Impulsivity and Concussion in Juvenile Rats: Examining Molecular and Structural Aspects of the Frontostriatal Pathway

Harleen Hehar; Keith Yeates; Bryan Kolb; Michael J Esser; Richelle Mychasiuk

doi:10.1371/journal.pone.0139842

. 2015 Oct 8;10(10):e0139842. doi: 10.1371/journal.pone.0139842

Impulsivity and Concussion in Juvenile Rats: Examining Molecular and Structural Aspects of the Frontostriatal Pathway

Harleen Hehar ¹, Keith Yeates ², Bryan Kolb ³, Michael J Esser ¹, Richelle Mychasiuk ^1,^*

Editor: Ryan K Bachtell⁴

PMCID: PMC4598031 PMID: 26448536

Abstract

Impulsivity and poor executive control have been implicated in the pathogenesis of many developmental and neuropsychiatric disorders. Similarly, concussions/mild traumatic brain injuries (mTBI) have been associated with increased risk for neuropsychiatric disorders and the development of impulsivity and inattention. Researchers and epidemiologists have therefore considered whether or not concussions induce symptoms of attention-deficit/hyperactivity disorder (ADHD), or merely unmask impulsive tendencies that were already present. The purpose of this study was to determine if a single concussion in adolescence could induce ADHD-like impulsivity and impaired response inhibition, and subsequently determine if inherent impulsivity prior to a pediatric mTBI would exacerbate post-concussion symptomology with a specific emphasis on impulsive and inattentive behaviours. As these behaviours are believed to be associated with the frontostriatal circuit involving the nucleus accumbens (NAc) and the prefrontal cortex (PFC), the expression patterns of 8 genes (Comt, Drd2, Drd3, Drd4, Maoa, Sert, Tph1, and Tph2) from these two regions were examined. In addition, Golgi-Cox staining of medium spiny neurons in the NAc provided a neuroanatomical examination of mTBI-induced structural changes. The study found that a single early brain injury could induce impulsivity and impairments in response inhibition that were more pronounced in males. Interestingly, when animals with inherent impulsivity experienced mTBI, injury-related deficits were exacerbated in female animals. The single concussion increased dendritic branching, but reduced synaptic density in the NAc, and these changes were likely associated with the increase in impulsivity. Finally, mTBI-induced impulsivity was associated with modifications to gene expression that differed dramatically from the gene expression pattern associated with inherent impulsivity, despite very similar behavioural phenotypes. Our findings suggest the need to tailor treatment strategies for mTBI in light of an individual’s premorbid characteristics, given significant differences in molecular profiles of the frontostriatal circuits that depend upon sex and the etiology of the behavioural phenotype.

Introduction

Many developmental disorders, such as attention-deficit/hyperactivity disorder (ADHD) are believed to have multifactorial etiologies involving alterations to several neural pathways [1]. These variations in pathogenesis contribute to substantial heterogeneity in symptom presentation and diagnosis [2, 3]. In essence however, ADHD is a disorder of executive function that is characterized by a pervasive pattern of inattention, impulsivity, and hyperactivity that are developmentally inappropriate [4]. Although all symptoms are potentially debilitating, impulsivity is now recognized as having a central role in the pathogenesis of many neuropsychiatric disorders [5]. In the broadest of terms, impulsivity is characterized by poor self-control and reflected in rapid decision-making that lacks foresight and anticipation of future consequences. Two main pathways of executive function, response inhibition and reward signaling, seem to be critical for impulse control and the ability to delay gratification. Alterations to these pathways, which involve the prefrontal cortex and dorsal striatum, are hypothesized to result in dysfunctional processing of anticipated rewards and a reduction in cognitive flexibility [6]. Research has articulated complex and interdependent roles for dopamine and serotonin systems in the etiology of impulsivity. These roles have been corroborated by efficacious drugs that act upon dopamine receptors in the nucleus accumbens (NAc) (for review see [5]). In addition, extensive connections exist between serotonergic neurons and many of the brain regions involved in the regulation of impulse control, such as the NAc, prefrontal cortex (PFC), ventral tegmental area (VTA), and hippocampus [7, 8].

