Correction to Supporting Information for Gauvain et al., The neuronal K-Cl cotransporter KCC2 influences postsynaptic AMPA receptor content and lateral diffusion in dendritic spines

NEUROSCIENCE Correction to Supporting Information for Gauvain et al. (2011) Proc Natl Acad Sci USA 108:15474–15479 (published online before print as 10.1073/pnas.1107893108).

The authors note that on page 1 of the Supporting Information, left column, first full paragraph, lines 5–7, “the rat nontarget shRNA sequence was CCTGCTTGTTGGCATCTATTTCTTCCTGTCAAAATAGATGCCAACAAGCAGG” should instead appear as “the rat nontarget shRNA sequence was GGAATCTCATTCGATGCATACCTTCCTGTCAGTATGCATCGAATGAGATTCC.” The SI has been corrected online.