59. Myatt L. Review: Reactive oxygen and nitrogen species and functional adaptation of the placenta. Placenta. 2010;31: S66–S69. 10.1016/j.placenta.2009.12.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Raijmakers MTM, Steegers EAP, Peters WHM. Glutathione S-transferases and thiol concentrations in embryonic and early fetal tissues. Hum Reprod. 2001;16: 2445–2450. 10.1093/humrep/16.11.2445 [DOI] [PubMed] [Google Scholar]
- 61. Burton GJ, Hempstock J, Jauniaux E. Oxygen, early embryonic metabolism and free radical-mediated embryopathies. Reprod Biomed Online. 2002;6: 84–96. 10.1016/S1472-6483(10)62060-3 [DOI] [PubMed] [Google Scholar]
- 62. Wrenzycki C, Herrmann D, Niemann H. Timing of blastocyst expansion affects spatial messenger RNA expression patterns of genes in bovine blastocysts produced in vitro. Biol Reprod. 2003;68: 2073–2080. 10.1095/biolreprod.102.012104 [DOI] [PubMed] [Google Scholar]
- 63. D’Cruz NT, Wilson KJ, Cooney MA, Tecirlioglu RT, Lagutina I, Galli C, et al. Putative imprinted gene expression in uniparental bovine embryo models. Reprod Fertil Dev. 2008;20: 589–597. 10.1071/RD08024 [DOI] [PubMed] [Google Scholar]
- 64. Houghton FD, Barr KJ, Walter G, Gabriel H, Gru R, Traub O, et al. Functional Significance of Gap Junctional Coupling in Preimplantation Development 1. Biol Reprod. 2002;66: 1403–1412. 10.1095/biolreprod66.5.1403 [DOI] [PubMed] [Google Scholar]
- 65. Davies TC, Barr KJ, Jones DH, Zhu D, Kidder GM. Multiple members of the connexin gene family participate in preimplantation development of the mouse. Dev Genet. 1996;18: 234–243. 10.1002/(SICI)1520-6408(1996)18:3<234::AID-DVG4>3.0.CO;2-A [DOI] [PubMed] [Google Scholar]
- 66. De Sousa PA, Valdimarsson G, Nicholson BJ, Kidder GM. Connexin trafficking and the control of gap junction assembly in mouse preimplantation embryos. Development. 1993;117: 1355–1367. Available: http://dev.biologists.org/content/117/4/1355.full.pdf [DOI] [PubMed] [Google Scholar]
- 67. Lin JH-C, Weigel H, Cotrina ML, Liu S, Bueno E, Hansen AJ, et al. Gap-junction-mediated propagation and amplification of cell injury. Nat Neurosci. 1998;1: 494–500. 10.1038/2210 [DOI] [PubMed] [Google Scholar]
- 68. Bannerman P, Nichols W, Puhalla S, Oliver T, Berman M, Pleasure D. Early migratory rat neural crest cells express functional gap junctions: evidence that neural crest cell survival requires gap junction function. J Neurosci Res. 2000;61: 605–615. 10.1002/1097-4547(20000915)61:6<605::AID-JNR4>3.0.CO;2-U [DOI] [PubMed] [Google Scholar]
- 69. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, et al. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell. 2005;122: 947–956. 10.1016/j.cell.2005.08.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Cauffman G, De Rycke M, Sermon K, Liebaers I, Van de Velde H. Markers that define stemness in ESC are unable to identify the totipotent cells in human preimplantation embryos. Hum Reprod. 2009;24: 63–70. 10.1093/humrep/den351 [DOI] [PubMed] [Google Scholar]
- 71. Gómez E, Muñoz M, Rodríguez A, Caamaño JN, Facal N, Díez C. Vitrification of bovine blastocysts produced in vitro inflicts selective damage to the inner cell mass. Reprod Domest Anim. 2009;44: 194–199. 10.1111/j.1439-0531.2007.01026.x [DOI] [PubMed] [Google Scholar]
- 72. Gad A, Hoelker M, Besenfelder U, Havlicek V, Cinar U, Rings F, et al. Molecular Mechanisms and Pathways Involved in Bovine Embryonic Genome Activation and Their Regulation by Alternative In Vivo and In Vitro Culture Conditions. Biol Reprod. 2012;87: 100, 1–13. 10.1095/biolreprod.112.099697 [DOI] [PubMed] [Google Scholar]
- 73. Amin A, Gad A, Salilew-Wondim D, Prastowo S, Held E, Hoelker M, et al. Bovine embryo survival under oxidative-stress conditions is associated with activity of the NRF2-mediated oxidative-stress-response pathway. Mol Reprod Dev. 2014;81: 497–513. 10.1002/mrd.22316 [DOI] [PubMed] [Google Scholar]
- 74. Nedambale TL, Du F, Yang X, Tian XC. Higher survival rate of vitrified and thawed in vitro produced bovine blastocysts following culture in defined medium supplemented with β-mercaptoethanol. Anim Reprod Sci. 2006;93: 61–75. 10.1016/j.anireprosci.2005.06.027 [DOI] [PubMed] [Google Scholar]
- 75. Harris C, Hansen JM. Oxidative stress, thiols, and redox profiles. Methods Mol Biol. 2012;889: 325–346. 10.1007/978-1-61779-867-2_21 [DOI] [PubMed] [Google Scholar]
- 76. Ghanem N, Ha A-N, Fakruzzaman M, Bang J-I, Lee S-C, Kong I-K. Differential expression of selected candidate genes in bovine embryos produced invitro and cultured with chemicals modulating lipid metabolism. Theriogenology. 2014;82: 238–250. 10.1016/j.theriogenology.2014.03.024 [DOI] [PubMed] [Google Scholar]
- 77. Khodabandeh Jahromi Z, Amidi F, Mugehe SMHN, Sobhani A, Mehrannia K, Abbasi M, et al. Expression of Heat Shock Protein (HSP A1A) and MnSOD Genes Following Vitrification of Mouse MII Oocytes with Cryotop Method. Yakhteh Med J. 2010;12: 113–119. Available: http://celljournal.org/library/upload/article/15 Amidi.pdf [Google Scholar]
- 78. Yan H, Harding JJ. Glycation-induced inactivation and loss of antigenicity of catalase and superoxide dismutase. Biochem J. 1997;328: 599–605. Available: http://www.biochemj.org/bj/328/0599/3280599.pdf [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79. Izawa S, Inoue Y, Kimura A. Importance of catalase in the adaptive response to hydrogen peroxide: analysis of acatalasaemic Saccharomyces cerevisiae. Biochem J. 1996;320: 61–67. Available: http://www.biochemj.org/bj/320/0061/3200061.pdf [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80. Lledías F, Rangel P, Hansberg W. Oxidation of catalase by singlet oxygen. J Biol Chem. 1998;273: 10630–10637. 10.1074/jbc.273.17.10630 [DOI] [PubMed] [Google Scholar]
- 81. Guérin P, El Mouatassim S, Ménézo Y. Oxidative stress and protection against reactive oxygen species in the pre-implantation embryo and its surroundings. Hum Reprod Update. 2001;7: 175–189. 10.1093/humupd/7.2.175 [DOI] [PubMed] [Google Scholar]
- 82. Corrêa GA, Rumpf R, Mundim TCD, Franco MM, Dode MAN. Oxygen tension during in vitro culture of bovine embryos: effect in production and expression of genes related to oxidative stress. Anim Reprod Sci. 2008;104: 132–142. 10.1016/j.anireprosci.2007.02.002 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(TIF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information file.