Owing to the strong hereditary influence on ADHD prevalence (71% of variance accounted for by genetic differences), many researchers have attempted whole genome linkage studies and genome wide association studies (GWAS) (for review see [1]). Unsurprisingly, strong correlations were consistently found for many dopaminergic and serotonergic genes, but a single common genetic variant is unlikely to be responsible for individual presentations of impulsivity. Researchers have therefore begun to postulate that cell architecture and function may play a more significant role than originally believed [1]. In support of this, resting-state functional connectivity MRI (rs-fcMRI) studies have found positive linear relationships between NAc—PFC connectivity and impulsivity [6]. Moreover, a meta-analysis of 55 different studies demonstrated that the executive dysfunction associated with impulsivity and inattention resulted from hypoactivation of the frontoparietal network, whereas distractibility was linked to hyperactivation of the ventral attention network [9]. To our knowledge no studies have looked at dendritic morphology with respect to impulsivity, but neurotransmitter modulation has been investigated extensively (for review see [5]). For example, mice lacking the dopamine transporter 1 (Dat1) exhibit hyperactivity and risk taking behaviours that reflect impulsivity [10], while specific human Dat1 genotypes have been linked to striatal activation patterns in ADHD individuals [11]. A novel study by Dalley and colleagues [12] showed that impulsivity in rats was associated with a significant reduction in dopamine 2 and dopamine 3 receptors in the ventral striatum.

A major contributor to the occurrence of impulsivity, and possibly ADHD in adolescence is mild traumatic brain injury (mTBI) or concussion [13, 14]. TBI, generally associated with falls, sports, and automobile accidents, is the leading cause of disability and mortality in children and adolescents [15], with mTBI and concussions accounting for 80–90% of all of these injuries [16]. Although symptoms are transient for most children, a significant proportion of children go on to suffer from lingering and progressive symptoms [17]. Studies indicate that children with persistent post-concussive symptoms experience difficulties paying attention, decreased concentration, and slowed reaction times, while their caregivers often report increased impulsivity and impatience [18–21]. As concussion symptomology is likely dependent upon reductions in tract integrity associated with tearing and shearing of white matter [22–25], it stands to reason that the complex circuits involved in reward processing and response inhibition are also likely to be at risk. Circumstantial differences in directionality and severity of the acceleration forces involved in the brain injury, in conjunction with pre-morbid characteristics, could therefore contribute to the heterogeneity of symptom presentation [7, 25–27].

With this in mind, the purpose of the current study was two fold. First, the study sought to examine the effects of an adolescent mTBI on aspects of the reward pathway, with specific emphasis on the frontostriatal circuit. Investigation into this pathway involved implementation of multiple techniques, including behavioural analysis of impulsivity and response inhibition, Golgi-Cox staining of medium spiny neurons in the NAc, and determination of gene expression changes in both the PFC and NAc. The second objective of the study was to determine how pre-existing impulsivity moderated outcomes from an early mTBI, with an emphasis on the frontostriatal reward circuit. Two behavioural paradigms capitalized on Go/No-Go training to examine impulsivity, response inhibition, and strategy perseveration, while gene expression changes in dopamine receptors, catecholamine transporters, and neurotransmitter signaling were used to study aspects of the frontostriatal circuit in impulsive and standard rats after a concussion. Based upon epidemiological data [28], we hypothesized that the adolescent brain injury would disrupt normal patterning of the frontostriatal pathway, and that premorbid impulsive behaviours would exacerbate mTBI-induced deficits of attention and inhibition

Materials and Methods

Study Design

The study was divided into two distinct but related experiments. As both experiments used the same protocols and procedures, they will only be described once. The first experiment was designed to examine the effects of a concussion on the frontostriatal pathway in standard juvenile rats. Male and female pups were trained on the paradigms below, received an early brain injury, underwent testing, and were sacrificed for molecular and neuroanatomical analysis. The second experiment was designed to investigate the effects of pre-morbid impulsivity on mTBI-related modification to the frontostriatal pathway. Male and female pups from the standard and impulsive cohorts were trained on the paradigms below, received an early brain injury, underwent testing, and were sacrificed for molecular analysis.

