Skip to main content
Mobile DNA logoLink to Mobile DNA
. 2015 Oct 6;6:18. doi: 10.1186/s13100-015-0049-1

Identification and characterization of a minisatellite contained within a novel miniature inverted-repeat transposable element (MITE) of Porphyromonas gingivalis

Brian A Klein 1,2, Tsute Chen 2, Jodie C Scott 2, Andrea L Koenigsberg 1, Margaret J Duncan 2, Linden T Hu 1,✉
PMCID: PMC4596501  PMID: 26448788

Abstract

Background

Repetitive regions of DNA and transposable elements have been found to constitute large percentages of eukaryotic and prokaryotic genomes. Such elements are known to be involved in transcriptional regulation, host-pathogen interactions and genome evolution.

Results

We identified a minisatellite contained within a miniature inverted-repeat transposable element (MITE) in Porphyromonas gingivalis. The P. gingivalis minisatellite and associated MITE, named ‘BrickBuilt’, comprises a tandemly repeating twenty-three nucleotide DNA sequence lacking spacer regions between repeats, and with flanking ‘leader’ and ‘tail’ subunits that include small inverted-repeat ends. Forms of the BrickBuilt MITE are found 19 times in the genome of P. gingivalis strain ATCC 33277, and also multiple times within the strains W83, TDC60, HG66 and JCVI SC001. BrickBuilt is always located intergenically ranging between 49 and 591 nucleotides from the nearest upstream and downstream coding sequences. Segments of BrickBuilt contain promoter elements with bidirectional transcription capabilities.

Conclusions

We performed a bioinformatic analysis of BrickBuilt utilizing existing whole genome sequencing, microarray and RNAseq data, as well as performing in vitro promoter probe assays to determine potential roles, mechanisms and regulation of the expression of these elements and their affect on surrounding loci. The multiplicity, localization and limited host range nature of MITEs and MITE-like elements in P. gingivalis suggest that these elements may play an important role in facilitating genome evolution as well as modulating the transcriptional regulatory system.

Electronic supplementary material

The online version of this article (doi:10.1186/s13100-015-0049-1) contains supplementary material, which is available to authorized users.

Keywords: Species-specific repeat, DNA structure, Miniature Inverted-repeat Transposable Element, BrickBuilt, Transcriptional regulation, Porphyromonas

Background

Porphyromonas gingivalis, a gram-negative, anaerobic, asaccharolytic, black-pigmenting bacterium, is a keystone pathogen in the development and progression of periodontal disease [1, 2]. Multiple repetitive and transposable elements were previously identified in the P. gingivalis genomes [3–12]. Genome sequences are now available for multiple strains of P. gingivalis which has greatly facilitated genetic and genomic analyses of the species [9–16]. Each of the sequenced P. gingivalis genomes has contained multiple repetitive and transposable elements, an aspect that makes sequencing and alignment difficult.

Repetitive Elements (REs) are DNA sequences present in multiple copies throughout a genome, chromosome or vector. They are broadly classified into ‘terminal’, ‘tandem’ and ‘interspersed’ repeats, however, each of these classifications encompasses several sub-types of REs. Tandem repeats are classified as either identical or non-identical based on the level of nucleic acid matching. They are then further classified as either micro, mini or macro satellites based on size of the repeat. Repetitive elements can either be localized at a single site where a motif is recurrent sequentially adjacent to each other or at many loci as reiteration [17–19].

Transposable Elements (TEs) are ‘mobile’ DNA sequences that can change locus or multiply and insert into new loci within a genome or between genomes via excision/replication and insertion. They can insert into chromosomes, plasmids and bacteriophages. Class I TEs are retrotransposons, which require reverse-transcriptase activity to transpose. Class II TEs are DNA transposons, which unlike reverse transcriptase-utilizing Class I elements, require a transposase or a replicase to transpose [19–21]. Class II elements can either be autonomous or non-autonomous, the latter [canonically] having undergone mutations involving the transposase such that they can no longer duplicate or excise without the assistance of a parent element that utilizes a similar transposase. Within the non-autonomous element sub-class are miniature inverted-repeat transposable elements, or MITEs [22–25].

MITEs have a distinct structure relative to other TEs. They are between 50–1000 bp in length and are often present in high copy numbers per genome. MITEs are typically AT-nucleotide (nt) rich and frequently contain terminal inverted repeats (TIRs) and target site duplications (TSDs), but they lack the capacity to code for functional transposases [22–25]. Transposable elements, in particular MITEs, can be found in all taxa, varying in number and type between species and can account for greater than half of a genome. Bacteria typically carry between 10–20 copies of a MITE per genome, while plants may have up to 20,000 copies of a given MITE. Copy numbers are suggested to depend on non-coding region availability, polyploidy, the presence of a fully-functional autonomous version of a transposase, evolutionary ‘burst’ opportunities and regulatory potential of the given element [26–29]. Eukaryotic MITEs are frequently found in or closely associated with the coding region while prokaryotic MITEs are almost exclusively found intergenically [26, 30–36]. Intergenically located MITEs in prokaryotes have been shown to be able to affect gene expression [23, 25].

Several studies have demonstrated potential interactions of repetitive elements with transposable elements, which are generally thought to work independently and be mutually exclusive. In the wedge clam (Donax trunculu) genome as well as the butterfly and moth (Lepidoptera) genomes, ‘hitchhiking’ microsatellites were found within transposable elements [37, 38]. Microsatellites and simple sequence repeats have also been found closely associated with transposable elements in Neisseria meningitidis [39].

Here we describe ‘BrickBuilt’, a miniature inverted-repeat transposable element containing a minisatellite, in P. gingivalis. The sequences, location, copy number, prevalence throughout the species, as well as implications on genome (in)stability and transcriptional regulation are described. Similarities to other autonomous and non-autonomous P. gingivalis transposable elements are addressed with the goal of defining a potential network for the biogenesis of these elements in P. gingivalis and their effects on the P. gingivalis genome.

Results and discussion

Identification of a repetitive element in Porphyromonas gingivalis

We identified a DNA element, ‘BrickBuilt’, in the genome of P. gingivalis strain ATCC 33277. The element was initially identified as a tandemly-repeated sequence of 23 nt located intergenically at a single site (Additional file 1: Figure S1). A more thorough investigation of the genome revealed 19 independent, non-identical segments of the element scattered throughout the genome of strain ATCC 33277 (Table 1). The smallest number of 23 nt direct repeats is 1 (BrickBuilt_1) and the largest 22.8 (BrickBuilt_12). The 23 nt direct repeats are imperfect within a given element, imperfect bases vary from one element to another and imperfections do not correlate with length or total number of repeats within a given element (Fig. 1). The percent of mismatches within a given element varies from 0 to 11, and the percent of insertions and deletions within an element varies from 0 to 6. Within the 23 nt repeats there are conserved and non-conserved nucleotide sites, with the latter half of the element containing the majority of non-conserved sites (Fig. 1). Although similar in length to CRISPR element spacers and microRNAs, BrickBuilt elements are seemingly unrelated to these other entities.

Table 1.

Genes/Coding Sequences located 5′ and 3′ to BrickBuilt elements. Gene numbers and characterizations correspond to strain ATCC 33277. Loci of BrickBuilt elements across four sequenced and annotated P. gingivalis strains. BrickBuilt elements are situated intergenically between the genes noted. Grayed-out boxes represent loci at which BrickBuilt is aberrant

MITE 33277 Locus W83 Locus TDC60 Locus HG66 Locus Gene Characterization Gene Strand
BrickBuilt_1 PGN_0031 PG0033 PGTDC60_0032 EG14_02395 RmuC domain (DUF 805) -
PGN_0033 PG0034 PGTDC60_0034 EG14_02400 Thioredoxin trx -
BrickBuilt_2 PGN_0204 PG2159 PGTDC60_1262 EG14_03005 Protoporphyrinogen oxidase hemG +
PGN_0205 PG2161 PGTDC60_1265 EG14_03010 AraC family transcriptional regulator -
BrickBuilt_3 PGN_0303 PG0196 PGTDC60_0466 EG14_04795 Zinc protease (Peptidase M16) +
PGN_0306 PG0198 PGTDC60_0471 EG14_04805 PF05656 family protein (DUF 805) +
BrickBuilt_4 PGN_0336 NP PGTDC60_1661 EG14_04940 Immunoreactive antigen/PorSS CTD -
PGN_0340 NP PGTDC60_1665 EG14_04960 Peptidase S41/PorSS CTD +
BrickBuilt_5 PGN_0361 PG0264 PGTDC60_0543 EG14_05065 Glycosyl transferase family 2 +
PGN_0365 PG0267 PGTDC60_0547 EG14_05075 Arginyl-tRNA synthetase argS +
BrickBuilt_6 PGN_0400 PG1715 PGTDC60_0586 EG14_05255 TonB-dependent receptor Cna protein +
PGN_0403 PG1714 PGTDC60_0590 EG14_05265 Pyridoxamine-phosphate oxidase pdxH +
BrickBuilt_7 PGN_0455 PG0549 PGTDC60_0639 EG14_03135 Partial ISPg5 +
PGN_0456 PG0553 PGTDC60_0641 EG14_03150 Methylmalonyl-CoA mutase scpA -
BrickBuilt_8 PGN_0550 PG1559 PGTDC60_0739 EG14_03610 Glycine cleavage system subunit T gcvT +
PGN_0553 PG1556 PGTDC60_0743 EG14_03615 Conserved hypothetical (DUF2149) -
BrickBuilt_9 PGN_0558 PG1548 PGTDC60_0748 EG14_03640 Haem-binding protein hmuY -
PGN_0559 PG1550 PGTDC60_0751 EG14_03655 Serine protease (Peptidase C10) prtT -
BrickBuilt_10 PGN_0632 PG0585 PGTDC60_1709 EG14_09225 Aspartyl-tRNA amidotransferase B +
PGN_0633 PG0587 PGTDC60_1713 EG14_09235 Membrane protein putative ion channel btuF -
BrickBuilt_11 PGN_0667 PG0625 PGTDC60_1753 EG14_09060 GTP cyclohydrolase I/PorSS CTD folE +
PGN_0668 PG0627 PGTDC60_1756 EG14_09045 RNA-binding protein/PorSS CTD -
BrickBuilt_12 PGN_0819 PG0796 PGTDC60_1912 EG14_08255 Leucyl-tRNA synthetase leuS -
PGN_0823 PG0800 PGTDC60_1917 EG14_08240 NAD-utilizing dehydrogenase -
BrickBuilt_13 PGN_0831 PG0807 PGTDC60_1926 EG14_08205 N utilization substance/PorSS CTD -
PGN_0832 PG0809 PGTDC60_1927 EG14_08200 Gliding motility protein/PorSS CTD sprA -
BrickBuilt_14 PGN_0871 PG1389 PGTDC60_2074 EG14_07995 Membrane protein -
PGN_0872 PG1391 PGTDC60_2073 EG14_08000 DNA-binding protein (PF00216) +
BrickBuilt_15 PGN_0898 PG1424 PGTDC60_2039 EG14_07870 Peptidylarginine deiminase/PorSS CTD PAD -
PGN_0900 PG1427 PGTDC60_2036 EG14_07865 Peptidase C10/PorSS CTD -
BrickBuilt_16 PGN_1207 PG1117 PGTDC60_1098 EG14_06320 Transport multidrug efflux +
PGN_1208 PG1118 PGTDC60_1096 EG14_06310 ClpB chaperone and protease clpB -
BrickBuilt_17 PGN_1476 PG0494 PGTDC60_1611 EG14_09640 PorSS C-terminal sorting domain -
PGN_1479 PG0491 PGTDC60_1606 EG14_09650 Peptidase S10/PorSS CTD dppVII -
BrickBuilt_18 PGN_1777 PG1784 PGTDC60_0106 EG14_00235 Cysteine protease (Peptidase C1) -
PGN_1780 PG1786 PGTDC60_0110 EG14_00245 Endoribonuclease L-PSP -
BrickBuilt_19 PGN_2035 PG0088 PGTDC60_0367 EG14_01925 Peptidase M16 +
PGN_2037 PG0090 PGTDC60_0370 EG14_01930 DNA-binding protein from starved cells dps +

