Abstract
Background:
Pseudomonas aeruginosais a frequent nosocomial pathogen that causes severe diseases in many settings. Carbapenems, including meropenem and imipenem, are effective antibiotics against this organism. However, the use of carbapenems has been hampered by the emergence of strains resistant to carbapenemsvia different mechanisms such as the production of metallo-β-lactamases (MBLs), which hydrolyze all carbapenems. Several kinds of MBLs have been reported, among them VIM and IMP types being the most clinically significant carbapenemases.
Objectives:
We aimed to determine the distribution of blaVIM-2 and blaIMP-1 transferable genes encoding MBLs in P. aeruginosa isolated from three academic hospitals in Kermanshah.
Patients and Methods:
From 22nd June to 22nd September 2012, 225 isolates of P. aeruginosa were collected. These isolates were tested for antibiotic susceptibility with the Kirby-Bauer disk-diffusion method, and the MBLs were assessed using the imipenem-EDTA double-disk synergy test. The isolates were investigated for blaVIM-2 and blaIMP-1 genes using polymerase chain reaction.
Results:
Among the 225 isolates, 33.7% (76/225) and 18.1% (41/225) were resistant to imipenem and meropenem, respectively. Of the 76 imipenem-resistant P. aeruginosa strains, 45 (59.2%) were positive for MBLs, 34 (75%) strains carried the blaIMP-1 gene, and 1 (2.2%) strain carried the blaVIM-2 gene.
Conclusions:
Our results showed that there was a high frequency of IMP-1 positive P. aeruginosa in the different wards of the hospitals.
Keywords: β-Lactamases, Carbapenems, Polymerase Chain Reaction, Pseudomonas aeruginosa
1. Background
Pseudomonas aeruginosais a frequent nosocomial pathogen that causes severe diseases in many settings, particularly in immune-compromised patients such as those with cancer, burns, and cystic fibrosis. Infections are frequently severe, and two recent studies have indicated that the rate of mortality attributable to P. aeruginosa bacteremia is approximately 34% (1, 2). This organism is clinically important since it possesses several virulence factors and is intrinsically resistant to many antimicrobial and disinfectant agents (3). Carbapenems such as meropenem and imipenem are effective antibiotics against this organism since they present a good spectrum of activity and are stable to hydrolysis by most β-lactamases, including the extended spectrum β-lactamases (3, 4). However, the use of carbapenems has been hampered by the emergence of strains resistant to carbapenems via different mechanisms such as impermeability to the drug due to loss of OprD porin, upregulation of the active efflux pump systems, and production of metallo-β-lactamases (MBLs), which hydrolyze all carbapenems (5-7).
MBLs are divided into two categories: chromosomally mediated enzymes and those encoded by movable genetic elements such as plasmids and transposons (8-10). Several kinds of MBLs have been reported, including IMP, VIM, SPM, GIM, and SIM-1 (11). The VIM and IMP types are the most clinically significant carbapenemases coded by blaVIM and blaIMP genes. At least 14 different VIM and 23 different IMP MBLs have been identified so far (7, 8). There are many reports which indicate an increase in the prevalence of carbapenem-resistance mediated by acquired MBLs; however, the prevalence of the MBL-producing isolates of P. aeruginosa varies in Asian countries (8, 12, 13). In Iran, the first isolation of blaIMP-1 was reported in 2011 by Peymani et al. (14), who collected Acinetobacter baumannii isolates from several hospitals in Tabriz (Northwest of Iran).
The growing rate of resistance against the traditional antibiotics has rendered the treatment of patients with infections caused by MBL-producing P. aeruginosa critical. Previous studies have shown a high prevalence rate of multidrug-resistant P. aeruginosa isolated from different clinical specimens, especially in burn wards in Iran (15, 16); nevertheless, little information is available on the distribution of MBL-producing isolates in the country. For example, in Markazi province, 37% of the P. aeruginosa isolates obtained from the hospitalized patients were shown to be resistant to imipenem, and 50% of these strains were detected to have blaVIM-1, 56.6% blaVIM-2, and 6.6% blaIMP-1 (17). In another study, from 240 P. aeruginosa isolates, 34.16% were imipenem-resistant, and 23.3% were screened as MBL-positive strains using the double-disk synergy test. Additionally, a specific polymerase chain reaction (PCR) test confirmed the presence of 8 (9.75%) and 10 (12.19%) IMP-1 and VIM-2 types, respectively (18).