Subjects and Breeding Procedures

All experiments reported here were carried out in accordance with the Canadian Council of Animal Care and received approval from the University of Calgary Conjoint Faculties Research Ethics Approval Board. The husbandry room was maintained at 21°C on a 12:12 hr light:dark cycle in which the lights turned on at 0700. Half of the Sprague Dawley rat pups were born to dams that had ad libitum access to food and water (STD) and the other half were born to dams that were calorically restricted for 9 weeks; 3 weeks prior to mating, the 3 weeks of gestation and the 3 weeks of weaning (IMP). In the caloric restriction group, dams had ad libitum access to food every other day; food was restricted on alternating days but access to water was maintained throughout. Care was taken to ensure that dams did not lose more than 30% of their average daily weight. As prior observations in the laboratory [29] suggested that pups born to calorically restricted dams were hyperactive and possibly impulsive, we used this programming technique to generate an inherently impulsive phenotype that could be tested in this study. A total of 41 pups were born to four calorically restricted dams (23 Male: 18 Female) and 42 pups were born to four standard fed dams (20 Male: 22 Female). To control for litter effects, at postnatal day 21 (P21) a single male and female from each dam was randomly assigned to live in a sex-matched cage with 3 other animals from the same dam type (STD vs. IMP). A total of 48 rat pups (12 male STD, 12 male IMP: 12 female STD, 12 female IMP) were used for this study.

Hyperactivity

Animals were tested in the Open Field paradigm on P26, P33, P40, P47, and P55 to measure general locomotor activity. On each of these days, rats were placed in the center of a circular arena (diameter 135 cm) and permitted to explore the environment for 10 minutes. An overhead camera running Noldus Ethovision XT 10.0 software was used to track and analyze the rat’s overall movement and distance travelled. The arena was cleaned with Virkon® between each testing session.

5-Choice Serial Reaction Test (Go/No-Go Task & Extinction Paradigm)

All animals began training in the 5-Choice Serial Reaction test (Go/No-Go task) on P27. For the duration of Go/No-Go training and testing, rats were food restricted in an effort to increase their motivation to obtain the food rewards associated with the task (weight loss did not exceed 20% of normal body weight). The training protocol used was similar to that of Bari et al [30], but modified by this laboratory [31] for younger rats. The protocol ran on two identical Habitest Modular 5-Hole Operant Conditioning Chambers (28 cm x 29 cm x 24 cm–W x H x D) (Harvard Apparatus, QC Canada). The training was divided into two stages. The first step was designed to teach the rats that a reward (a banana flavored 45g precision-weight food tablet (BioServ, Product #F0059)) would be provided when they correctly nose-poked an illuminated hole (Go stimuli) and that 3 reward pellets would be provided if they resisted nose-poking an illuminated hole when all of the holes were illuminated (No-Go stimuli). In summary, Stage 1 training sessions were 20 minutes long. They began with an illumination of the house light and reward magazine where a reward pellet had been left. Once the rat retrieved the reward pellet, the session commenced with the house light and reward magazine light being extinguished and the Go stimulus initiated. The Go stimulus in this stage consisted of illumination of 1of the 5 holes; this hole remained illuminated until the rat nose-poked the specific hole. Upon nose-poking the correct hole, the hole light extinguished and the reward magazine/house lights illuminated at the same time that a banana pellet was dispensed into the reward magazine. During Stage 1 of the training, the rat was not penalized for nose-poking the wrong hole; it was simply just not rewarded, i.e. nose poking of the other 4 dark holes would not dispense a banana pellet nor would it extinguish the Go stimulus. Once the rat correctly nose-poked and retrieved its banana pellet, a second hole was illuminated (the order of the Go stimuli illumination was randomly designed) and the process continued. No-Go stimuli were randomly presented (~ every 5–7 stimuli), interspersed among the Go stimuli. A No-Go stimulus was characterized by simultaneous illumination of all 5 holes. The rat had to learn to abstain from nose poking under these conditions. If the rat was able to abstain from responding in the No-Go stimulus, the lights in the 5 holes were extinguished, the reward magazine and house lights were illuminated, and 3 banana pellets were dispensed. An incorrect response on the No-Go stimuli (nose-poking any of the illuminated holes) resulted in a 20 second time-out (a period of darkness where the rats were unable to poke for rewards). Stage 1 training sessions occurred once/day for 10–14 consecutive days. When rats were proficient at Stage 1, Go stimuli, animals were switched to Stage 2 training.