‘NP’ stands for ‘Not Present’

Fig. 1.

Fig. 1

Sequence logo representation of the 23 nucleotide repeat region from P. gingivalis strain ATCC 33277 multiple alignments. Generated with Weblogo software. Total height of a nucleic acid stack represents sequence conservation at a given position. Height of symbols at a stack represents relative frequency of a given nucleic acid at that position. Top sequence logo corresponds to compilation of the consensus of the 19 BrickBuilt elements; consensus for each made prior to combining for sequence logo. Bottom sequence logo corresponds to BrickBuilt_5 alone, constructed from its 18 full repeats

After determining the length and locations of each independent direct repeat element we performed alignments of the sequences flanking the direct repeats to determine whether specific DNA sequences or motifs were necessary for the presence of the element. Alignments of the sequences flanking the direct repeats revealed regions of homology, different for the two flanks of the repeat, which were determined to be ‘leader’ and ‘tail’ regions that encompassed the direct repeats (Fig. 2). Of the 19 elements, 11 are flanked by portions of both a leader and a tail, 3 by just leader, 2 by just tail, and 3 by neither. When considered as a single whole element, all BrickBuilt elements are intergenic, although some are within regions where annotation pipelines predicted hypothetical genes that do not appear to be expressed based on proteomic data [40–42]. Total length of the complete elements ranges from 991 nt (BrickBuilt_5) to 84 nt (BrickBuilt_14), which is determined by number of internal 23 nt repeats as well as the specific element may contain full, partial or no leader and tail segments. The longest leader segment is 285 nucleotides (BrickBuilt_17) and the longest tail segment is 318 nucleotides (BrickBuilt_4). No BrickBuilt element is bisected by a full-length autonomous transposable element. Thus, although repetitive intergenic sequences may be targets for insertion of exogenous or duplicated endogenous genes, such events have yet to be detected. Additionally, no leader-to-tail versions are present without a full 23 nt repeat and no TIR-containing individual leader or tail segments are present without the 23 nt repeats. A single site adjacent to the Hmu operon contains a partial tail-only version that lacks the terminal 20 nt that would include the TIR; no partial leader-only versions of the element are present.

Fig. 2.

Fig. 2

MEME motif analysis block output of the 19 BrickBuilt elements in P. gingivalis strain ATCC 33277. Entire element FASTA sequences were used as the input. Settings for analysis were: Distribution of motif occurrence as ‘any number of repetitions’, number of different motifs as ‘5’, minimum motif with as ‘23’, and maximum motif width as ‘200’. Dark and light blue blocks correspond to 23 nucleotide repeat regions, red blocks to leader regions and purple blocks to tail regions. Yellow blocks, potentially representing a 5th motif, were only found on the positive strand and had the lowest e-values associated with their significance scores

The genome sequence of strain ATCC 33277 contains 2,345,886 bases. When complied together all 19 BrickBuilt elements in strain ATCC 33277 make up 10,276 bases, or 0.44 percent of the overall genome; the equivalent of 9 protein coding sequences in this strain on average.

Conservation of BrickBuilt elements in other strains of P. gingivalis

Of the 19 versions of BrickBuilt found within strain ATCC 33277, 16 are conserved between the analogous coding sequences within strains W83, TDC60 and HG66 (Table 1 and Additional file 2: Table S1). Strains HG66 and TDC60 contain 19 versions of BrickBuilt, equivalent to the number in strain ATCC 33277. However, strain W83 only contains 18 versions of the element. Strains ATCC 33277 and HG66 share the exact same 19 loci for BrickBuilt elements. One locus in strain TDC60 (BrickBuilt_4) is deviant and is encompassed by two ISPg1 elements. Strain W83 has three sites that differ from the other strains, all which are located adjacent to other types of IS or repetitive elements. In this strain BrickBuilt_4 is completely lacking, while BrickBuilt_7 and BrickBuilt_18 are aberrant with respect to size having only maintained 23 nt repeats.

BrickBuilt elements can be identified in the genome of P. gingivalis strain JCVI SC001, which is not yet included in the default NCBI BLAST nucleotide database settings. Genome searches of the FASTA files from the JCVI SC001 revealed that most BrickBuilt loci in the JCVI SC001 genome contained strings of undetermined bases, which can be attributed to the manner of isolation, sequencing and assembly. Eight other P. gingivalis genomes have since been sequenced and deposited in NCBI, yet they are not completely assembled. Assembly gaps are located at sites where the corresponding surrounding CDS from ATCC 33277 contain BrickBuilt elements, suggesting BrickBuilt is present in those genomes as well and potentially capable of causing assembly difficulties (Additional file 3: Figure S2). Additionally, a degenerate version of the 23 nt repeat consensus sequence (AGAYCATARTATCCTCTCRTRTG) was searched against all 13 (8 unfinished) P. gingivalis genomes, each giving positive hits (data not shown). Because of assembly gaps and undetermined bases around BrickBuilt sites in the unfinished sequencing projects they were not included in multiple alignments.

Multiple alignments of BrickBuilt elements using the sequences from strains ATCC 33277, W83, TDC60 and HG66 revealed that sequences from strain ATCC 33277 align most closely with HG66, and those from strain W83 with TDC60 (Fig. 3). Similarly, a phylogenetic analysis with PHYML showed similar clustering of ATCC33277 with HG66 and W83 with TDC60 (Fig. 3). The matching of the sequences between the strains in the above pairings is consistent throughout 18 of 19 elements. Branching of BrickBuilt elements is congruent with the dendrogram generated based on genomic BLAST for all 13 P. gingivalis genomes. Interestingly, strain HG66 was deposited as ‘being closely related to strain W83’, yet based on the results of dendrogram from the full genome BLAST and from alignments of the BrickBuilt, this seems to be incorrect. The BrickBuilt_5, BrickBuilt_8, BrickBuilt_10, BrickBuilt_11, BrickBuilt_12, BrickBuilt_13, BrickBuilt_14 and BrickBuilt_15 sites all lie between the same two CDS within the respective genomes, with strains ATCC 33277 and HG66 usually having more 23 nucleotide repeats than W83 and TDC60. BrickBuilt_6 is the only site at which strains W83 and TDC60 have more 23 nt repeats than ATCC 33277 and HG66. BrickBuilt_9, the shortest element which is also the only element without a 23 nt repeat has only one SNP across the 100 nucleotides. Unlike all the other BrickBuilts, that single SNP would align strain ATCC 33277 with W83 and strain TDC60 with HG66.

Fig. 3.

Fig. 3

BrickBuilt_5 multiple alignment generated using MAFFT on the Geneious R8 platform with strain ATCC 33277, W83, TDC60 and HG66 inputs. The multiple alignment is focused on the first 200 nt of the leader region. Grey within the tracks denotes complete conservation at a site. Color within the tracks denotes variable sites. At all five sites where more than one strain is variable strains ATCC 33277 and HG66 cluster together, as do strains TDC60 and W83. Within this region only strains TDC60 and W83 have sites where they alone differ from the other three strains; this is consistent throughout for this specific element

The repetitive nature of the BrickBuilt elements, both the internal repeats and that they are found multiple times through the genome, can lead to sequencing, assembly and annotation issues. Because the strains W83, ATCC 33277, TDC60, HG66 and JCVI SC001 are unique strains, were sequenced independently, and were de novo assembled, placement of BrickBuilt elements at the same locus across genomes is unlikely to be due to use of a shared scaffold. However, care should be taken when aligning newly-sequenced P. gingivalis genomes to a scaffold.

Homology to MITEs and other repetitive elements

The 23 nt repeats and the leader and tail segments of the element were analyzed using BLAST (NCBI server) to determine whether the element is present in genomes other than the species P. gingivalis [43]. With default BLAST nucleotide settings, a full-length BrickBuilt and each of the three distinct parts of the element match solely to P. gingivalis. All four sequenced and annotated strains of P. gingivalis available for BLAST searching harbored hits for BrickBuilt. Through querying discontiguous megablast as well as using less stringent search constraints within megablast with ‘max target sequences’, ‘expect threshold’, ‘word size’ and ‘filter low complexity regions’, low-homology hits were obtained with the terminal inverted repeat regions. However, matches identified in this manner were only homologous in the TIR sections. Of note, when BLASTx searches (protein database search using a translated nucleotide query) were performed with the leader and tail sequences under default settings several Bacteroidetes species contained tail hits and one species contained a leader hit. Porphyromonas gulae contained strong hits with both leader and tail, while Prevotella tannerae and P. dentalis contained weak tail hits only. All of the BLASTx hits were either part of a predicted transposase/partial transposase or a hypothetical protein. If BrickBuilt were indeed a non-autonomous transposable element, homology to sections of related transposons through BLASTx would not be unexpected. As such, low BLASTx homology within Prevotella tannerae and P. dentalis does not point to these hits being potential parent or identical elements of BrickBuilt.