2. Objectives
The current study was performed to examine the prevalence of MBL-producing P. aeruginosa isolates obtained from clinical specimens at different hospitals in Kermanshah (Imam Khomeini, Imam Reza, and Taleghani hospitals) and also the prevalence of those harboring the blaVIM-2 and blaIMP-1 genes, which are the most clinically significant carbapenemases.
3. Patients and Methods
3.1. Samples
From 22nd June to 22nd September 2012, 225 isolates of P. aeruginosa were collected from three hospitals in Kermanshah. The isolates were taken from urine (n = 79, 35%), blood (n = 14, 6.2%), wound (n = 29, 12.8%), respiratory tract (n = 81, 36%), burned tissue (n = 17, 7.5%), and eye (n = 5, 2.2%). The isolates were collected from different wards, including ICU, CCU, urology, emergency, burn, respiratory, and surgery. P. aeruginosa was identified by Gram staining, ability to produce oxidase and catalase, oxidative-fermentative test, resistance to cetrimide, and growth at 42°C (19).
3.2. Antimicrobial Susceptibility Testing
The disk diffusion test was conducted in accordance with the clinical and laboratory standards institute (CLSI) methodology. The antimicrobial agents included comprised aztreonam (10 µg), cefepime (10 µg), ceftazidime (30 µg), ciprofloxacin (5 µg), gentamicin (10 µg), imipenem (10 µg), and piperacillin/tazobactam (10 µg, 100 µg) (MAST, U.K.). P. aeruginosa ATCC 27853 was used as quality control in each run of antimicrobial susceptibility testing.
3.3. Identification of Metallo-β-Lactamases
Among β-lactamases, MBLs are unique in requiring the presence of zinc ion in the active site of the enzyme, and are, thus, inhibited by chelating agents such as ethylenediaminetetraacetic acid (EDTA) (20). The imipenem-EDTA double-disk synergy test was used in order to identify the P. aeruginosa producing MBLs. Therefore, a 0.50-M EDTA (Merck, Germany) solution was prepared by dissolving 186.1 g of EDTA in 1000 mL of distilled water, and the pH was adjusted to 8 by adding NaOH (21). Then, 4 μL of the prepared solution was added to the imipenem disk and dried in an incubator. The prepared EDTA/imipenem disk and the imipenem disk itself were placed in a plate containing the Müller-Hinton agar (Merck, Germany) with cultured P. aeruginosa. After 16 - 18 hours of incubation at 37°C, an increase of ≥ 7 mm in the inhibition zone diameter in the presence of EDTA compared to imipenem tested alone was considered to be a positive test for the presence of an MBL (4, 18, 22).
PCR was performed to detect the blaVIM-2 and blaIMP-1 genes. The DNA templates from all the isolates were extracted by boiling (10 minutes in 95°C), and PCR was carried out in a thermal cycler (Bio Rad, USA) using 25-µL volumes containing 12.5 µL of PCR Master Mix (500 mM of Tris-HCl pH 8.55, 1.5 mM of MgCl2, 0.2 mM of dNTPs, and 0.04 units/uL of Taq DNA polymerase) (SinaClon Inc., Tehran, Iran) and 0.5 µM of each of the primers (SinaClon Inc., Iran). The primers and the cycling condition are listed in Table 1 (23, 24).
Table 1. Primers and Cycling Condition.
