Purification, crystallization and X-ray crystallographic analysis of human RAB11(S20V), a constitutively active GTP-binding form

RAB11(S20V), a constitutively active GTP-binding form of RAB11, was purified and crystallized. Crystals were obtained at 293 K and diffracted to a resolution of 2.4 Å; they belonged to space group I4, with unit-cell parameters a = 74.11, b = 74.11, c = 149.44 Å.

Abstract

RAB11, a member of the Ras superfamily of small G proteins, is involved in the regulation of vesicle trafficking during endosome recycling. Substitution of Ser20 by Val20 in Rab11 [RAB11(S20V)] inhibits its GTP hydrolysis activity and produces a constitutively active GTP-binding form. In this study, the RAB11(S20V) mutant was overexpressed in Escherichia coli with an engineered C-terminal His tag. RAB11(S20V) was then purified to homogeneity and was crystallized at 293 K. X-ray diffraction data were collected to a resolution of 2.4 Å from a crystal belonging to space group I4, with unit-cell parameters a = 74.11, b = 74.11, c = 149.44 Å. The asymmetric unit was estimated to contain two molecules of RAB11(S20V).

1. Introduction  

The Ras superfamily of small G proteins are a family of GTP hydrolase enzymes that perform critical functions in various cellular processes, including cytoskeletal organization, mitogenesis, vesicle trafficking and nuclear transport (Macara et al., 1996 ▸). The activity of this family is controlled by the nucleotide-binding state. The family is active when bound to GTP and inactive when bound to GDP (Takai et al., 1992 ▸). GDP can be replaced by free GTP to produce the active form. GTP hydrolysis in this family is accelerated by GTPase-activating proteins (GAPs), and GTP exchange is catalyzed by guanine nucleotide-exchange factors (GEFs) (Park, 2013 ▸). The RAB (RAs in the brain) GTPase family is part of the Ras superfamily of small G proteins and is particularly responsible for vesicle trafficking, which is essential for endocytosis, biosynthesis, secretion, cell differentiation and growth (Bergbrede et al., 2009 ▸). The active form of the RAB family can recruit specific binding partners, such as sorting adaptors, tethering factors, kinases, phosphatases and motors, and influence vesicle formation, transport and tethering (Gross­hans et al., 2006 ▸). The RAB GTPase family has been extensively studied because a functional loss of the RAB pathways has been implicated in a variety of human diseases (Stenmark, 2009 ▸), such as choroideraemia and neurodegenerative diseases (Gitler et al., 2008 ▸; Rak et al., 2004 ▸).

The RAB11 family is a representative RAB GTPase family. This family of small G proteins are particularly involved in the control of TfR recycling and in the mobilization of endosomal membranes for phagocytosis in macrophages (Cox et al., 2000 ▸; Ullrich et al., 1996 ▸). Recent structural studies of the RAB family show that the structural changes upon binding of GTP or GDP in switches 1 and 2 might be critical for activity in the RAB family (Pasqualato et al., 2004 ▸). Mg²⁺ is also a critical cofactor for the activity of the RAS superfamily of small G proteins by participating in the coordination of GTP or GDP in the GTP-binding pocket (John et al., 1993 ▸). GTP/Mg²⁺ binds more strongly to the RAB GTPase family than GDP/Mg²⁺ (Simon et al., 1996 ▸). Substitution of Ser20 by Val20 [hereafter called RAB11(S20V)] or of Gln60 by Leu [RAB11(Q70L)] inhibits the GTP-hydrolysis activity of RAB11 (Pasqualato et al., 2004 ▸). These mutations are constitutively active forms and, as such, are used in many cellular experiments (Cox et al., 2000 ▸).

The exact regulation mechanism by which GTP and GDP mediate the activity of the RAB GTPase family is still vague. As a first step towards obtaining a better understanding of this process, we overexpressed, purified and crystallized a mutant defective in its GTP hydrolysis activity: the GTP-locked, constitutively active form of RAB11, RAB11(S20V). X-ray diffraction data were collected to a resolution of 2.4 Å from a crystal belonging to space group I4, with unit-cell parameters a = 74.11, b = 74.11, c = 149.44 Å. The asymmetric unit was estimated to contain two molecules of RAB11(S20V).