Genome analysis of recently-uploaded Porphyromonas gulae strains was carried out using the NCBI-deposited WGS shotgun sequencing data, from which we determined that P. gulae strains do in fact carry BrickBuilt homologues (Additional file 4: Figure S3) [44, 45]. Some of the P. gingivalis BrickBuilt element locations are conserved within P. gulae strains. However, greater strain variation seems evident in P. gulae at certain BrickBuilt loci than between P. gingivalis strains (Additioal file 5: Figure S3). Of note, the original P. gulae genome was obtained from a wolf and the subsequent strains were obtained from domesticated dogs. The original strain (DSM 15663) only contains 4 BrickBuilt homologues within the genome, and importantly lacks the BrickBuilt_5 homologue that was used for the majority of BLAST database queries.

Within P. gingivalis there have been three previously identified groups of MITEs or non-autonomous transposable elements; named the 239, 464 (PgRS) and 700 groups [10, 13]. These numbers are the names of three types of MITEs already noted in P. gingivalis genomics publications. The numbers were initially related to the overall length of the elements, however, the 464 type was renamed in subsequent publications and in NCBI genome graphics annotations. General copy numbers of the four MITE versions are similar, holding around 10–20. The number of full copies and partial or fragment copies of each element differs slightly between genomes within the species. During our examination of BrickBuilt we analyzed whether any sequence overlap was apparent between the elements and found that the terminal inverted repeats are similar, yet the rest of the elements do not bear similarity. 464/PgRS elements were previously identified as containing 41 nucleotide tandem direct repeats [10, 13]. The 23 and 41 nucleotide internal tandem direct repeats of the elements do not share homology with each other and neither have non-P. gingivalis BLAST matches within the NCBI database. The segments of the 464/PgRS elements flanking the 41 nt tandem direct repeats are themselves repetitive, which is unlike the non-repetitive leader and tail segments of BrickBuilt. Although not related by sequence, similarities in copy number between 464/PgRS and BrickBuilt elements are evident. With P. gingivalis harboring four types of MITE-like elements it is interesting that two types, BrickBuilt and 464/PgRS, contain microsatellite repeats. Although several 236 and 700-type elements are located near repeats or other repetitive elements, they seem not to have encompassed any mini- or microsatellites from analyses of the currently available genomes.

In addition to Tn and IS elements, multiple groups have described repetitive sequences within P. gingivalis genomes ranging from single nucleotide tracts to mini- and microsatellites [13, 46]. Several 41, 23 and 22 nucleotide tandem direct repeats were described in P. gingivalis strain W83, yet the exact locations of such repeats were not identified, nor were comparative genomics an option at the time of the report [13]. Some of the 23 nt tandem direct repeats noted are presumably the direct repeat portions of BrickBuilt.

Within P. gingivalis there are 11 recognized IS elements and 2 different composite transposon (Ctn) elements [13, 47, 48]. Ten of the terminal inverted repeats for the 13 IS and Ctn have been previously characterized. The TIRs of BrickBuilt were identified by first determining where non-repetitive DNA sequences immediately flanked repetitive ones (i.e. leader and tail segments). Next, all sequences were compared in multiple alignments, and only versions that maintained intact leaders or tails were then used for determination of consensus sequences (Fig. 4). The TIRs of BrickBuilt and MITEPgRS elements are almost identical, as are the TIRs of MITE293 and MITE700 elements. The MITE-like elements in P. gingivalis share either identical or within one nucleotide TIRs with those of full-length IS elements within the P. gingivalis genomes; ISPg1, ISPg3, ISPg4 and ISPg9 (Table 2). The matching full-length ISPg elements are all categorized within the IS5 family. BrickBuilt’s TIRs are most similar to those of ISPg1 and ISPg9 (which share identical TIRs); ISPg4 is the next closest match with 2 nucleotides different (Table 2). MITE293 and MITE700 TIRs match with ISPg3. Although the TIRs are similar, no remnant of a transposase from any P. gingivalis IS or Tn element remains within any of the BrickBuilt copies.

Fig. 4.

Fig. 4

Consensus Terminal Inverted Repeats (TIRs) of BrickBuilt elements visualized with Weblogo software. Only elements that contained intact leader or tail segments, which carry the TIRs, were considered and used for consensus construction

Table 2.

Terminal Inverted Repeats (TIRs) of BrickBuilt elements from strain ATCC 33277. Terminal Inverted Repeats and family of selected IS and MITE-like elements in Porphyromonas gingivalis as well as ISNme1 from Neisseria meningitidis

Locus (33277) TIR 5′ (nt) TIR 3′ (nt) Both TIRs
 BrickBuilt_1 CCGAAAGGTCTC
 BrickBuilt_2 CCGAAAGGTCTC
 BrickBuilt_3 AAGACCTTTGCA CCGAAAGGTCTC YES
 BrickBuilt_4 GAGACCTTTGCA TGCAAAGGTCTC YES
 BrickBuilt_5 GAGACCTTTGCA CGCAAAGGTCTC YES
 BrickBuilt_6 CACAAAGGTCTT
 BrickBuilt_7
 BrickBuilt_8 TGCAAAAGTCTC
 BrickBuilt_9
 BrickBuilt_10
 BrickBuilt_11
 BrickBuilt_12 GACAAAGGTCTC
 BrickBuilt_13
 BrickBuilt_14
 BrickBuilt_15 GAGCCCTTTGCA
 BrickBuilt_16
 BrickBuilt_17 GAGCCCTTCGCA
 BrickBuilt_18 GAGCCCTTTGCA TGCAAAGGCCTC YES
 BrickBuilt_19 GAGCCCTTTGCA
Element Left TIR Right TIR Family
 ISPg1 GAGACCATTGCA TTCAAAGGTCTC IS5
 ISPg3 ACGTCAGTTCGA TCGAACTGACGT IS5
 ISPg4 GAGACTGTTGCA CGCAACAGTCTC IS5
 ISPg9 GAGACCATTGCA IS5
 MITE239 ACGTGAGTTCGATATAAAGGAA TTCGCTTAAATCGAACTGGCGT
 MITEPgRS/MITE464 GAGACTGTTGCA TGCAACGGTCTC
 MITE700 ACGTCATTCGA TCGAACTCACGT
 BrickBuilt GAGACCTTCGCA TGAAAGGTCTC
 Nsm ISNme1 GAGACCTTTGCAAAA TTTTGCAAAGGTCTC IS5

Blank spaces for TIRs indicate situations in which the region is degenerate or not present

Only 4 of the 19 BrickBuilt copies contain both an intact leader and tail associated TIR (Table 2). In order to determine whether BrickBuilt makes target site duplications (TSD), the DNA sequence immediately adjacent to the proposed TIRs were examined of these 4 copies. Three of the four copies of BrickBuilt do carry TSDs, however, they are not the same length or sequence for each element. BrickBuilt_3 has a ‘CT’ dinucleotide flanking its TIRs; BrickBuilt_4 has a ‘GAAA’ tetranucleotide flanking its TIRs; BrickBuilt_5 has an ‘AAAAA’ heptanucelotide; and BrickBuilt_18 does not contain a putative TSD because one of its two TIRs is shared by a MITE293 element. These duplications on either side of the elements may not reflect canonical TSDs, however, if these elements are mobilized by multiple transposases that each make different restrictions to the target DNA this could potentially occur. Within P. gingvialis, ISPg elements generate TSDs varying from 2–9 bp; some can lack TSDs completely and may frequently nest into other mobile elements and thus eliminate TSD identification. Additional TSD data related to element mobility will be presented below.

After determining the IS5 family-like TIRs of BrickBuilt other IS5 elements were scanned for potential similarity. Identical TIRs to that of BrickBuilt were found in the Neisseria meningitidis ISNmeI and its derivatives (Table 2). ISNmeI is the proposed (based on TIRs) parent element for the type II MITE ATR (AT-rich Repeat) in Neisseria meningitidis genomes [39]. ATR elements are found 19 times within N. meningitidis genomes, which is similar to that of BrickBuilt’s distribution. Additionally, ATR elements are frequently associated with direct repeat elements of N. meningitidis known as REP2.

From initial characterizations of the configuration and locations of BrickBuilt elements, they can be classified within the large group of non-autonomous transposable elements, potentially best fitting within the MITE subcategory. A caveat must be placed, however, given that MITE elements are typically described as being comprised of two homologous flanking regions, and we have determined that BrickBuilt elements contain distinct ‘leader’ and ‘tail’ segments. Since all accessible genome sequences of P. gingivalis strains contain BrickBuilt elements, the parent element or first version of BrickBuilt probably occurred early within the phylogeny of the P. gingivalis species. Insertion of the 23 nt repeat(s) into the original parent element may be the event that catalyzed the inactivation of an autonomous transposable element. Alternatively, a version of BrickBuilt already containing the 23 nt repeats could have been laterally-transferred via plasmid or horizontally-transferred via phage. Given that no full-length (TIR-containing) leader or tail regions are present without a 23 nt repeat it may be deleterious to maintain a full leader or tail region on the chromosome, or the 23 nt repeat is required by the autonomous element.

The limited host range nature of BrickBuilt identified through NCBI BLAST is intriguing yet not uncommon for non-autonomous transposable elements [49–52]. Once a non-autonomous element occurs within a genome, potentially by deletions of an autonomous transposable element, as well as via conjugation-based horizontal transfer of a plasmid or transduction via a bacteriophage, movement between species will become less likely. Additionally, few bacterial species have multiple genome assemblies available for intraspecies comparisons, which could lead to missed elements due to strain variation. Furthermore, it is possible that repetitive sequences could be mis-sequenced or left out of genome assemblies due to repeat region sequencing difficulties or unassigned bases.

Predicted secondary structure of BrickBuilt

The direct repeats within BrickBuilt are predicted to form long stem loop structures (Figs. 5 and 6). Three DNA/RNA structure prediction programs, Mfold, RNAstructure and RegRNA2.0, independently predicted long stem loops to form from/within the element [53–55]. The length of the version of BrickBuilt affects the size of the predicted stem loop structure and the associated entropy. BrickBuilt_1, BrickBuilt_9 and BrickBuilt_14 are not predicted to form long stem loops by the RegRNA2.0 program due to the length of the internal 23 nt repeats, however, shorter stem loops due to dyad symmetry may occur. BrickBuilt elements are predicted to be surrounded/flanked by Rho-independent terminators and/or polyadenyltaion sites in 10 of 19 instances. No portion of BrickBuilt matched to any structures in Rfam [56].

Fig. 5.

Fig. 5

RegRNA2.0 analysis output of P. gingivalis strain ATCC 33277 BrickBuilt_5 and surrounding CDS-to-CDS area. The immediate 5′ CDS is PGN_0361 and the immediate 3′ CDS is PGN_0364 (argS). Options of open reading frames, Rho-independent terminators, transcriptional regulatory motifs, riboswitches, cis-regulatory elements, ERPINs, Rfam database matches, long stems and functional RNA sequences were queried. The Rho-independent terminate identified occurs prior to the BrickBuilt element

Fig. 6.