| Target | Oligonucleotide Sequence (5’ - 3) | Polymerase Chain Reaction Condition | No. of Cycles | Fragment Size, bp | Reference |
|---|---|---|---|---|---|
| bla IMP-1 | 94°C, 30 s | 25 | 448 | (23) | |
| CATGGTTTGGTGGTTCTTGT | 57°C, 45 s | ||||
| ATAATTTGGCGGACTTTGGC | 72°C, 60 s | ||||
| bla VIM-2 | 94°C, 30 s | 25 | 801 | (24) | |
| ATGTTCAAACTTTTGAGTAAG | 57°C, 45 s | ||||
| CTACTCAACGACTGAGCG | 72°C, 60 s |
Following amplification, 10 µL of each sample was analyzed with 1.5% agarose gel electrophoresis for the detection of positive samples. For all the amplification reactions, the mixture was heated at 96°C for 4 minutes prior to thermocycling. The mixture was held at 72°C for 7 minutes after the final cycle before cooling at 4°C. The agarose gel electrophoresis of blaVIM-2 and blaIMP-1 PCR products is depicted in Figure 1. The positive controls (clinical P. aeruginosa isolates with sequenced blaIMP-1 and blaVIM-2 genes) were kindly dedicated by Dr. Najjar Pirayeh (Tarbiat Modarres University), and the negative control contained water in place of DNA.
Figure 1. Electrophoresis Results of the blaIMP-1 Gene Polymerase Chain Reaction.

Lane 1: Positive control (clinical P. aeruginosa with the sequenced blaIMP-1 gene). Lane M: 100 bp DNA ladder. Lanes 2, 3, and 4: Isolates with the blaIMP-1 gene. Lane 5: Negative control (distilled water).
Figure 2. Electrophoresis Results of the blaVIM-2 Gene Polymerase Chain Reaction.

Lane M: 100 bp DNA ladder. Lane 1: Isolate with the blaVIM-2 gene. Lane 2: Negative control (distilled water). Lane 3: Positive control (clinical P. aeruginosa with the sequenced blaVIM-2 gene).
4. Results
Totally, 225 confirmed isolates of P. aeruginosa recovered from different clinical specimens were tested for antibiogram. The findings showed that 137 (61%) isolates were resistant to ceftazidime, 131 (58.5%) to gentamicin, 130 (57.7%) to piperacillin/tazobactam, 101 (44.7%) to ciprofloxacin, 96 (42.8%) to cefepime, 92 (40.9%) to aztreonam, 76 (33.7%) to imipenem, and 41 (18.1%) to meropenem. According to these percentages, imipenem and meropenem were the most effective drugs. The imipenem-EDTA double-disk synergy test showed that 45 out of the 76 (59.2%) imipenem-resistant strains were MBL positive. The isolates were collected from different wards, including ICU (n = 22), urology (n = 2), emergency (n = 4), burn (n = 11), respiratory (n = 3), and surgery (n = 3).
Furthermore, our molecular studies showed that only the MBL-positive strains were positive in PCR. Moreover, 75% (n = 34) of the MBL-positive strains were detected to have blaIMP-1 and 2.2% blaVIM-2 (n = 1). blaIMP-1 was taken from burned tissue (n = 10, 29.4 %), respiratory tract (n = 10, 29.4 %), urine (n = 8, 23.5%), blood (n = 2, 5.8%), eye (n = 3, 8.8%), and vagina (n = 1, 2.9%). blaVIM-2 (n = 1) was recovered from burned tissue. Antibiogram showed that the strains resistant to imipenem possessed high-level resistance to gentamicin (100%), cefepime (94.7%), and ceftazidime (94.7%). Among the imipenem-resistant strains, 30.3% (n = 23) were resistant to meropenem and the rest (n = 53) were sensitive to it. On the other hand, there were 18 meropenem-resistant strains sensitive to both imipenem and cefepime.
5. Discussion
Microbial resistance has increased drastically in recent years in both developed and developing countries and it has rapidly become a leading public health concern. The prevalence of antimicrobial resistance varies greatly between and within countries and between different pathogens. Resistance to antibiotics among organisms is increased either by mutations or by acquiring new genetic material via horizontal gene transfer. Several factors favor the development of bacterial resistance to antibiotics in developing countries such as the less potent activity of the drugs, i.e. some of the antibiotics provided in developing countries have decreased potency due to the degradation or adulteration of the drug or because of the presence of a lower concentration of active substances, lack of well-equipped diagnostic laboratories, and excessive use of antimicrobials in domestic animals (8-10).
