Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2015 Oct 16;53(11):3614–3617. doi: 10.1128/JCM.01736-15

Identification of a Bovine Enteric Calicivirus, Kırklareli Virus, Distantly Related to Neboviruses, in Calves with Enteritis in Turkey

Feray Alkan a, İlke Karayel a, Cristiana Catella b, Livia Bodnar b, Gianvito Lanave b, Krisztián Bányai c, Barbara Di Martino d, Nicola Decaro b, Canio Buonavoglia b,e,*, Vito Martella b,✉
Editor: M J Loeffelholz
PMCID: PMC4609679  PMID: 26292294

Abstract

A calicivirus was detected in neonatal calves with enteritis in Kırklareli, Thrace, Turkey. In the full-length genome, Kırklareli virus was related (48% nucleotide identity) to bovine enteric caliciviruses (Nebovirus genus). The virus was also detected in a herd in Ankara, Central Anatolia, but not in other Turkish prefectures.

TEXT

Caliciviruses (family Caliciviridae) are important pathogens of humans and animals. Caliciviruses are nonenveloped, small round viruses with a single-strand positive-sense RNA genome of 7 to 8.5 kb in size, polyadenylated at the 3′ end (1). The family includes the genera Vesivirus, Norovirus, Sapovirus, Lagovirus, and Nebovirus. In recent years, novel, yet unclassified caliciviruses have been identified in mammals, birds, and fishes (2).

Caliciviruses of at least three distinct genera (Nebovirus, Norovirus, and Vesivirus) have been detected in cattle. However, on the basis of either experimental infections or observational studies, only neboviruses and noroviruses have been associated with enteric replication and with enteric signs (3, 4).

In early 2012, an outbreak of enteritis occurred in Kırklareli, Thrace, Turkey. The herd consisted of 250 cows and 200 calves, with enteric disease affecting about 60% of the calves, resulting in 30% mortality. A total of 17 fecal samples, collected from the affected calves, were tested and found to be positive for either species A rotavirus or coronavirus. All animals also tested positive for Cryptosporidium spp. Interestingly, upon electron microscopy observation, small round viruses (SRVs) could be observed in 3 stool samples. Using reverse transcription (RT)-PCR with consensus primers (5) and the sequence analysis of a short (330-nucleotide [nt]) fragment of the RNA-dependent RNA polymerase (RdRp), the SRVs were characterized as caliciviruses, with limited homology (<65% nt identity), to the prototype strain Nebraska (Nebovirus genus) (6). By combining RT-PCRs with a primer walking strategy, 5′ and 3′ RACE (rapid amplification of cDNA ends) protocols and next-generation sequencing, the complete genome of the calicivirus, named Kırklareli virus, was determined (GenBank accession no. KT119483). The genome was 7,484 nt long, excluding the poly(A) tail, with a ribonucleoside composition of 20.4% A, 30.9% C, 27.5% G, and 21.2% U. The 5′ untranslated region (UTR) was 67 nt long, while the 3′ UTR was 80 nt long. Two open reading frames (ORFs), of 6,581 nt (ORF1) and 657 nt (ORF2) in length, were mapped. ORF1 encoded a large polyprotein of 2,226 amino acids (aa) in length, containing the replicative proteins and, at the 3′ end, the 1,629 nt-long (542 aa) capsid region, with a potential cleavage site, EGD, between the nonstructural proteins and the capsid protein. ORF2 encoded a 218-aa long protein (Fig. 1). Conserved amino acid motifs characteristic of caliciviruses, including the 2C-like helicase-nucleoside triphosphatase DNA-binding (GXXGXGKS/T) and the ATP hydrolysis (KXXXFXSXXXXXS/TTN) motifs, the 3D pol (GLPSG and YGDD) motifs and the VP1 capsid (PPG) motifs, were present in the ORF1 polyprotein. In the 3C-like protease of Kırklareli virus, cytosine (C) replaced aspartic acid (D) in the GDDG motif, which is conserved in caliciviruses. By sequence comparison of the full-length genome, the highest nucleotide identity was to neboviruses (48%), followed by lagoviruses (38%), while the lowest nucleotide identity (25%) was to recoviruses and to Atlantic salmon caliciviruses. In the ORF1, the highest identity (51% nt and 42% aa) was to neboviruses, while identity to other caliciviruses was lower than 39% nt and 23% aa. In the capsid precursor coding region of ORF1, Kırklareli virus displayed 44% nt identity (41% aa) to neboviruses and less than 36% nt (21% aa) to other caliciviruses. In the ORF2, the highest identity (39% nt and 27% aa) was to neboviruses (Table 1). Upon phylogenetic analysis, the virus clustered closest to the Nebovirus taxon (Fig. 2).