Fig. 6

Mfold analysis output of BrickBuilt_5 for P. gingivalis strain ATCC 33277 (top) and W83 (bottom). Calculated entropy for the ATCC 33277 structure is ΔG = −128.02 and for W83 is ΔG = −101.06. Input for strain ATCC 33277 was 991 nt and 807 nt for strain W83. The 184 nt length difference is due to 23 nt repeat numbers. The 23 nt repeats comprise the long stem loops

Predicted structures of BrickBuilt vary slightly between strains at a given conserved locus. The BrickBuilt_5 Mfold entropy predictions for strains ATCC 33277 and W83 are −127.96 and −102.50, respectively (Fig. 6). BrickBuilt_5 in ATCC 33277 is 991 nucleotides long and the analogous W83 version is 807 nucleotides. In this case the length difference is due to W83 BrickBuilt_5 having fewer 23 nt internal direct repeats; the leader and tails are of the same length. Within a multiple alignment of the four P. gingivalis strains at the BrickBuilt_5 locus there are 18 single nucleotide polymorphisms (SNPs) that separate the lineages (Fig. 6). Substituting SNPs between strains at the BrickBuilt_5 locus into the ATCC 33277 model changes the predicted entropy of the element by −7.25, or 5.7 %, to −135.17.

Although no BLASTn matches for BrickBuilt were found outside of the P. gingivalis species, MITEs from other species have been shown or are predicted to be of similar modular makeup and form long stem loops [23, 35, 38, 57–59]. In addition, repetitive sequences that are not MITE-associated also frequently form stem loop structures [58, 60–62]. Stem loop structures, especially long stem loops, are capable of modulating transcript half-life, modulating translational efficiency as well as serving as docking/receptor sites for proteins [12, 58, 61]. The Rho-independent terminator upstream of BrickBuilt_5 is located 111–148 nt from the 5′ CDS, with the leader region of BrickBuilt_5 located 182 nt from the 5′ CDS (Fig. 6). Thus, in this case, the BrickBuilt element has not disrupted the ‘natural’ terminator for the 5′ CDS. However, given the proximity to the Rho-independent terminator, this BrickBuilt element may be able to modulate the stability or accessibility of the terminator. The long stem loop structures of BrickBuilt_5 start 257 nt from the Rho-independent terminator and end 965 nt away.

Genome locations and surroundings

All BrickBuilt elements are located intergenically; no direct overlap or interruptions of genuine protein coding sequences are apparent in the complete genomes available to date (Table 1 and Additional file 2: Table S1). Several ‘hypothetical proteins’ are annotated to be within BrickBuilt elements, however expression of these proteins has not been confirmed experimentally [40–42]. Several of the predicted hypothetical proteins are part of repeated/overlapping probes on P. gingivalis microarrays. Additionally, the 23 nt repeats within BrickBuilt elements are predicted to cause frequent translational stops (data not shown). Lack of experimental confirmation of protein products, nonunique microarray probes and abundant translational stops suggests that translation of these regions is unlikely, and even if translation were to occur it would probably be truncated versions of a repetitive or mobile element.

Of the 38 genes surrounding the BrickBuilt elements in the ATCC 33277 genome there are several functional clusters (Table 1). Six genes encode proteases of the C1, (2) C10, (2) M16 and S41 families. Five genes are predicted to encode DNA/RNA-binding proteins, and another four are involved in tRNA metabolism. Noticeably, of the 19 BrickBuilt elements in strain ATCC 33277, 5 are located adjacent to a gene/protein containing a Por Secretion System C-Terminal Domain (PorSS CTD) [63] (Table 1). Likewise, 5 of the previously identified P. gingivalis MITEs within the W83 genome are also located next to PorSS CTDs. A total of 34 PorSS CTDs have been predicted within the W83 genome (only 22 annotated on NCBI with TIGR); 29 % of PorSS CTDs are associated with MITEs [64]. The PorSS is connected to pigmentation and haem acquisition in P. gingivalis. Apart from those associated with PorSS, other genes surrounding BrickBuilt elements are hemG, dps, trx, and hmuY, which are involved in haem biosynthesis, acquisition and detoxification, respectively. Additionally, two separate DUF 805 motifs are found in genes surrounding BrickBuilt elements, which are associated with phage integrases. The locations relative to CDS raise the possibility that BrickBuilt could be acting as or similar to a Putative Mobile Promoter (PMP); a secondary regulatory circuit or mechanism to canonical transcription and translation modulation [65].

Expansion and contraction of the 23 nt repeats between strains is evident at the conserved BrickBuilt loci. Entire 23 nt repeat segments have been removed or added. Full and/or partial deletions of the leader and tail regions are also apparent. Deletions of the leader and tail regions occur from the distal ends of each segment with respect to the 23 nt internal repeats.

Pairwise and multiple alignments of a respective BrickBuilt locus across the four strains of P. gingivalis revealed SNPs that potentially suggest lineages or selected and compensatory mutations (Fig. 3). Whether the SNPs are generated de novo at each site, occur in stages and are distributed, or occur through site-to-site recombination cannot be determined definitively from currently published genome assemblies alone. However, multiple alignments of the conserved BrickBuilt loci within a given strain show patterns of non-random mutation. For sites at which SNPs have occurred, the SNP is frequently distributed at several positions within the element, yet this occurs at intervals. Additionally, SNPs appear localized around a 2–4 nt site when compared in multiple alignments. Long Term Evolution Experiments (LTEE) and plasmid-based recombination systems could be employed to determine mutation rates within BrickBuilt in comparison to the rest of the genome, whether 23 nt repeats expand and contract at a given locus, and how recombinogenic the elements are.

BrickBuilt_4 may best demonstrate the lingering ‘mobility’ of BrickBuilt elements within P. gingivalis. Strain HG66 shares the same locus with strain ATCC 33277. However, the TDC60 BrickBuilt_4 is not located between the same two genes (Fig. 7). No other mis-located BrickBuilt elements occur in strain TDC60 and the sequence of this element aligns closely with the ATCC 33277 and HG66 versions at this locus. Thus, it is probable that the BrickBuilt_4 homologue has been induced to transpose by or transposed with the surrounding ISPg1 elements. Additionally, no BrickBuilt_4 homologue is present in strain W83, adding to a mobility pattern of BrickBuilt_4 (Fig. 7). Importantly, BrickBuilt_4 is the only of these elements that has maintained perfect 12 bp TIR matches, increasing the likelihood that a surrogate transposase could act on the element. Further evidence of TSDs can be gleaned from this specific element by comparing the ‘filled’ and ‘empty’ sites between the strains. Strains ATCC 3377 and HG66, which contain the element at this locus, have a ‘GAAA’ tetranucleotide on each side of the intact TIRs. However, strains TDC60 and W83, which lack the element at this locus, only have a single ‘GAAA’ tetranucelotide copy.

Fig. 7.

Fig. 7

MAFFT-based alignments of aberrant BrickBuilt elements and areas across P. gingivalis strains. The top panel depicts the CDS-to-CDS region of BrickBuilt_4, using the surrounding CDS that would correctly correspond to the ATCC 33277 genome. Strain W83 has no BrickBuilt_4 and strain TDC60 has a BrickBuilt_4 that has moved or been moved to a different locus. The middle panel depicts BrickBuilt_18, in which strains ATCC 33277 and HG66 have a 236-type MITE within the BrickBuilt element. The bottom panel depicts the CDS-to-CDs region BrickBuilt_11 from strain ATCC 33277, in which strain W83 has acquired a gene immediately upstream of the BrickBuilt element. Light grey boxing indicates completely identical sequence regions. Black lines or boxing indicates areas of aberrance (e.g. SNPs or additional IS-like element)

With respect to P. gulae strains, BrickBuilt_5 demonstrates the possibility or history of mobility. At this site, 4 of the 11 P. gulae strains contain (and 7 lack) BrickBuilt copies. In the strains that contain an element a ‘AAAA’ TSD can be seen (‘AAAAA’ in P. gingivalis at that site). The P. gulae strains lacking an element at that site only have one ‘AAAA’ tetranucelotide. This site is completely conserved in the published P. gingivalis strains.

BrickBuilt_18 in the strains ATCC 33277 and HG66 contain/encompass MITE239_11 between nucleotides 659–904 of the sequence. Strain TDC60 has a gap where MITE239_11 occurs in the other two strains, while the flanking portions of the BrickBuilt match (Fig. 7). The strain W83 version at this site is diminutive, having been reduced to 1.5 copies of the 23 nt internal repeat. While strain W83 doesn’t harbor a MITE-within-a-MITE configuration at any locus, BrickBuilt_11 in strain W83 contains an ‘extra’ gene adjacent to the 5′ region of the element unlike any other strain (Fig. 7).

Transcriptional expression of BrickBuilt

Repetitive and transposable elements are capable of modulating the genome stability and evolution of species [17, 19, 58, 66]. Interestingly, no endogenous plasmids have been found for P. gingivalis to date. The presence of many copies and types of repetitive and transposable elements could serve a quick way by which P. gingivalis could recombine/adapt to external stimuli beyond traditional host-directed transcriptional and translational controls [17, 18, 67–69].

Analysis of previously published data

Previous microarray and RNAseq studies have shown transcripts originating from within BrickBuilt elements, yet none characterized these regions in detail [9, 70]. Several of the microarray probes are themselves repetitive and many of the oligos/~20 mers used for identifying transcripts could map to multiple sites within the genome. Although BrickBuilt elements are highly conserved and repetitive, small variations due to SNPs, size of leader and tail regions, and the surrounding intergenic context make it possible to map at least some transcripts to the correct sites (Fig. 8 and Additional file 5: Figure S4). For situations where completely identical regions could produce the same transcript, the mapping programs and settings used will determine whether the transcripts are placed at one of the matching loci exclusively, distributed amongst the loci evenly, or left out of the results entirely. Importantly, the placement of any transcript at one or distributed across all of a given repetitive oligo/~20 mer sites suggests that at least one of the sites contributes active transcription.

Fig. 8.