2. Materials and methods  

2.1. Macromolecule production  

RAB11(S20V) (amino-acid residues 8–175) was expressed in Escherichia coli. Full-length human RAB11(S20V) (GenBank ID P62491.3) was amplified by PCR using gene-specific primers containing NdeI and XhoI sites (forward, GGGCATATGATGGGCACCCGCGACGACGA; reverse, GGGCTCGAGTTAGATGTTCTGACAGC). PCR fragments were subsequently digested and ligated into pET-24a vector containing a C-terminal hexahistidine tag. The sequence of the cloned gene was verified by DNA sequencing. Our construct of RAB11(S20V) has an eight-residue tag that includes six C-terminal histidine residues (LEHHHHHH). The resulting plasmid was transformed into E. coli BL21 (DE3) competent cells, after which the cells were plated onto LB (Luria–Bertani) medium and incubated for 24 h at 310 K. Next, individual colonies were inoculated into 5 ml LB medium and incubated overnight at 310 K with shaking. Cultured cells were then transferred to 1 l LB medium and incubated with shaking for 4 h at 310 K until the OD₆₀₀ reached 0.67, after which expression was induced with 0.25 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 20 h at 293 K. Following induction, the bacteria were collected, resuspended and lysed by sonication in 50 ml lysis buffer (20 mM Tris–HCl pH 7.9, 500 mM NaCl, 20 mM imidazole). The bacterial lysate was subsequently centrifuged at 16 000g for 30 min at 277 K, after which the supernatant was applied onto a gravity-flow column (Bio-Rad) packed with 1.5 ml Ni–NTA affinity resin (Qiagen). The unbound bacterial proteins were subsequently removed from the column using 50 ml washing buffer (20 mM Tris–HCl pH 7.9, 500 mM NaCl, 25 mM imidazole). The target protein was subsequently eluted from the column using elution buffer (20 mM Tris–HCl pH 7.9, 500 mM NaCl, 250 mM imidazole). Fractions containing greater than 90% homogenous protein, as determined by SDS–PAGE, were pooled, after which the protein purity was further improved using a Superdex 200 10/30 gel-filtration column (GE Healthcare) pre-equilibrated with a solution consisting of 20 mM Tris–HCl pH 8.0, 150 mM NaCl. The target molecule eluted at about 17–18 ml; fractions were cooled and concentrated to 14 mg ml⁻¹ using a Vivaspin centrifugal concentrator (Sartorius, Göttingen, Germany). Macromolecule production is summarized in Table 1 ▸.

Table 1. Macromolecule-production information.

Source organism	Human
DNA source	GenBank P62491.3
Forward primer	GGGCATATGATGGGCACCCGCGACGACGA
Reverse primer	GGGCTCGAGTTAGATGTTCTGACAGC
Cloning vector	pET-24a
Expression vector	pET-24a
Expression host	E. coli BL21(DE3)
Complete amino-acid sequence of the construct produced	MGTRDDEYDYLFKVVLIGDSGVGKSNLLSRFTRNEFNLESKSTIGVEFATRSIQVDGKTIKAQIWDTAGQERYRAITSAYYRGAVGALLVYDIAKHLTYENVERWLKELRDHADSNIVIMLVGNKSDLRHLRAVPTDEARAFAEKNGLSFIETSALDSTNVEAAFQTILTEIYRIVSQKQMSDRRENDMSPSNNVVPIHVPPTTENKPKVQCCQNILEHHHHHH

2.2. Crystallization  

The crystallization conditions were initially screened at 293 K by the hanging-drop vapour-diffusion method using screening kits from Hampton Research (Crystal Screen, Crystal Screen 2, Index HT, SaltRX, Natrix, MembFac and Crystal Screen Cryo) and Jena Bioscience (Wizard I, II, III and IV). 24-Well crystallization plates from Hampton Research were used for crystallization. The initial crystals were grown by equilibrating a mixture consisting of 1 µl protein solution (14 mg ml⁻¹ protein in 20 mM Tris–HCl pH 8.0, 150 mM NaCl) and 1 µl reservoir solution consisting of 2.5 M sodium chloride, 0.2 M magnesium chloride, 0.1 M Tris–HCl pH 7.0 against 0.3 ml reservoir solution. After optimization, crystals appeared within 5 d and grew to maximum dimensions of 0.1 × 0.1 × 0.1 mm in the presence of 2.4 M sodium chloride, 0.1 M magnesium chloride, 0.1 M Tris–HCl pH 7.1. These crystals diffracted to 2.4 Å resolution. A summary of the crystallization is provided in Table 2 ▸.

Table 2. Crystallization.