Stage 2 of the training procedure required sustained visual attention. Similar to Stage 1, Stage 2 began with illumination of the house light and reward magazine and retrieval of a banana pellet. However, when these lights were extinguished a Go stimulus was again initiated (illumination of a single hole), but it only remained illuminated for 5 seconds. The animal was now required to nose poke within the 5s illumination period to receive a reward. If the animal nose-poked within the limited period, the illumination of the hole was extinguished, the house light and reward magazine were illuminated, and the banana pellet dispensed. Conversely, if the rat failed to nose poke the correct hole in the 5 s illumination period, it received a 5 s timeout. Once the rat retrieved the reward or the time-out ended, a second Go stimulus was illuminated (again the Go stimuli were delivered in a random order that differed from Stage 1). No-Go stimuli were also randomly injected into the Stage 2 training session, approximately every 5–7 stimuli. The No-Go stimuli procedure did not differ from that described in Stage 1. Stage 2 sessions were also 20 minutes long and occurred over 21 consecutive days.

Stage 3 was an Extinction protocol that was delivered over 3 consecutive days. This procedure was designed to determine if the animals would continue to nose poke in the absence of a reward. The rats were again placed in the Habitest Modular 5-Hole Operant Conditioning chambers for 20-minute sessions. The Extinction procedure consisted of only Go stimuli (5 s illuminations of a single hole). However in these circumstances when the rat correctly nose-poked, no banana pellet rewards were dispensed, i.e. the illumination would be extinguished, but there would be no subsequent illumination of the reward magazine and house light or deliverance of any pellets. After a 5 s delay, another Go stimuli would be illuminated. If correctly nose-poked in the 5 s period, the light would again extinguish but not be followed by a reward. If the rat did not correctly nose poke in the 5 s period, the light would extinguish, there would be a 5 s delay and another light would illuminate. There were no No-Go stimuli in the Extinction stage.

All data for the Go/No-Go test and Extinction paradigm was collected and analyzed with Graphic State 4 software (Coulburn Instruments, QC Canada). Data was collected for the Go/No-Go test at two distinct time-points, the day prior to the mTBI (7 days of Stage 2 training had been completed) and on the last day of Stage 2 training. Data for the Extinction paradigm was collected on Day 1 and Day 3 of Extinction training. Rats were scored on 5 measures; A) their accuracy level determined by their ability to detect the illumination and respond correctly by nose-poking the appropriate hole, B) their level of inaccuracy determined by nose-poking the wrong hole during the 5 s illumination period; given that illumination remained for 5 s or until the rat correctly nose-poked, rats could incorrectly nose poke multiple wrong holes for any given Go stimulus, C) impulsivity—additional nose-pokes into any of the holes that occurred during a time-out or premature nose-pokes that occurred in the 5 s delay after reward retrieval and before the next light could be illuminated, D) response inhibition—the latency to nose poke on the No-Go stimuli, and E) the number of missed lights which measured the number of lights that were illuminated for 5 s but not correctly nose-poked.

mTBI Procedure and Validation

At P48, rats from both of the cohorts (IMP and STD) received a mTBI using the modified weight drop technique as previously described [32, 33] or a sham injury. In short, rats were lightly anesthetized (until non-responsive to a toe pinch) with isofluorane and placed chest down on a scored piece of tinfoil that was suspended 10cm above a foam collection sponge. A 150g weight was dropped through a Plexiglas® guide tube (from 0.5m height), which produced a glancing impact to the top of the rat’s head propelling it through the tinfoil. The rat underwent a 180° rotation and landed on its back. The free fall produced acceleration/deceleration and rotational forces on the brain that mimic the forces of concussion. Immediately after the injury, the rats received topical administration of lidocaine and were placed in the supine position in a clean warm cage to recover. Animals experiencing a sham injury were exposed to the same procedure but did not experience the glancing impact or free fall.

Following the injury, all animals were scored for their time-to-right. This was measured as the time each rat took to wake and right its self, i.e. flip from the supine position to a prone or standing position. This was used a measure of loss of consciousness that differentiates between average time to wake from just the anesthetic (control animals) and time to wake after the anesthetic plus the injury (mTBI animals). Animals that had experienced a mTBI took significantly longer to wake and right themselves than animals in the sham group, regardless of sex or cohort, F(1, 41) = 26.19, p < .01. [Male IMP mTBI; 33.31 ±2.6 sec, Male IMP sham; 16.67 ±2.6 sec, Male STD mTBI, 26.82 ± 3.0 sec, Male STD sham; 18.32 ± 3.0 sec, Female IMP mTBI; 31.27 ±2.6 sec, Female IMP sham; 22.9 ±2.6 sec, Female STD mTBI; 34.71 ±3.0 sec, Female STD sham; 19.46 ±3.0 sec]. This finding is consistent with prior studies in our laboratory and is used to validate the presence of a brain injury [32, 34]. See Fig 1 for an overview of the experimental design along with a timeline of important testing dates.