Fig. 8

RNAseq display of transcripts of/from BrickBuilt_5 and surrounding area in strain W83 using JBrowse. Only uniquely mappable transcripts are displayed. Red horizontal lines correspond to forward strand-based transcripts from blood agar, tryptic soy and minimal media, respectively. Blue horizontal lines correspond to reverse strand-based transcripts from blood agar, tryptic soy and minimal media, respectively. (Full screen PDFs or screenshots are not currently possible with JBrowse, thus three different panels had to be compiled for the image. Direct link to data: http://bioinformatics.forsyth.org/jbrowse/index.html?data=PgRNAseq%2Fjson&loc=NC_002950%3A297655..299836&tracks=24Mer_Repeat%2Cncbigff%2Cbaphk_fw_bam%2Ctsb_fw_bam%2Cmin_fw_bam%2Cbaphk_rc_bam%2Ctsb_rc_bam%2Cmin_rc_bam&highlight=

Within the transcriptome transcript levels of individual BrickBuilt elements vary markedly and also vary according to growth medium, e.g. in/on minimal, tryptic soy, and blood media [9, 70]. Generally, transcripts from BrickBuilt regions are lowest on the blood-containing media. Transcript levels and distribution of transcripts of BrickBuilt elements, using strain W83 RNAseq data, can be grouped generally into three categories. Group one, displaying relatively high transcript levels throughout the element on only one strand bridging the entire CDS-to-CDS gap, includes BrickBuilt_1, 3, and 13. BrickBuilt_13, comprised only of the internal 23 nt repeats. The element’s expression correlates directly with that of the upstream gene, thus, the expression of BrickBuilt_13 could be completely due to transcriptional read-through from adjacent genes. Consistent with this, BrickBuilt_13-associated transcripts are all on the negative strand. Group two, displaying low to medium intermittent transcript in tryptic soy and minimal media but none on blood agar, includes BrickBuilt_2, 5, 6, 8, 10, 11, 12, 14, 15, 16, 17, and 19. Group three, displaying no transcript yet adjacent to upstream transcript that is well beyond an annotated CDS, includes only BrickBuilt_9.

Additional information about BrickBuilt elements and their surrounding regions can be garnered from the above microarrays and RNAseq studies as well as additional studies that have been carried out with P. gingivalis under defined conditions. High-density tiling microarray of P. gingivalis strain W83 by Chen et al. showed differential expression of BrickBuilt elements at several loci [9]. Using a W83 strain based microarray, genes PG0626 and PG0089 were found to be aberrant in strain ATCC 33277, corresponding to BrickBuilt_ 11 and BrickBuilt_ 19 loci. The area in and around BrickBuilt_10 was identified as a potential sRNA (sRNA35) by Philips et al. [71]. The highest expression of the putative sRNA35 occurred during mid-log cultures grown under hemin excess conditions after an initial period of hemin starvation. Under the experimental methods used by Philips et al., no other BrickBuilt loci were determined to be or be part of putative sRNAs expressed in response to hemin-variable growth conditions. BrickBuilt elements are not directly affected by FimR or LuxS regulation [72, 73]. However, genes surrounding BrickBuilt elements are regulated by LuxS. Lack of expression as well as partial expression of annotated genes surrounding BrickBuilt elements is evident from P. gingivalis strain W83 transcriptomic analyses by Hovik et al. [70]. Five of the conserved 30 genes flanking BrickBuilt elements in the W83 genome are predicted to not be expressed and 11 (including 3 of the 5 ‘not expressed’) give partial or abortive transcripts in blood, tryptic soy or minimal media.

The genomic association with haem biosynthesis and pigmentation-associated genes in conjunction with transcriptional data from RNAseq and microarray studies may point to regulation of BrickBuilt regions by haem or iron. DNA tandem repeats have been shown previously to affect transcription of iron and haem-associated genes [18, 74].

E. coli expression vectors

Promoter probe vectors pCB182 and pCB192 were used to determine the potential for transcription and transcriptional regulation of the full BrickBuilt element and segments. Four potential promoter sites were hypothesized based on previous RNAseq and microarray data (Fig. 9). Four configurations of the leader, tail and element were constructed using BrickBuilt_5 as a template: full element in leader-to-tail orientation (‘normal’, with tail abutting lacZ); full element in tail-to-leader orientation (‘reverse’, with flipped leader abutting lacZ); tail-only in reverse orientation; and leader-only in forward orientation. The reverse orientation of the full element, with the beginning of the leader abutting the promoter-less lacZ, displayed the greatest promoter activity of the four constructs (Fig. 10). All four constructs displayed statistically significant expression under heterologous expression in E. coli. No expression from the vectors lacking inserts was seen on plates with X-gal, while each insert-containing construct showed blue colonies due to expression by 24 h (Additional file 6: Figure S5). Expression from these constructs demonstrates bi-directional promoter ability (when tested in an E. coli system) within the tail segment as well as in the leader segment facing out of the element.

Fig. 9.

Fig. 9

Model of promoter capabilities of BrickBuilt_5 based on lacZ promoter probe ability. Bi-directional promoters are present in both the leader and tail segments of BrickBuilt_5. As such, at this locus antisense transcripts may be produced toward PGN_0361, sense transcripts produced toward arginyl-tRNA synthetase (argS), and transcripts of the 23 nucleotide repeat regions within the element may be produced from both strands. The distance from the tail to argS is less than 100 nt and may be or contain the promoter for argS

Fig. 10.

Fig. 10

ONPG assays for promoter capabilities of BrickBuilt_5 based on lacZ promoter probe constructs. Promoter-less lacZ backbone vectors pCB182 and pCB192 give low apparent β –Galactosidase activity. β –Galactosidase activity measured through ONPG cleavage after 3 h incubation at 28 °C. Error bars represent standard deviation between biological replicates in triplicate. Statistical significance determined by t-test (p < 0.05)

Conclusions

We identified and provided preliminary characterization of a genetic element, ‘BrickBuilt’, in the genome of Porphyromonas gingivalis. BrickBuilt appears to be a MITE-like element that has trapped a 23 nt direct repeat; propagating itself and the direct repeat throughout the genome. From promoter-less lacZ assays and analyses of previous microarray and RNAseq data we determined certain BrickBuilt elements contain promoter elements capable of bi-directional transcription. Given the element’s exclusively intergenic locations and surrounding gene directionality, these transcripts may serve to regulate expression of surrounding genes. Relative stability of locations, overall copy number and expression levels of the elements throughout the sequenced P. gingivalis genomes point to neutral or advantageous maintenance of BrickBuilt.

Further sequencing projects and phylogenomics will be necessary to determine which other species and strains contain the BrickBuilt element and at what evolutionary point these species and/or strains diverged. Additionally, strain-specific experimental evolution and plasmid-based recombination systems could be employed to determine mutation rates within BrickBuilt in comparison to the rest of the genome, whether and how 23 nt repeats expand and contract at a given locus, and how recombinogenic the elements are.

With respect to ‘mobility’ of a whole or partial BrickBuilt element, several experimental setups could be considered. First, inducing expression of endogenous transposases in order to mobilize BrickBuilt elements. One would need to initially determine under what conditions each transposase type in P. gingivalis is expressed, then induce expression and either PCR or sequence target BrickBuilt locations. Additionally, whole genome sequence could be employed to find the locations of element movement or duplication. Second, exogenous transposases could be expressed in P. gingivalis. Given the specificity of some transposases, a panel may need to be tested. Third, BrickBuilt elements could be introduced on plasmids into other bacterial species, specifically other Bacteroidetes, in order to try to obtain insertion into the heterologous host.

Adding BrickBuilt to the list of transposable and repetitive elements types in P. gingivalis brings the current total to 4 MITEs (or MITE-like elements), 11 ISs, 2 Ctn and 1 Tn. The ORFs and total base pairs encompassed by these elements constitute an impressive proportion of the genome. When compiled, the total percent of the P. gingivalis genome encoded by MITEs is 1 %; 0.44 % from BrickBuilt elements, 0.39 % from MITEPgRS elements, and the remaining 0.17 % from MITE700 and MITE239 family elements.

The ability of several of these elements being involved in genome evolution has been established [47, 48]. However, the full effects of these elements on genome stability and evolution as well as transcriptional, translational and post-translational response to stimuli remains to be experimentally determined.

Methods

Genomes/Strains

Genome sequence FASTA and GenBank files were downloaded from the NCBI database. At the time of this research, strains ATCC 33277, TDC60, W83, HG66 and JCVI SC001 were available as completed sequencing and assembly projects (ATCC 33277, TDC60 and W83 as ‘gapless chromosome’ status, HG66 as a single contig, and JCVI SC001 as a draft of many stitched contigs) [10, 13–16]. The five sequenced wild-type strains are disparate based on origin or lineage: W83 isolated in Germany (1950’s) from an oral lesion; ATCC 33277 was isolated in the USA (1980’s) from subgingival plaque; TDC60 was isolated in Japan (2011) from an oral lesion; HG66 isolated in the USA (1989) from a dental school patient; and JCVI SC001 was isolated in the USA (2013) from a hospital sink. The sequencing projects utilized different sequencing and assembly methods; each providing a de novo assembly. The JCVI SC001 genome sequence contained unidentified bases and residual gaps in the sequencing after the completed project.

Sequence analysis, clustering, alignment, phylogeneics/phylogenomics

NCBI BLAST suites were utilized to determine locations, structure and potential protein-coding capacity of the MITEs [43]. Query inputs were FASTA sequences taken directly from NCBI genome sequencing projects. For initial characterizations prior to determining species-specificity of the elements, the entire NCBI sequence database was queried. Following determination that the elements were only found (as of 11/2013) in the genomes of P. gingivalis strains, subsequence queries were focused to either the P. gingivalis species as a whole or specific P. gingivalis strains. Megablast, discontiguous megablast and BLASTn program selections for search optimization were all used in determining species-specificity as well as genome localizations.

MultAlin, Clustal Omega and the MEME suite were used to perform DNA-based and amino acid-based multiple alignments of the MITEs to determine conserved nucleotides and the start and stop points of the elements as well as proteins surrounding the MITEs. Amino acid-based alignments were used to determine whether the surrounding genes had structural domains at either the 5′ or 3′ ends that could potentially account for or facilitate MITE localization [75–77].

The BioCyc sequence pattern search tool ‘PatMatch’ was used to determine the number and genomic location of P. gingivalis MITEs in strain ATCC 33277 [78]. PatMatch indentifies potential sites given variations in the consensus sequences of the MITE direct repeats, TIRs, ‘leader’ and ‘tail’ regions because different mismatch numbers are allowed. Query inputs were nucleotide consensus sequences determined for each of the given parts of the MITE. Both DNA strands, as well as intergenic and coding sequences, were queried separately. Mismatches of ‘0’ through ‘3’ were allowed, with the constraint of the ‘mismatch type’ being a substitution.