FIG 1.

FIG 1

Genome comparison of Kırklareli virus with prototypes of the Nebovirus genus, strains Nebraska (NB) (AY082891) and Newbury-1 (DQ013304). Arrows indicate the putative start codon of the capsid region and the position of the ORF1/ORF2 junction. Arrows are also used to indicate the putative cleavage sites on the ORF1-encoded polyprotein.

TABLE 1.

Sequence identities between Kırklareli virus and other caliciviruses in the genome and in the RdRp and capsid regiona

Species (GenBank accession no.) Genus Sequence identity (%) for:
Genome
RdRp
Capsid
nt nt aa nt aa
Bo/NB (AY082891) Nebovirus 48 59 59 44 41
Le/EBHSV (NC002615) Lagovirus 38 46 38 36 21
Go/strain N (KJ473715) Nacovirusb 32 43 36 33 20
Ch/V0021/Bayern/2004 (HQ010042) 30 42 36 32 21
Hu/Manchester (X86560) Sapovirus 32 44 39 36 21
Fe/FCV/CFI/68 (U13992) Vesivirus 32 44 37 34 21
Hu/Norwalk (NC001959) Norovirus 28 39 34 29 15
Si/Tulane (EU391643) Recovirusb 25 38 28 28 13
Po/St-Valerien (AB863586) Valovirusb 27 37 28 31 15
ASC Nordland/2011 (KJ577139) Salmonid CVb 25 36 25 30 15
a

Distance values were calculated after alignment with ClustalW, without distance correction.

b

Candidate genera.

FIG 2.

FIG 2

Phylogenetic tree based on the whole genome of representatives of the various established and proposed calicivirus genera. The tree was generated using the neighbor joining method, with the Jukes Cantor algorithm of distance correction, with bootstrapping over 1,000 replicates. Fe, feline; Ca, canine; Po, porcine; Bo, bovine; Le, lapine; Hu, human; Ch, chicken; Go, goose; Tu, turkey; Si, simian; Mu, murine; ASC, Atlantic salmon calicivirus. The scale bar indicates the number of substitution per site.

The genetic diversity between Kırklareli virus and other bovine caliciviruses (neboviruses) appeared within the ranges observed among members of the same genus (7, 8); therefore, Kırklareli virus could represent an ancestor of the Nebovirus genus. Although neboviruses are relatively highly conserved and segregate into two major clades, Nebraska-like or Newbury-1-like, genetic heterogeneity due to recombination (9) or genetic drift (10) has also been reported. However, it is interesting to highlight that the Kırklareli virus differed in its genome organization from neboviruses. There was a 1-nt overlap between ORF1 and ORF2, while members of the Nebovirus genus have a 1-nt interval between the two ORFs. ORF1 was 48 nt (16 aa) longer, while ORF2 was 21 nt (7 aa) shorter. Also, the 5′ UTR was shorter (67 versus 74/75 nt), and the 3′ UTR was longer (80 versus 67 nt) than in neboviruses (Fig. 2).

Using specific primers designed for the capsid-coding region (primer CapFor, CCACCATTATCACCAAATTGC, and primer CapRev, CATAATCAGAATAGAAGGCGC), fecal samples obtained from calves of the Kırklareli enteritis outbreak were rescreened, identifying Kırklareli virus RNA in 5 of 17 (29.4%) calves. In addition, an archival collection of samples available in our laboratory was screened. This collection included an additional 33 calves with enteritis from 28 herds located in 3 Turkish prefectures. Kırklareli virus RNA was only detected in 1 additional herd in the Ankara region (Table 2). If this can be accounted for by nucleotide polymorphisms in the primer binding sites or if it reflects a limited/diverse geographical distribution remains to be assessed. It is important from this perspective to underline that, although Kırklareli virus is genetically related to neboviruses, oligonucleotides specific for neboviruses available in the literature (11, 12) failed to recognize Kırklareli virus RNA in RT-PCR. Upon alignment with the Kırklareli virus genome, we observed several nucleotide mismatches in the primer binding regions that likely prevented correct annealing.

TABLE 2.