Antimicrobial agents suitable for use in pediatric clinics are mainly limited to β-lactam antibiotics, especially carbapenems. However, the problem of drug resistance to carbapenems is gradually worsening owing to their increasing clinical use. The present study analyzed the patterns of resistance to several antibiotics such as carbapenems. The results showed that 33.7% of the isolates were resistant to imipenem. In a previous study in the Iranian city of Kermanshah in 2004, Mohajeri et al. (25) reported a lower rate of resistance (10%). However, another investigation conducted in the Iranian city of Shiraz in 2012 reported that 127 (59.16%) of the 240 isolates were resistant to this antibiotic (18). The reported rates of resistance to imipenem in Japan, Russia, France, Canada, and Spain were 8.3%, 13.4%, 18.5%, 12%, and 14%, respectively (26-30). As was mentioned, numerous factors contribute to these variations. In addition, the increased rate of resistance to imipenem in Kermanshah is in line with the increase throughout the world. Resistance to carbapenems in P. aeruginosa may be due to MBLs, which hydrolyze all carbapenems (5-7). Since MBLs are placed in movable elements, they are horizontally transmitted between organisms easily (8-10, 31). Large outbreaks by MBL-producing P. aeruginosa strains have been described in hospitals in Italy, Greece, and Korea (32-37). IMP and VIM-producing P. aeruginosa strains have been reported worldwide (10, 38-42).
In our study, the majority of the MBL producers carried the blaIMP gene (75%); however, the presence of this gene has been previously proved to be variable in different regions (17, 18). In a previous report from the Iranian province of Markazi, 37% (40 out of 108) of the P. aeruginosa isolates obtained from the hospitalized patients were demonstrated to be resistant to imipenem. The EDTA/imipenem test showed that 50% of the imipenem-resistant strains were MBL positive, and PCR revealed that 50% of the imipenem-resistant strains had blaVIM-1, 56.6% blaVIM-2, and 6.6% blaIMP-1 (17). In another study in Iran, from 240 P. aeruginosa isolates mainly recovered from wound, urine, and sputum, 82 (34.16%) isolates were imipenem-resistant (minimum inhibitory concentration [MIC] ≥ 4 μg/mL). Among these imipenem-resistant isolates, 19 (23.3%) MBL-producing P. aeruginosa isolates were screened using the double-disk synergy test. A specific PCR test confirmed the presence of 8 (9.75%) and 10 (12.19%) IMP-1 and VIM-2 types, respectively (18). In contrast, Khosravi and Mihani (2008) reported that none of the 8 MBL-producing P. aeruginosa strains in their study were positive for the blaIMP gene (40).
The most and also the sole frequent reported MBL-producing P. aeruginosa in Iran is VIM-1, previously cited by several researchers in different cities of Iran (4, 17, 22, 40, 43, 44). Nonetheless, there are only a few investigations reporting the presence of the VIM-2 type of P. aeruginosa in Iran. For the first time in 2012, Sadeghi et al. (17) detected this genotype in the Iranian city of Arak. Subsequently, in 2013, among the 82 imipenem-resistant isolates tested for MBLs, 10 isolates were positive for this gene (18). According to our findings, it seems that the MBL-producing isolates of P. aeruginosa are the main cause of IPM resistance among this species. We suggest that molecular typing via standard methods such as pulsed-field gel electrophoresis be conducted to define the clonality of the isolates.
Acknowledgments
This study was conducted in the microbiology department of Kermanshah university of medical sciences. The authors are grateful to Dr. Najjar Pirayeh for providing the positive controls.
Footnotes
Authors’ Contributions:Ramin Abiri: study concept and design, interpretation of data and final revision of the manuscript; Pantea Mohammadi: research and technical advisor, drafting of the manuscript; Navid Shavani: contribution in all laboratory experiments; Mansour Rezaei: Statistical analysis.
Funding/Support:The financial costs of the study were provided by Kermanshah university of medical sciences.