The Tandem Repeats Database software was used for determining all types of tandem repeat elements in the P. gingivalis genomes (strains ATCC 33277 and W83 hosted on the server as of 12/2013), and to determine whether the tandem repeats or MITE as a whole was conserved in other sequenced species [79]. BLAST query of the entire bacterial and viral tandem repeat database was carried out using the FASTA sequence downloaded from NCBI for P. gingivalis strain ATCC 33277 MITE. The Tandem Repeats Finder software was used to determine the composition of the P. gingivalis tandem repeat element [80]. ‘Basic’ sequence analysis was selected for queries. Tandem Repeats Finder was also used to determine repeat conservation within and between loci as well as where a given element started and ended.

The Geneious software platform (version R8) was used to download, store, deposit, manipulate and query P. gingivalis genomes and BrickBuilt MITEs [81].

MITE and surrounding coding Sequences’ nucleic acid and protein motif analysis

The Pfam and InterProScan databases and programs software were used to determine the presence and characteristics of nucleic acid and protein motifs [82, 83]. Query inputs were FASTA sequences from NCBI download files. For Pfam, an E-value of 1.0 and checking Pfam-B motifs were selected options prior to submission.

ExPASy Translate Tool software was used to determine whether the MITEs potentially encoded proteins, and thus are not strictly nucleic acid elements [84]. Genetic code option ‘standard’ was used for all queries. All six possible frames of translation were considered.

Modeling and structure prediction programs Mfold, RNAstructure and RegRNA2.0 were used to predict potential 2-D structures formed by MITE DNA and RNA [53–55]. Default options for programs in regard to structure prediction were chosen.

Cloning and reporter strains, media and growth conditions

Escherichia coli DH5α and TOP10 were used for cloning, plasmid maintenance and transcriptional assays. Ampicillin (100 μg/ml) was used when appropriate for prevention of contamination as well as isolation and maintenance of transformants containing plasmids. Strains were grown and maintained on LB [Lennox] agar or in LB [Lennox] broth (Invitrogen).

PCR primers containing BamHI and XmaI (NEB) restriction sites were designed immediately flanking the BrickBuilt_5 MITE associated with PGN_0361 (Additional file 2: Table S2). PCR products were generated using GoTaqLong Master Mix (Promega) and resultant bands were cloned into vector pCR TOPO-XL (Invitrogen), which was transformed into E. coli DH5α. Transformants were selected for kanamycin resistance and clones were confirmed by restriction digest and sequencing.

To generate constructs using the promoter probe vectors pCB182 and pCB192, pCR2.1 and pCR-TOPO-XL cloned BrickBuilt MITE constructs and pCB182/pCB192 were double-digested with BamHI (NEB) and XbaI (NEB) or BamHI and XmaI (NEB) and then transformed into E. coli TOP10. Transformants were selected for ampicillin resistance generated by an insertion event. Clones were confirmed by restriction digest and sequencing.

Transcriptional analyses

BROP, specifically the ‘Genomics Tools for Oral Pathogens’ and ‘Microbial Transcriptome Database’ sections of the resource, were used to determine genome location, characteristics of coding sequencings surrounding MITEs, differences between strains as well as transcriptome data [85]. Over the course of the research, two different variations of the RNAseq data for P. gingivalis strain W83 were supported, one directly on BROP and then a later form on JBrowse. The JBrowse form gives greater functionality in displaying data and visualization [86]. Under the ‘Genomics Tools for Oral Pathogens’ subset, the ‘GenomeViewer’ function was used to compare genome arrangements of P. gingivalis strains ATCC 33277 and W83 with relation to MITEs, as well as display the previously performed microarray data (under the strain W83 section) for MITE-associated genome areas under the three different nutrient conditions (the same conditions performed in the RNAseq) [9, 70].

β –galactosidase assays

Escherichia coli strains were grown and maintained in Luria-Bertani (LB) media supplemented with ampicillin (100 μg/l) as required. PCR primers and synthesized oligos used for strain constructions are listed in Additional file 2: Table S2. The pCB182 and pCB192 vectors lack promoters but contain translational start codons [87]. As such, gene expression of lacZ, and in turn protein expression of LacZ read out through β –galactosidase activity, should be the result of promoter activity from fragments cloned into the vector. β -galactosidase assays were performed under plate-based (X-Gal) and broth-based (ONPG) setups. For plate-based assays, frozen stock cultures of the BrickBuilt MITE derivatives transcriptionally fused to lacZ in their respective E. coli strains were plated onto LB agar containing X-gal and ampicillin. For broth-based assays, cultures of the BrickBuilt MITE derivatives transcriptionally fused to lacZ in their respective E. coli strains were grown in LB broth for 3 h with shaking at 37 °C. An aliquot of each culture (500 μl) was added to a lysis and assay solution mixture (500 μl), vortexed, and then incubated at 28 °C for 3 h. Color development was measured spectrophotometrically at OD420 nm and cell debris at OD550 nm. Respective Miller units were calculated as previously described [88].

All data, genome sequences as well as RNAseq and microarray, are currently available in public repositories and publications related to these data have been referenced. Locations of the MITE sequences in P. gingivalis and P. gulae strains will be deposited to NCBI such that identifiers and notes can be amended to the graphic outputs of sequence files.

Acknowledgements

Drs. Andrea Pauli and Eivind Valen working in the laboratory of Dr. Alexander Schier at Harvard University for their help and knowledge in non-coding RNA biology and RNA regulation. Dr. Michael Malamy at Tufts University for his expertise in mobile genetic elements and plasmid biology. Dr. Carla Cugini at Rutgers School of Dental Medicine for her expertise P. gingivalis biology.

Funding

This project was supported by grants from the National Institute of Dental & Craniofacial Research, F31 DE022491 (BAK), R01 DE024308 (LTH and MJD) and R01 DE015931 (MJD). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Dental & Craniofacial Research or the National Institutes of Health.

Abbreviations

MITE

Miniature Inverted-repeat Transposable Element

RE

Repetitive Element

TE

Transposable Element

TIR

Terminal Inverted Repeat

TSD

Target Site Duplication

PCR

Polymerase Chain Reaction

BROP

Bioinformatics Resource Oral Pathogens

MTD

Microbial Transcriptome Database

BLAST

Basic Local Alignment Search Tool

OD

Optical Density

X-gal

5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside

ONPG

O-Nitrophenyl-β-D-galactopyranoside

Additional files

Additional file 1: Figure S1. (92.2KB, pdf)

Tandem Repeat Finder analysis of P. gingivalis strain ATCC 33277 BrickBuilt_5. Overall statistics of the repeats/repeat region found within BrickBuilt_5; 23 nt repeat indicies of the element relative to the entire element, period size, copy number, consensus size, percent matches, percent InDels, alignment score, percent composition for each nucleotide and entropy measure based on percent composition. The individual locations of mismatches and InDels within BrickBuilt_5 are shown as positions marked by stars (*). (PDF 92 kb)

Additional file 2: Table S1. (66.8KB, xlsx)

Loci and nucleotide sites of BrickBuilt elements across four sequenced and annotated P. gingivalis strains. BrickBuilt elements are situated intergenically between the genes noted. Grayed-out boxes represent loci at which BrickBuilt is aberrant. Table S2. Primers for sequencing and cloning. Sequence of oligos ordered for cloning directly into promoter-probe vectors. (XLSX 66 kb)

Additional file 3: Figure S2. (19.4KB, png)

P. gingivalis strain SJD2 assembly showing an ‘assembly gap’ at the site of BrickBuilt elements from strains ATCC 33277, W83, TDC60 and HG66. The same genes flanking the assembly gap are found flanking BrickBuilt_11 in strains ATCC 33277, W83, TDC60 and HG66. The top dark green track depicts individual contigs (a total of 140 for this strain), the second dark green track depicts individual scaffolds (a total of 117 for this strain), the yellow track shows predicted coding sequences, the light green track shows predicted genes, and the bottom track shows the assembly gap as a rightward-pointing triangle. (PNG 19 kb)

Additional file 4: Figure S3. (108.9KB, pdf)

BrickBuilt_5 region MAFFT alignment and PHYML tree of P. gulae and P. gingivalis strains. All COT_052 P. gulae strains were sequenced/deposited during the preparation of the manuscript. Additionally, all P. gulae strains are currently scaffold or contig assemblies; none are completed chromosomes and thus are also not available for default BLASTn query on NCBI. The aligned bases between 2,500-3,800 contain the BrickBuilt_5 MITE; flanking regions contain the same 2 upstream and downstream genes in all strains. Of the 12 nodes in the tree, 8 have a bootstrap value of greater than 85 (100 bootstrap iterations). In the ‘consensus identity’ track, green indicates sites of complete conservation, yellow of partial conservation and red of little conservation. Within each of the 15 strain tracks the black lines or blocks indicate sites that deviate from the consensus at that given site. (PDF 108 kb)

Additional file 5: Figure S4. (1.1MB, pdf)

Microarray display of transcripts in BROP MTD database of BrickBuilt_5 and surrounding area in strain W83. Tracts represent positive and negative strand blood agar (top), tryptic soy broth (middle) and minimal media (bottom), respectively. BrickBuilt_5 noted with black bracket.

Additional file 6: Figure S5. (230.9KB, png)

X-gal and ONPG assays of promoter capabilities of BrickBuilt_5 based on lacZ promoter probe constructs. Promoter-less lacZ vectors pCB182 and pCB192 give no apparent β –Galactosidase activity. BrickBuilt_5 leader and tail oligos (Eurofins Operon) were cloned into vector pCB192. Full-length BrickBuilt_5 was cloned into pCB192, ‘Normal’, with the tail segment of the element upstream of lacZ facing in the same orientation (tail abutting lacZ). Full-length BrickBuilt_5 was cloned into pCB182, ‘Reverse’, with the leader segment of the element upstream of lacZ facing in the same orientation (flipped leader abutting lacZ). X-gal activity visualized after 24 h incubation. Top of two liquid assays of ONPG activity visualized after 3 h incubation; bottom after 24 h incubation.

Footnotes

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

BAK conceived of the study, participated in its design and coordination, carried out molecular genetics, carried out bioinformatic analyses and drafted the manuscript. TC participated in study design and coordination, carried out bioinformatic analyses and drafted the manuscript. AK participated in study design and coordination and carried out molecular genetics. JCS participated in study design and coordination and carried out molecular genetics. MJD participated in study design and coordination and drafted the manuscript. LTH conceived of the study, participated in its design and coordination and drafted the manuscript. All authors read and approved the final manuscript.

Contributor Information

Brian A. Klein, Email: bklein@forsyth.org

Tsute Chen, Email: tchen@forsyth.org.