Neuroanatomical and Molecular Analysis

Following all behavioural testing, rats were sacrificed at P65. A portion of the rats (n = 28) were subjected to isoflourane inhalation, weighed, and rapidly decapitated. Using the Zilles atlas [35] tissue from the Cg3 and IL (the PFC) and NAc was removed, flash frozen on dry ice, and stored at -80°C for molecular profiling. The remainder of the rats (n = 20) were administered an overdose of sodium pentobarbital, weighed, and intracardially perfused with 0.9% saline. The brains were removed and placed in dark bottles containing Golgi-Cox solution where they were stored for 14 days.

For the molecular analysis, total RNA was extracted from the brain tissue with the Allprep RNA/DNA Mini Kit according to manufacturer protocols (Qiagen, Germany). The concentration and purity of samples were measured with a NanoDrop 2000 (Thermo Fisher Scientific, USA). Purified RNA (2μg) was reverse transcribed into cDNA using the oligo(dT)₂₀ Superscript III First-Strand Synthesis Supermix Kit (Invitrogen, USA) according to manufacturer protocols.

Genes were selected based on their prior use in studies of impulsivity, with specific emphasis on the frontostriatal pathways. Eight genes were selected: Catachol-O-methyltransferase (Comt), Dopamine receptors 2, 3, and 4, (Drd2, Drd3, Drd4), Monoamine oxidase A, (Maoa), Serotonin transporter (Sert), and Tryptophan hydroxylase 1, and 2 (Tph1, Tph2). Multiple attempts were made to examine the Dopamine transporter (Dat1), but expression levels were below detectable ranges. In addition, Drd3 expression was determined for the NAc, but fell below detection in the PFC and was therefore omitted for that specific brain region.

All primers for the qRT-PCR were designed in-house by a research technician using Primer3 (http://bioinfo.ut.ee/primer3) and were then purchased from IDT (Coralville, USA). See Table 1 for primer sequences and optimal cycling parameters for the 8 genes. Each sample was run in duplicate and two separate research analysts processed all target genes. qRT-PCR was performed and analyzed with the CFX Connect Real-Time PCR detection system (Bio-Rad, Hercules, USA) with 10ng of cDNA, 0.5μM of the forward and reverse primers, and 1X SYBR Green FastMix with Rox. Relative target gene expression was determined by normalization to two housekeeping genes, CycA and Ywhaz [36] using the 2^-ΔΔCt method as previously described by Pfaffl [37].

Table 1. Primer information for the 8 genes examined with relative qPCR.

Gene Symbol	Gene Name	Primer Sequence	Amplicon Size (bp)	Tm (°C)	Cycling Parameters
		(+ sense and–antisense)
Comt	Catechol o-methyltransferase	(+) atcttcacggggtttcagtg	145	60.0
		(-) gagctgctggggacagtaag
Drd2	Dopamine receptor D2	(+) gccgagttactgtcatgattgc	154	60.0
		(-) ggcacgtagaatgagacaatgg
Drd3	Dopamine receptor D3	(+) tcttcagtggtgtccttctacg	200	59.0
		(-) ctggcccttattgaaaactgcc
Drd4	Dopamine receptor D4	(+) cctcaaccccatcatctacacc	193	60.0	1 cycle 95°C 3 min,
		(-) cccagcgttgataaatggttagg
Maoa	Monoamine oxidase A	(+) gagaagaactggtgtgaggagc	170	60.0	40 cycles 95°C 15 sec,
		(-) tcaactgctccttccatgtagc
SERT	Serotonin transporter (Slc6a4)	(+) gtggactctcagacatgctacc	190	60.0	40 cycles 95°C 15 sec,
		(-) ttagaagctaacagatgcgggg
Tph1	Tryptophan hydroxylase 1	(+) cactcactgtctctgaaaacgc	216	60.0	40 cycles Tm °C 30 sec,
		(-) agccatgaatttgagagggagg
Tph2	Tryptophan hydroxylase 2	(+) gtgtgtaaaagcctttgacccg	181	60.0	+Melt Curve
		(-) ttcaatgctctgtgtgtagggg
CycA	Cyclophilin A	(+) agcactggggagaaaggatt	248	58.0
		(-) agccactcagtcttggcagt
Ywhaz	Tyrosine 3-monooxygenase/ tryptophan, 5-monooxygenase activation protein, zeta	(+) ttgagcagaagacggaaggt	136	56.1
		(-) gaagcattggggatcaagaa