References
- 1.Giamarellou H. Prescribing guidelines for severe Pseudomonas infections. J Antimicrob Chemother. 2002;49(2):229–33. doi: 10.1093/jac/49.2.229. [DOI] [PubMed] [Google Scholar]
- 2.Rello J, Jubert P, Valles J, Artigas A, Rue M, Niederman MS. Evaluation of outcome for intubated patients with pneumonia due to Pseudomonas aeruginosa. Clin Infect Dis. 1996;23(5):973–8. doi: 10.1093/clinids/23.5.973. [DOI] [PubMed] [Google Scholar]
- 3.Gales AC, Menezes LC, Silbert S, Sader HS. Dissemination in distinct Brazilian regions of an epidemic carbapenem-resistant Pseudomonas aeruginosa producing SPM metallo-beta-lactamase. J Antimicrob Chemother. 2003;52(4):699–702. doi: 10.1093/jac/dkg416. [DOI] [PubMed] [Google Scholar]
- 4.Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol. 2010;33(3):243–8. [PubMed] [Google Scholar]
- 5.Kohler T, Michea-Hamzehpour M, Epp SF, Pechere JC. Carbapenem activities against Pseudomonas aeruginosa: respective contributions of OprD and efflux systems. Antimicrob Agents Chemother. 1999;43(2):424–7. doi: 10.1128/aac.43.2.424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Livermore DM. Interplay of impermeability and chromosomal beta-lactamase activity in imipenem-resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1992;36(9):2046–8. doi: 10.1128/aac.36.9.2046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Nordmann P, Poirel L. Emerging carbapenemases in Gram-negative aerobes. Clin Microbiol Infect. 2002;8(6):321–31. doi: 10.1046/j.1469-0691.2002.00401.x. [DOI] [PubMed] [Google Scholar]
- 8.Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005;18(2):306–25. doi: 10.1128/CMR.18.2.306-325.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Pitout JD, Revathi G, Chow BL, Kabera B, Kariuki S, Nordmann P, et al. Metallo-beta-lactamase-producing Pseudomonas aeruginosa isolated from a large tertiary centre in Kenya. Clin Microbiol Infect. 2008;14(8):755–9. doi: 10.1111/j.1469-0691.2008.02030.x. [DOI] [PubMed] [Google Scholar]
- 10.Garza-Ramos U, Morfin-Otero R, Sader HS, Jones RN, Hernandez E, Rodriguez-Noriega E, et al. Metallo-beta-lactamase gene bla(IMP-15) in a class 1 integron, In95, from Pseudomonas aeruginosa clinical isolates from a hospital in Mexico. Antimicrob Agents Chemother. 2008;52(8):2943–6. doi: 10.1128/AAC.00679-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mendes RE, Castanheira M, Pignatari ACC, Gales AC. Metalo-beta-lactamases. Jornal Brasileiro de Patologia e Medicina Laboratorial. 2006;42(2):103–13. doi: 10.1590/s1676-24442006000200007. [DOI] [Google Scholar]
- 12.Iseri L, Bayraktar MR. Changes in the rates of antimicrobial resistance among clinical isolates of Pseudomonas aeruginosa between 2002 and 2004 in a tertiary-care teaching hospital in Turkey. New Microbiol. 2008;31(3):351–5. [PubMed] [Google Scholar]
- 13.Picao RC, Poirel L, Gales AC, Nordmann P. Diversity of beta-lactamases produced by ceftazidime-resistant Pseudomonas aeruginosa isolates causing bloodstream infections in Brazil. Antimicrob Agents Chemother. 2009;53(9):3908–13. doi: 10.1128/AAC.00453-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Peymani A, Nahaei MR, Farajnia S, Hasani A, Mirsalehian A, Sohrabi N, et al. High prevalence of metallo-beta-lactamase-producing acinetobacter baumannii in a teaching hospital in Tabriz, Iran. Jpn J Infect Dis. 2011;64(1):69–71. [PubMed] [Google Scholar]
- 15.Shahcheraghi F, Feizabadi MM, Yamin V, Abiri R, Abedian Z. Serovar determination, drug resistance patterns and plasmid profiles of Pseudomonas aeruginosa isolated from burn patients at two hospitals of Tehran (IRAN). Burns. 2003;29(6):547–51. doi: 10.1016/s0305-4179(03)00142-6. [DOI] [PubMed] [Google Scholar]