Jodie C. Scott, Email: jscott@forsyth.org

Andrea L. Koenigsberg, Email: andrea.koenigsberg@tufts.edu

Margaret J. Duncan, Email: mduncan@forsyth.org

Linden T. Hu, Phone: (617)636-7613, Email: linden.hu@tufts.edu

References

  • 1.Hajishengallis G, Liang S, Payne MA, Hashim A, Jotwani R, Eskan MA, et al. Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe. 2011;10:497–506. doi: 10.1016/j.chom.2011.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Curtis MA, Zenobia C, Darveau RP. The relationship of the oral microbiotia to periodontal health and disease. Cell Host Microbe. 2011;10:302–6. doi: 10.1016/j.chom.2011.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Maley J, Roberts IS. Characterisation of IS1126 from Porphyromonas gingivalis W83: A new member of the IS4 family of insertion sequence elements. FEMS Microbiol Lett. 1994;123:219–24. doi: 10.1111/j.1574-6968.1994.tb07225.x. [DOI] [PubMed] [Google Scholar]
  • 4.Wang C, Bond VC, Genco CA. Identification of a second endogenous Porphyromonas gingivalis insertion element. J Bacteriol. 1997;179:3808–12. doi: 10.1128/jb.179.11.3808-3812.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lewis JP, Macrina FL. IS195, an insertion sequence-like element associated with protease genes in Porphyromonas gingivalis. Infect Immun. 1998;66:3035–42. doi: 10.1128/iai.66.7.3035-3042.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sawada K, Kokeguchi S, Hongyo H, Sawada S, Miyamoto M, Maeda H, et al. Identification by subtractive hybridization of a novel insertion sequence specific for virulent strains of Porphyromonas gingivalis. Infect Immun. 1999;67:5621–5. doi: 10.1128/iai.67.11.5621-5625.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Califano JV, Kitten T, Lewis JP, Macrina FL, Fleischmann RD, Fraser CM, et al. Characterization of Porphyromonas gingivalis insertion sequence-like element ISPg5. Infect Immun. 2000;68:5247–53. doi: 10.1128/IAI.68.9.5247-5253.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Califano JV, Arimoto T, Kitten T. The genetic relatedness of Porphyromonas gingivalis clinical and laboratory strains assessed by analysis of insertion sequence (IS) element distribution. J Periodontal Res. 2003;38:411–6. doi: 10.1034/j.1600-0765.2003.00665.x. [DOI] [PubMed] [Google Scholar]
  • 9.Chen T, Hosogi Y, Nishikawa K, Abbey K, Fleischmann RD, Walling J, et al. Comparative whole-genome analysis of virulent and avirulent strains of Porphyromonas gingivalis. J Bacteriol. 2004;186:5473–9. doi: 10.1128/JB.186.16.5473-5479.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Naito M, Hirakawa H, Yamashita A, Ohara N, Shoji M, Yukitake H, et al. Determination of the genome sequence of Porphyromonas gingivalis strain ATCC 33277 and genomic comparison with strain W83 revealed extensive genome rearrangements in P. gingivalis. DNA Res. 2008;15:215–25. doi: 10.1093/dnares/dsn013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Naito M, Sato K, Shoji M, Yukitake H, Ogura Y, Hayashi T, et al. Characterization of the Porphyromonas gingivalis conjugative transposon CTnPg1: Determination of the integration site and the genes essential for conjugal transfer. Microbiology. 2011;157:2022–32. doi: 10.1099/mic.0.047803-0. [DOI] [PubMed] [Google Scholar]
  • 12.Bainbridge BW, Hirano T, Grieshaber N, Davey ME. Deletion of a 77-base-pair inverted repeat element alters the synthesis of surface polysaccharides in Porphyromonas gingivalis. J Bacteriol. 2015;197:1208–20. doi: 10.1128/JB.02589-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nelson KE, Fleischmann RD, DeBoy RT, Paulsen IT, Fouts DE, Eisen JA, et al. Complete genome sequence of the oral pathogenic bacterium Porphyromonas gingivalis strain W83. J Bacteriol. 2003;185:5591–601. doi: 10.1128/JB.185.18.5591-5601.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Watanabe T, Maruyama F, Nozawa T, Aoki A, Okano S, Shibata Y, et al. Complete genome sequence of the bacterium Porphyromonas gingivalis TDC60, which causes periodontal disease. J Bacteriol. 2011;193:4259–60. doi: 10.1128/JB.05269-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.McLean JS, Lombardo M, Ziegler MG, Novotny M, Yee-Greenbaum J, Badger JH, et al. Genome of the pathogen Porphyromonas gingivalis recovered from a biofilm in a hospital sink using a high-throughput single-cell genomics platform. Genome Res. 2013;23:867–77. doi: 10.1101/gr.150433.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Siddiqui H, Yoder-Himes DR, Mizgalska D, Nguyen KA, Potempa J, Olsen I. Genome sequence of Porphyromonas gingivalis strain HG66 (DSM 28984). Genome Announc. 2014;2:doi:10.1128/genomeA.00947-14. [DOI] [PMC free article] [PubMed]
  • 17.Treangen TJ, Abraham AL, Touchon M, Rocha EP. Genesis, effects and fates of repeats in prokaryotic genomes. FEMS Microbiol Rev. 2009;33:539–71. doi: 10.1111/j.1574-6976.2009.00169.x. [DOI] [PubMed] [Google Scholar]
  • 18.Zhou K, Aertsen A, Michiels CW. The role of variable DNA tandem repeats in bacterial adaptation. FEMS Microbiol Rev. 2014;38:119–41. doi: 10.1111/1574-6976.12036. [DOI] [PubMed] [Google Scholar]
  • 19.Padeken J, Zeller P, Gasser SM. Repeat DNA in genome organization and stability. Curr Opin Genet Dev. 2015;31:12–9. doi: 10.1016/j.gde.2015.03.009. [DOI] [PubMed] [Google Scholar]
  • 20.Siguier P, Gourbeyre E, Chandler M. Bacterial insertion sequences: Their genomic impact and diversity. FEMS Microbiol Rev. 2014;38:865–91. doi: 10.1111/1574-6976.12067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Piégu B, Bire S, Arensburger P, Bigot Y. A survey of transposable element classification systems - A call for a fundamental update to meet the challenge of their diversity and complexity. Mol Phylogenet Evol. 2015;86:90–109. doi: 10.1016/j.ympev.2015.03.009. [DOI] [PubMed] [Google Scholar]
  • 22.Gonzalez J, Petrov D. MITEs - the ultimate parasites. Science. 2009;325:1352–3. doi: 10.1126/science.1179556. [DOI] [PubMed] [Google Scholar]
  • 23.Ilyina TS. Miniature repetitive mobile elements of bacteria: Structural organization and properties. Mol Genet Microbiol Virol. 2010;25:139–47. doi: 10.3103/S0891416810040014. [DOI] [Google Scholar]
  • 24.Fattash I, Rooke R, Wong A, Hui C, Luu T, Bhardwaj P, et al. Miniature inverted-repeat transposable elements: Discovery, distribution, and activity. Genome. 2013;56:475–86. doi: 10.1139/gen-2012-0174. [DOI] [PubMed] [Google Scholar]
  • 25.Darmon E, Leach DR. Bacterial genome instability. Microbiol Mol Biol Rev. 2014;78:1–39. doi: 10.1128/MMBR.00035-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Feschotte C, Jiang N, Wessler SR. Plant transposable elements: Where genetics meets genomics. Nat Rev Genet. 2002;3:329–41. doi: 10.1038/nrg793. [DOI] [PubMed] [Google Scholar]
  • 27.Naito K, Zhang F, Tsukiyama T, Saito H, Hancock CN, Richardson AO, et al. Unexpected consequences of a sudden and massive transposon amplification on rice gene expression. Nature. 2009;461:1130–4. doi: 10.1038/nature08479. [DOI] [PubMed] [Google Scholar]
  • 28.Lu C, Chen J, Zhang Y, Hu Q, Su W, Kuang H. Miniature inverted-repeat transposable elements (MITEs) have been accumulated through amplification bursts and play important roles in gene expression and species diversity in oryza sativa. Mol Biol Evol. 2012;29:1005–17. doi: 10.1093/molbev/msr282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang X, Tan J, Bai Z, Deng X, Li Z, Zhou C, et al. Detection and characterization of miniature inverted-repeat transposable elements in “candidatus liberibacter asiaticus”. J Bacteriol. 2013;195:3979–86. doi: 10.1128/JB.00413-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bureau TE, Wessler SR. Tourist: A large family of small inverted repeat elements frequently associated with maize genes. Plant Cell. 1992;4:1283–94. doi: 10.1105/tpc.4.10.1283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bureau TE, Wessler SR. Stowaway: A new family of inverted repeat elements associated with the genes of both monocotyledonous and dicotyledonous plants. Plant Cell. 1994;6:907–16. doi: 10.1105/tpc.6.6.907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chen SL, Shapiro L. Identification of long intergenic repeat sequences associated with DNA methylation sites in Caulobacter crescentus and other alpha-proteobacteria. J Bacteriol. 2003;185:4997–5002. doi: 10.1128/JB.185.16.4997-5002.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Han Y, Korban SS. Spring: A novel family of miniature inverted-repeat transposable elements is associated with genes in apple. Genomics. 2007;90:195–200. doi: 10.1016/j.ygeno.2007.04.005. [DOI] [PubMed] [Google Scholar]
  • 34.Nelson WC, Bhaya D, Heidelberg JF. Novel miniature transposable elements in thermophilic Synechococcus strains and their impact on an environmental population. J Bacteriol. 2012;194:3636–42. doi: 10.1128/JB.00333-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Deng H, Shu D, Luo D, Gong T, Sun F, Tan H. Scatter: A novel family of miniature inverted-repeat transposable elements in the fungus Botrytis cinerea. J Basic Microbiol. 2013;53:815–22. doi: 10.1002/jobm.201200238. [DOI] [PubMed] [Google Scholar]
  • 36.Sampath P, Murukarthick J, Izzah NK, Lee J, Choi HI, Shirasawa K, et al. Genome-wide comparative analysis of 20 miniature inverted-repeat transposable element families in Brassica rapa and B. oleracea. PLoS ONE. 2014;9. [DOI] [PMC free article] [PubMed]
  • 37.Coates BS, Kroemer JA, Sumerford DV, Hellmich RL. A novel class of miniature inverted repeat transposable elements (MITEs) that contain hitchhiking (GTCY)n microsatellites. Insect Mol Biol. 2011;20:15–27. doi: 10.1111/j.1365-2583.2010.01046.x. [DOI] [PubMed] [Google Scholar]
  • 38.Satovic E, Plohl M. Tandem repeat-containing MITEs in the clam Donax trunculus. Genome Biol Evol. 2013;5:2549–59. doi: 10.1093/gbe/evt202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Parkhill J, Achtman M, James KD, Bentley SD, Churcher C, Klee SR, et al. Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature. 2000;404:502–6. doi: 10.1038/35006655. [DOI] [PubMed] [Google Scholar]