Open in a new tab

To complete the histological processing, brains were transferred to 30% sucrose solution, following the 14-day Golgi-Cox impregnation period. Brains remained in sucrose for at least 3 day prior to being cut at 200μm on a Vibratome. Brain slices were mounted on gelatin coated slides and then stained according to the Golgi-Cox procedure described elsewhere [38, 39]. Individual neurons were selected from the NAc and traced at 250x using a camera lucida mounted on a microscope. A total of 10 cells (5/hemisphere) were traced from the NAc of each animal. The mean of cells from each hemisphere comprised the data points for the statistical analyses. See Fig 2B for a representative drawing of the cells and spines from the NAc. Neuroanatomical analyses included: 1) dendritic branch order, an overall estimation of the dendritic complexity based on the number of times the branches bifurcate, 2) Sholl analysis, a measure of dendritic length derived from the number of dendritic branches that intersect concentric circles spaced 20μm from the cell body, and 3) spine density, a measure of synaptic prevalence that is calculated by increasing the microscope to a 1000x magnification and counting the number of spine protrusions for every 10μm. A research technician blinded to all experimental conditions drew the neurons under investigation, and another research technician completed the analysis.

Fig 2 — A) Accuracy, B) Impulsivity, C) Inaccuracy, and D) Response Inhibition, for male and female animals from the STD cohorts at the pre-injury (black bars) and post-injury (white bars) test sessions (x significant effect of mTBI, * significant effect of testing period, all p < .05).

Statistical Analysis

All statistical analyses were carried out with SPSS 22.0 for Mac. Repeated measures ANOVAs were conducted with the pre-injury and post-injury testing points (days) treated as within-subjects variables and sex (male/female), injury (mTBI/sham), and cohort (IMP/STD) treated as between-subject factors. Dependent variables were drawn from the Go/No-Go test. Repeated Measures ANOVAs were also conducted with extinction day 1 and extinction day 3 (days) treated as within-subjects variables and sex (male/female), injury (mTBI/sham), and cohort (IMP/STD) treated as between-subject factors with outcomes of the Extinction paradigm treated as dependent variables. A repeated measures ANOVA for the 5 testing days with sex (male/female), injury (mTBI/sham), and cohort (IMP/STD) as factors was run to analyze hyperactivity in the open field. Three-way ANOVAs with sex (male/female), injury (mTBI/sham), and cohort (IMP/STD) as factors were run for the measures of injury validation and changes in gene expression. Finally, a two-way ANOVA with sex (male/female) and injury (mTBI/sham) as factors was run for the neuroanatomical variables. In all cases a p < .05 was considered statistically significant.

Results

Experiment #1. Pediatric mTBI and the Frontostriatal Pathway

Go/No-Go Paradigm

Accuracy: Accuracy was used to measure the animal’s spatial attention and ability to quickly and accurately respond to the illumination of a random hole. Animals were tested in the Go/No-Go paradigm prior to the injury and approximately 2 weeks after the mTBI. All animals improved from the first testing period to the second, but the improvement in accuracy was significantly greater for sham animals than for mTBI animals. The repeated measures ANOVA demonstrated a significant day x injury interaction, F(1,19) = 9.12, p = .01, with a significant between-subjects effect of injury, F (1, 19) = 9.47, p = .01, sex, F(1, 19) = 7.61, p = .02, but not a significant interaction, p >.05. See Fig 2A.

Impulsivity: The number of ‘impulsive’ nose-pokes (nose-poking prior to activation of the Go stimulus, or during a timeout) was measured for both testing sessions. A mTBI induced a significant increase in the number of impulsive nose-pokes committed by male animals at the second testing session. No differences were observed in the number of impulsive nose-pokes for females. The repeated measures ANOVA demonstrated a significant between-subjects effect of sex, F (1, 19) = 45.53, p < .01, but not of injury, F(1, 19) = 2.13, p = .18. See Fig 2B.

Inaccuracy: Inaccuracy was a measure of the number of holes that were poked incorrectly while the cued light was on. There were no significant differences between sham and mTBI animals at the second testing session. The repeated measures ANOVA demonstrated no significant effects or interactions, p’s >.05. See Fig 2C.