- 16.Shahcheraghi F, Nikbin VS, Feizabadi MM. Prevalence of ESBLs genes among multidrug-resistant isolates of Pseudomonas aeruginosa isolated from patients in Tehran. Microb Drug Resist. 2009;15(1):37–9. doi: 10.1089/mdr.2009.0880. [DOI] [PubMed] [Google Scholar]
- 17.Sadeghi A, Rahimi B, Shojapour M. Molecular detection of metallo-β-lactamase genes blaVIM-1, blaVIM-2, blaIMP-1, blaIMP-2 and blaSPM-1 in Pseudomonas aeruginosa isolated from hospitalized patients in Markazi province by Duplex-PCR. Afr J Microbiol Res. 2012;6(12):2965–9. [Google Scholar]
- 18.Sarhangi M, Motamedifar M, Sarvari J. Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran. Jundishapur J Microbiol. 2013;6(7):e22582 [Google Scholar]
- 19.Mahon C, Lehman D, Manuselis G. Text book of Diagnostic Microbiology. 4 ed. Maryland Heights (MO): Saunders Elsevier; 2011. [Google Scholar]
- 20.Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother. 1995;39(6):1211–33. doi: 10.1128/aac.39.6.1211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. New York: Cold spring harbor laboratory press; 1989. [Google Scholar]
- 22.Shahcheraghi F, Nikbin VS, Shooraj F, Shafiei M. Investigation of blaIMP-1, blaVIM-1 and blaSPM-1 MBL genes among clinical strains of Pseudomonas aeruginosa isolated from Imam Khomeini Hospital, Tehran, Iran. Pejouhandeh. 2009;14(2):Pe67–72. [Google Scholar]
- 23.Fazeli H, Sadighian H, Esfahani BN, Pourmand MR. Identification of class-1 integron and various β-lactamase classes among clinical isolates of Pseudomonas aeruginosa at children's medical center hospital. J Med Bacteriol. 2013;1(3, 4):25–36. [Google Scholar]
- 24.Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, et al. PCR typing of genetic determinants for metallo-beta-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol. 2003;41(12):5407–13. doi: 10.1128/JCM.41.12.5407-5413.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mohajeri P. Antibiotic susceptibility and resistance patterns of pseudomonas aeruginosa strains isolated from different clinical specimens in patients referred to the teaching hospitals in Kermanshah (2001-2). J Kermanshah Univ Med Sci. 2004;7(4):11–20. [Google Scholar]
- 26.Bouza E, Garcia-Garrote F, Cercenado E, Marin M, Diaz MS. Pseudomonas aeruginosa: a survey of resistance in 136 hospitals in Spain. The Spanish Pseudomonas aeruginosa Study Group. Antimicrob Agents Chemother. 1999;43(4):981–2. doi: 10.1128/aac.43.4.981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Rio Y, Pina P, Jurin F, Allouch P, Didion J, Chardon H, et al. [Susceptibility of Pseudomonas aeruginosa to antibiotics isolated from patients of intensive care units in France in 1998. Resistant phenotypes to beta-lactams]. Pathol Biol (Paris). 2002;50(1):12–7. doi: 10.1016/s0369-8114(01)00261-9. [DOI] [PubMed] [Google Scholar]
- 28.Karakoc B, Gerceker AA. In-vitro activities of various antibiotics, alone and in combination with amikacin against Pseudomonas aeruginosa. Int J Antimicrob Agents. 2001;18(6):567–70. doi: 10.1016/s0924-8579(01)00458-7. [DOI] [PubMed] [Google Scholar]
- 29.Sivolodskii EP. [Antibiotics sensitivity and characteristics of the esculin-positive Pseudomonas aeruginosa biovar]. Antibiot Khimioter. 2000;45(8):17–20. [PubMed] [Google Scholar]
- 30.Niitsuma K, Saitoh M, Kojimabara M, Kashiwabara N, Aoki T, Tomizawa M, et al. [Antimicrobial susceptibility of Pseudomonas aeruginosa isolated in Fukushima Prefecture]. Jpn J Antibiot. 2001;54(2):79–87. [PubMed] [Google Scholar]