  • 40.Xia Q, Wang T, Taub F, Park Y, Capestany CA, Lamont RJ, et al. Quantitative proteomics of intracellular Porphyromonas gingivalis. Proteomics. 2007;7:4323–37. doi: 10.1002/pmic.200700543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kuboniwa M, Hendrickson EL, Xia Q, Wang T, Xie H, Hackett M, et al. Proteomics of Porphyromonas gingivalis within a model oral microbial community. BMC Microbiol. 2009;9:98,2180-9-98. doi: 10.1186/1471-2180-9-98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Maeda K, Nagata H, Ojima M, Amano A. Proteomic and transcriptional analysis of interaction between oral microbiota Porphyromonas gingivalis and Streptococcus oralis. J Proteome Res. 2015;14:82–94. doi: 10.1021/pr500848e. [DOI] [PubMed] [Google Scholar]
  • 43.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 44.Tatusova T, Ciufo S, Fedorov B, O'Neill K, Tolstoy I. RefSeq microbial genomes database: New representation and annotation strategy. Nucleic Acids Res. 2015;43:3872. doi: 10.1093/nar/gkv278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Coil DA, Alexiev A, Wallis C, O'Flynn C, Deusch O, Davis I, et al. Draft genome sequences of 26 Porphyromonas strains isolated from the canine oral microbiome. Genome Announc. 2015;3:doi:10.1128/genomeA.00187-15. [DOI] [PMC free article] [PubMed]
  • 46.Coenye T, Vandamme P. Characterization of mononucleotide repeats in sequenced prokaryotic genomes. DNA Res. 2005;12:221–33. doi: 10.1093/dnares/dsi009. [DOI] [PubMed] [Google Scholar]
  • 47.Duncan MJ. Genomics of oral bacteria. Crit Rev Oral Biol Med. 2003;14:175–87. doi: 10.1177/154411130301400303. [DOI] [PubMed] [Google Scholar]
  • 48.Tribble GD, Kerr JE, Wang B. Genetic diversity in the oral pathogen Porphyromonas gingivalis: Molecular mechanisms and biological consequences. Future Microbiol. 2013;8:607–20. doi: 10.2217/fmb.13.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hikosaka A, Kawahara A. Lineage-specific tandem repeats riding on a transposable element of MITE in Xenopus evolution: A new mechanism for creating simple sequence repeats. J Mol Evol. 2004;59:738–46. doi: 10.1007/s00239-004-2664-1. [DOI] [PubMed] [Google Scholar]
  • 50.Yang HP, Barbash DA. Abundant and species-specific DINE-1 transposable elements in 12 Drosophila genomes. Genome Biol. 2008;9:R39,2008-9-2-r39. doi: 10.1186/gb-2008-9-2-r39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Koressaar T, Remm M. Characterization of species-specific repeats in 613 prokaryotic species. DNA Res. 2012;19:219–30. doi: 10.1093/dnares/dss006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Halász J, Kodad O. Hegedus A. Plant Journal: Identification of a recently active Prunus-specific non-autonomous mutator element with considerable genome shaping force; 2014. [DOI] [PubMed] [Google Scholar]
  • 53.Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003;31:3406–15. doi: 10.1093/nar/gkg595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Bellaousov S, Reuter JS, Seetin MG, Mathews DH. RNAstructure: Web servers for RNA secondary structure prediction and analysis. Nucleic Acids Res. 2013;41:W471–4. doi: 10.1093/nar/gkt290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Chang TH, Huang HY, Hsu JB, Weng SL, Horng JT, Huang HD. An enhanced computational platform for investigating the roles of regulatory RNA and for identifying functional RNA motifs. BMC Bioinformatics. 2013;14(Suppl 2):S4,2105-14-S2-S4. doi: 10.1186/1471-2105-14-S2-S4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Nawrocki EP, Burge SW, Bateman A, Daub J, Eberhardt RY, Eddy SR, et al. Rfam 12.0: Updates to the RNA families database. Nucleic Acids Res. 2015;43:D130–7. doi: 10.1093/nar/gku1063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Zhou F, Tran T, Xu Y. Nezha, a novel active miniature inverted-repeat transposable element in Cyanobacteria. Biochem Biophys Res Commun. 2008;365:790–4. doi: 10.1016/j.bbrc.2007.11.038. [DOI] [PubMed] [Google Scholar]
  • 58.Delihas N. Impact of small repeat sequences on bacterial genome evolution. Genome Biol Evol. 2011;3:959–73. doi: 10.1093/gbe/evr077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Zhang HH, Xu HE, Shen YH, Han MJ, Zhang Z. The origin and evolution of six miniature inverted-repeat transposable elements in Bombyx mori and Rhodnius prolixus. Genome Biol Evol. 2013;5:2020–31. doi: 10.1093/gbe/evt153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.De Gregorio E, Silvestro G, Petrillo M, Carlomagno MS, Di Nocera PP. Enterobacterial repetitive intergenic consensus sequence repeats in Yersiniae: Genomic organization and functional properties. J Bacteriol. 2005;187:7945–54. doi: 10.1128/JB.187.23.7945-7954.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Petrillo M, Silvestro G, Di Nocera PP, Boccia A, Paolella G. Stem-loop structures in prokaryotic genomes. BMC Genomics. 2006;7:170. doi: 10.1186/1471-2164-7-170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Bertels F, Rainey PB. Within-genome evolution of REPINs: A new family of miniature mobile DNA in bacteria. PLoS Genet. 2011;7 doi: 10.1371/journal.pgen.1002132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Sato K. Por secretion system of Porphyromonas gingivalis. J Oral Biosci. 2011;53:187–96. doi: 10.1016/S1349-0079(11)80001-0. [DOI] [Google Scholar]
  • 64.Seers CA, Slakeski N, Veith PD, Nikolof T, Chen YY, Dashper SG, et al. The RgpB C-terminal domain has a role in attachment of RgpB to the outer membrane and belongs to a novel C-terminal-domain family found in Porphyromonas gingivalis. J Bacteriol. 2006;188:6376–86. doi: 10.1128/JB.00731-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Matus-Garcia M, Nijveen H, Van Passel MWJ. Promoter propagation in prokaryotes. Nucleic Acids Res. 2012;40:10032–10040. doi: 10.1093/nar/gks787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Bennetzen JL, Wang H, eds. The Contributions of Transposable Elements to the Structure, Function, and Evolution of Plant Genomes.; 2014; No. 65:505–30. [DOI] [PubMed]
  • 67.Slotkin RK, Martienssen R. Transposable elements and the epigenetic regulation of the genome. Nat Rev Genet. 2007;8:272–85. doi: 10.1038/nrg2072. [DOI] [PubMed] [Google Scholar]
  • 68.Feschotte C. Transposable elements and the evolution of regulatory networks. Nat Rev Genet. 2008;9:397–405. doi: 10.1038/nrg2337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Lisch D. How important are transposons for plant evolution? Nat Rev Genet. 2013;14:49–61. doi: 10.1038/nrg3374. [DOI] [PubMed] [Google Scholar]
  • 70.Høvik H, Wen-Han Y, Olsen I, Chen T. Comprehensive transcriptome analysis of the periodontopathogenic bacterium Porphyromonas gingivalis W83. J Bacteriol. 2012;194:100–14. doi: 10.1128/JB.06385-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Phillips P, Progulske-Fox A, Grieshaber S. Grieshaber N. FEMS Microbiology Letters: Expression of Porphyromonas gingivalis small RNA in response to hemin availability identified using microarray and RNA-seq analysis; 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Nishikawa K, Yoshimura F, Duncan MJ. A regulation cascade controls expression of Porphyromonas gingivalis fimbriae via the FimR response regulator. Mol Microbiol. 2004;54:546–60. doi: 10.1111/j.1365-2958.2004.04291.x. [DOI] [PubMed] [Google Scholar]
  • 73.Hirano T, Beck DA, Demuth DR, Hackett M, Lamont RJ. Deep sequencing of Porphyromonas gingivalis and comparative transcriptome analysis of a LuxS mutant. Front Cell Infect Microbiol. 2012;2:79. doi: 10.3389/fcimb.2012.00079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Chen S, Li X. Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes. BMC Evol Biol. 2007;7:46. doi: 10.1186/1471-2148-7-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16:10881–90. doi: 10.1093/nar/16.22.10881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, et al. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009;37:W202–8. doi: 10.1093/nar/gkp335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using clustal omega. Mol Syst Biol. 2011;7:539. doi: 10.1038/msb.2011.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Karp PD, Paley SM, Krummenacker M, Latendresse M, Dale JM, Lee TJ, et al. Pathway tools version 13.0: Integrated software for pathway/genome informatics and systems biology. Brief Bioinform. 2010;11:40–79. doi: 10.1093/bib/bbp043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Gelfand Y, Rodriguez A, Benson G. TRDB--the tandem repeats database. Nucleic Acids Res. 2007;35:D80–7. doi: 10.1093/nar/gkl1013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Benson G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999;27:573–80. doi: 10.1093/nar/27.2.573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. Pfam: The protein families database. Nucleic Acids Res. 2014;42:D222–30. doi: 10.1093/nar/gkt1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Jones P, Binns D, Chang HY, Fraser M, Li W, McAnulla C, et al. InterProScan 5: Genome-scale protein function classification. Bioinformatics. 2014;30:1236–40. doi: 10.1093/bioinformatics/btu031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Artimo P, Jonnalagedda M, Arnold K, Baratin D, Csardi G, de Castro E, et al. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res. 2012;40:W597–603. doi: 10.1093/nar/gks400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Chen T, Abbey K, Deng W, Cheng M. The bioinformatics resource for oral pathogens. Nucleic Acids Res. 2005;33:W734–40. doi: 10.1093/nar/gki361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Westesson O, Skinner M, Holmes I. Visualizing next-generation sequencing data with JBrowse. Brief Bioinform. 2013;14:172–7. doi: 10.1093/bib/bbr078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Schneider K, Beck CF. Promoter-probe vectors for the analysis of divergently arranged promoters. Gene. 1986;42:37–48. doi: 10.1016/0378-1119(86)90148-4. [DOI] [PubMed] [Google Scholar]
  • 88.Wang XG, Lin B, Kidder JM, Telford S, Hu LT. Effects of environmental changes on expression of the oligopeptide permease (opp) genes of Borrelia burgdorferi. J Bacteriol. 2002;184:6198–206. doi: 10.1128/JB.184.22.6198-6206.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Mobile DNA are provided here courtesy of BMC

RESOURCES