Method	Hanging-drop vapour diffusion
Plate type	24-well plates, Hampton Research
Temperature (K)	293
Protein concentration (mgml1)	14
Buffer composition of protein solution	20mM TrisHCl pH 8.0, 150mM NaCl
Composition of reservoir solution	2.4M sodium chloride, 0.1M magnesium chloride, 0.1M TrisHCl pH 7.1
Volume and ratio of drop	2l, 1:1
Volume of reservoir (l)	300

2.3. Data collection and processing  

For data collection, the crystals were directly cooled in liquid nitrogen. The high concentration of salt made the mother liquor a good cryoprotectant without further modifications. A 2.4 Å resolution native diffraction data set was collected from a single crystal using an ADSC quantum 315r detector (crystal-to-detector distance 250 mm, 1° oscillation per image, total rotation angle of 180°) on beamline 5C at the Pohang Accelerator Laboratory (PAL), Republic of Korea. The data set was indexed and processed using HKL-2000 (Otwinowski & Minor, 1997 ▸). A summary of the data collection is provided in Table 3 ▸.

Table 3. Data collection and processing.

Values in parentheses are for the outer shell.

Diffraction source	5C, PAL
Wavelength ()	1.000
Temperature (K)	110
Detector	ADSC Quantum 315r
Crystal-to-detector distance (mm)	250
Rotation range per image ()	1
Total rotation range ()	180
Exposure time per image (s)	1
Space group	I4
Unit-cell parameters (, )	a = b = 74.11, c = 149.44, = = = 90.00
Mosaicity ()	0.6
Resolution range ()	502.4
Total No. of reflections	118010
No. of unique reflections	15662
Completeness (%)	100 (100)
Multiplicity	7.5 (7.6)
I/(I)	30.8 (3.9)
R r.i.m. (%)	12.5 (75.4)

3. Results and discussion  

The exact molecular mechanism of GTP- and GDP-mediated control of the activity of the RAB GTPase family is still unknown. To obtain a better understanding of this process, we overexpressed, purified and crystallized RAB11(S20V); this mutant is a well known GTP lock and a constitutively active form of RAB11.

His-tag affinity chromatography followed by gel-filtration chromatography produced 95% pure RAB11(S20V) and no contaminating bands were observed upon SDS–PAGE analysis. The calculated monomeric molecular weight of RAB11(S20V), including the C-terminal His tag, was 20.9 kDa and its size-exclusion chromatography peak eluted at around 17–18 ml, suggesting that it exists as a monomer in solution (Fig. 1 ▸). A gel-filtration standard (Bio-Rad) consisting of a mixture of molecular-mass markers, thyroglobulin (670 000 Da), globulin (158 000 Da), ovalbumin (44 000 Da), myoglobulin (17 000 Da) and vitamin B₁₂ (1350 Da), was used for size calibration.

Figure 1.

Purification of RAB11(S20V) by size-exclusion chromatography (SEC). The insert shows the SEC fractions analyzed by SDS–PAGE.

An initial crystal was obtained in solution No. 17 of Wizard II (Jena Bioscience; 2.5 M sodium chloride, 0.2 M magnesium chloride, 0.1 M Tris–HCl pH 7.0); however, it diffracted poorly. Optimization of the crystallization conditions using a range of concentrations of protein, NaCl and magnesium chloride and a range of pH led to better crystals using 2.4 M sodium chloride, 0.1 M magnesium chloride, 0.1 M Tris–HCl pH 7.1 (Fig. 2 ▸). The optimized crystals grew to dimensions of 0.1 × 0.1 × 0.1 mm in 5 d and diffracted to 2.4 Å resolution (Fig. 3 ▸). The crystals belonged to space group I4, with unit-cell parameters a = 74.11, b = 74.11, c = 149.44 Å.

Figure 2.

Crystals of RAB11(S20V). The crystals grew in 5 d in the presence of 2.4 M sodium chloride, 0.1 M magnesium chloride, 0.1 M Tris–HCl pH 7.1. The approximate dimensions of the crystals were 0.1 × 0.1 × 0.1 mm.

Figure 3.

A diffraction image (1° oscillation) of the Rab11(S20V) crystal. The 2.5 Å resolution ring is indicated; the crystal data were processed to 2.4 Å resolution.

Assuming the presence of two molecules in the crystallo­graphic asymmetric unit, the Matthews coefficient (V _M) was calculated to be 2.55 ų Da⁻¹<, which corresponds to a solvent content of 51.76% (Matthews, 1968 ▸. The molecular-replacement phasing method was conducted using Phaser (McCoy, 2007 ▸) with the GDP-binding form of RAB11 (PDB entry 1oiv; Pasqualato et al., 2004 ▸) as a search model. A clear solution with rotation-function and translation-function Z scores of 16.2 and 20.5, respectively, was obtained. Initial refinement with REFMAC5 (Vagin & Teplyakov, 2010 ▸) using the initial Phaser model gave an R _work of 30.8% and an R _free of 35.2%. An intact GTP with Mg²⁺ was detected at the nucleotide-binding site. Further structural refinement is currently in progress.