Response Inhibition: Animals were scored on their ability to inhibit a response during the No-Go stimuli. Early in the training procedure (test day 1) all animals scored poorly on this task, regardless of sex. Similar to the accuracy testing, sham animals exhibited greater improvements from the pre-injury test to the post injury session than mTBI animals. The repeated measures ANOVA demonstrated a significant day effect, F(1, 19) = 26.41, p < .01, and a day x injury interaction, F(1,19) = 4.94, p = .05. See Fig 2D.

Neuroanatomical Analysis

Golgi-Cox analysis of neurons in the NAc was only carried out for animals in the standard cohort with a mTBI or sham injury. The analysis did not include IMP animals.

Dendritic Branch Order: Analysis of the medium spiny neurons in the NAc demonstrated that both male and female animals with an early mTBI had significantly more dendritic branches when compared to animals with a sham injury. The two-way ANOVA showed a main effect of injury, F(1, 39) = 12.09, p < .01, but not of sex, F(1, 39) = 2.54, p = .12, nor a significant interaction, F(1, 39) = 0.60, p = .45. See Fig 3B.

Fig 3 — A) exhibits a representative tracing of average medium spiny neurons and dendritic spines from the NAc in sham and mTBI animals; B) graphical representation of dendritic branch order from Golgi-Cox stained neurons; C) representation of average dendritic length, and D) is illustrative analysis of dendritic spine density; (*main effect of mTBI p < .05; # main effect of sex p < .05).

Sholl Analysis / Dendritic Length: The injury-dependent changes in dendritic length of medium spiny neurons varied for males and females. Male animals with an mTBI experienced significant reductions in dendritic length whereas female animals with an mTBI exhibited significant increases in dendritic length when compared to controls. The two-way ANOVA demonstrated a significant sex by injury interaction, F(1, 39) = 5.47, p = .03, but no significant main effects, p’s > .05. See Fig 3C.

Spine Density: Examination of synapse density in the NAc found that males and females differed at baseline, but both experienced a significant reduction following the mTBI. The two-way ANOVA demonstrated a significant main effect of sex, F(1, 39) = 73.27, p < .01, and of injury, F(1, 39) = 4.97, p = .03, but the interaction was not significant, F(1, 39) = 0.07, p = .80. See Fig 3D.

Molecular Analysis

Results from the ANOVAs for the 8 genes examined can be found in Table 2. In summary, a majority of the genes examined in the PFC and NAc exhibited significant sex-differences or sex x mTBI interactions whereby the mTBI resulted in opposing changes in gene expression for females and males. See Fig 4.

Table 2. Summary of results from the two-way ANOVAs for changes in expression of each of the genes examined in the NAc and PFC of animals with a sham or mTBI F(p).

Brain Region	Gene	Sex Effect	mTBI Effect	Sex x mTBI Interaction
	*Comt*	3.05 (.12)	1.90 (.21)	17.77 (< .01)
	*Drd2*	7.23 (.02)	2.83 (.13)	4.44 (.06)
	*Drd3*	1.23 (.29)	0.45 (.52)	3.44 (.10)
	*Drd4*	1.61 (.24)	1.28 (.29)	10.47 (.01)
NAc	*Maoa*	24.24 (< .01)	19.94 (< .01)	4.17 (.07)
	*Sert*	0.02 (.89)	0.02 (.89)	0.43 (.53)
	*Tph1*	1.41 (.27)	0.02 (.88)	3.37 (.10)
	*Tph2*	103.77 (< .01)	55.75 (< .01)	22.77 (< .01)
	*Comt*	0.56 (.48)	0.07 (.79)	0.53 (.49)
	*Drd2*	1.49 (.26)	0.09 (.77)	4.61 (.06)
	*Drd3*	N/A
PFC	*Drd4*	11.25 (.01)	0.11 (.75)	0.02 (.91)
	*Maoa*	14.21 (< .01)	0.10 (.76)	0.65 (.44)
	*Sert*	2.10 (.19)	1.65 (.23)	5.63 (.04)
	*Tph1*	0.88 (.38)	0.01 (.96)	0.28 (.61)
	*Tph2*	13.95 (< .01)	0.10 (.78)	1.00 (.34)

Open in a new tab

Fig 4 — The centerline represents typical expression (STD-shams) with the bars exhibiting percent changes from normal (*main effect of mTBI p < .05).

Experiment #2. Impulsivity, mTBI, and the Frontostriatal Circuit