- 31.Ryoo NH, Ha JS, Jeon DS, Kim JR. Prevalence of Metallo-β-lactamases in Imipenem-non-susceptiblePseudomonas aeruginosaandAcinetobacter baumannii. Korean J Clinic Microbiol. 2010;13(4):169. doi: 10.5145/kjcm.2010.13.4.169. [DOI] [Google Scholar]
- 32.Hsueh PR, Teng LJ, Yang PC, Chen YC, Ho SW, Luh KT. Persistence of a multidrug-resistant Pseudomonas aeruginosa clone in an intensive care burn unit. J Clin Microbiol. 1998;36(5):1347–51. doi: 10.1128/jcm.36.5.1347-1351.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Cornaglia G, Riccio ML, Mazzariol A, Lauretti L, Fontana R, Rossolini GM. Appearance of IMP-1 metallo-beta-lactamase in Europe. Lancet. 1999;353(9156):899–900. doi: 10.1016/s0140-6736(98)05954-6. [DOI] [PubMed] [Google Scholar]
- 34.Hirakata Y, Yamaguchi T, Nakano M, Izumikawa K, Mine M, Aoki S, et al. Clinical and bacteriological characteristics of IMP-type metallo-beta-lactamase-producing Pseudomonas aeruginosa. Clin Infect Dis. 2003;37(1):26–32. doi: 10.1086/375594. [DOI] [PubMed] [Google Scholar]
- 35.Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. bla(VIM-2) cassette-containing novel integrons in metallo-beta-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother. 2002;46(4):1053–8. doi: 10.1128/AAC.46.4.1053-1058.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mavroidi A, Tsakris A, Tzelepi E, Pournaras S, Loukova V, Tzouvelekis LS. Carbapenem-hydrolysing VIM-2 metallo- beta-lactamase in Pseudomonas aeruginosa from Greece. J Antimicrob Chemother. 2000;46(6):1041–2. doi: 10.1093/jac/46.6.1041. [DOI] [PubMed] [Google Scholar]
- 37.Senda K, Arakawa Y, Nakashima K, Ito H, Ichiyama S, Shimokata K, et al. Multifocal outbreaks of metallo-ß-lactamase- producing Pseudomonas aeruginosa resistant to broad-spectrum -lactams, including carbapenems. Antimicrob Agents Chemother. 1996;40:349–53. doi: 10.1128/aac.40.2.349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Dong F, Xu XW, Song WQ, Lu P, Yu SJ, Yang YH, et al. Characterization of multidrug-resistant and metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from a paediatric clinic in China. Chin Med J (Engl). 2008;121(17):1611–6. [PubMed] [Google Scholar]
- 39.Yatsuyanagi J, Saito S, Harata S, Suzuki N, Ito Y, Amano K, et al. Class 1 integron containing metallo-beta-lactamase gene blaVIM-2 in Pseudomonas aeruginosa clinical strains isolated in Japan. Antimicrob Agents Chemother. 2004;48(2):626–8. doi: 10.1128/AAC.48.2.626-628.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Khosravi AD, Mihani F. Detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagn Microbiol Infect Dis. 2008;60(1):125–8. doi: 10.1016/j.diagmicrobio.2007.08.003. [DOI] [PubMed] [Google Scholar]
- 41.Corvec S, Poirel L, Espaze E, Giraudeau C, Drugeon H, Nordmann P. Long-term evolution of a nosocomial outbreak of Pseudomonas aeruginosa producing VIM-2 metallo-enzyme. J Hosp Infect. 2008;68(1):73–82. doi: 10.1016/j.jhin.2007.10.016. [DOI] [PubMed] [Google Scholar]
- 42.Perez IA, Garcia CP, Poggi MH, Braun JS, Castillo VC, Roman JC, et al. [Presence of metallo beta-lactamases in imipenem-resistant Pseudomonas aeruginosa]. Rev Med Chil. 2008;136(4):423–32. [PubMed] [Google Scholar]
- 43.Saderi H, Lotfalipour H, Owlia P, Salimi H. Detection of Metallo- -Lactamase Producing Pseudomonas aeruginosa Isolated From Burn Patients in Tehran, Iran. Lab Med. 2010;41(10):609–12. doi: 10.1309/lmqjf9j3t2oaacdj. [DOI] [Google Scholar]
- 44.Bahar MA, Jamali S, Samadikuchaksaraei A. Imipenem-resistant Pseudomonas aeruginosa strains carry metallo-beta-lactamase gene bla(VIM) in a level I Iranian burn hospital. Burns. 2010;36(6):826–30. doi: 10.1016/j.burns.2009.10.011. [DOI] [PubMed] [Google Scholar]