Screening for Kırklareli calicivirus in diarrheal calves in Turkey prefectures

Prefecture City No. of positive herds/total no. (% positive) No. of positive samples/total no. (% positive)
Thrace Kırklareli 1/1 (100) 5/17 (29.4)
Anatolia Ankara 1/5 (20.0) 1/6 (16.6)
Marmara Bursa 0/17 0/21
Aegen İzmir 0/6 0/6
Total 2/29 (6.8) 6/50 (12.0)

Attempts were made to cultivate the virus in bovine cells lines, e.g., MDBK and PEB, but the virus failed to replicate in vitro, as observed by monitoring the onset of cytopathic effect in serial passages and viral replication by RT-PCR. Failure to propagate the virus in vitro was not unexpected, as neboviruses and other enteric caliciviruses are not cultivatable, with the exceptions of the porcine sapovirus strain Cowden (13) and of murine noroviruses (14).

Livestock constitutes a large part of agricultural production in Turkey and contributes to the economic development of rural households, with several farmers relying on livestock for their incomes. In this study, we identified a bovine calicivirus, distantly related to other bovine enteric caliciviruses, e.g., neboviruses, with a distinctive genome organization. Experimental infection with the nebovirus prototypes, strains Newbury-1 and Nebraska, causes anorexia, diarrhea, and xylose malabsorption in gnotobiotic calves, with damage restricted to the anterior half of the small intestine (4, 6, 15), suggesting that neboviruses are able to cause enteric disease in calves. If Kırklareli virus also retains these pathogenic properties should be demonstrated by experimental infections. In addition, information on the epidemiological features of Kırklareli-like caliciviruses should be gathered in larger, structured epidemiological studies in order to assess the relevance of this enteric virus in bovines.

Nucleotide sequence accession number.

The new sequence for the Kırklareli virus genome has been deposited in GenBank under accession no. KT119483.

ACKNOWLEDGMENT

K.B. was supported by the Momentum Program of the Hungarian Academy of Sciences.

REFERENCES

  • 1.Green KY. 2013. Caliciviridae: the noroviruses, p 583–609. In Knipe DM, Howley PM (ed), Fields virology, 6th, (ed) Lippincott Williams & Wilkins, Philadelphia PA. [Google Scholar]
  • 2.Clarke IN, Estes MK, Green KY, Hansman GS, Knowles NJ, Koopmans MK, Matson DO, Meyers G, Neill JD, Radford A, Smith AW, Studdert MJ, Thiel H-J, Vinjé J. 2012. Caliciviridae, p 977–986. In King AW, Adams MJ, Carstens EB, Lefkowitz EJ (ed), Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses, Elsevier, Oxford, United Kingdom. [Google Scholar]
  • 3.Otto PH, Clarke IN, Lambden PR, Salim O, Reetz J, Liebler-Tenorio EM. 2011. Infection of calves with bovine norovirus GIII.1 strain Jena virus: an experimental model to study the pathogenesis of norovirus infection. J Virol 85:12013–12021. doi: 10.1128/JVI.05342-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hall GA, Bridger JC, Brooker BE, Parsons KR, Ormerod E. 1984. Lesions of gnotobiotic calves experimentally infected with a calicivirus-like (Newbury) agent. Vet Pathol 21:208–215. [DOI] [PubMed] [Google Scholar]
  • 5.Jiang X, Huang PW, Zhong WM, Farkas T, Cubitt DW, Matson DO. 1999. Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT-PCR. J Virol Methods 83:145–154. doi: 10.1016/S0166-0934(99)00114-7. [DOI] [PubMed] [Google Scholar]
  • 6.Smiley JR, Chang KO, Hayes J, Vinjé J, Saif LJ. 2002. Characterization of an enteropathogenic bovine calicivirus representing a potentially new calicivirus genus. J Virol 76:10089–10098. doi: 10.1128/JVI.76.20.10089-10098.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pinto P, Wang Q, Chen N, Dubovi EJ, Daniels JB, Millward LM, Buonavoglia C, Martella V, Saif LJ. 2012. Discovery and genomic characterization of noroviruses from a gastroenteritis outbreak in domestic cats in the US. PLoS One 7:e32739. doi: 10.1371/journal.pone.0032739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Oka T, Wang Q, Katayama K, Saif LJ. 2015. Comprehensive review of human sapoviruses. Clin Microbiol Rev 28:32–53. doi: 10.1128/CMR.00011-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Di Martino B, Di Profio F, Martella V, Ceci C, Marsilio F. 2011. Evidence for recombination in neboviruses. Vet Microbiol 153:367–372. doi: 10.1016/j.vetmic.2011.05.034. [DOI] [PubMed] [Google Scholar]
  • 10.Kaplon J, Guenau E, Asdrubal P, Pothier P, Ambert-Balay K. 2011. Possible novel nebovirus genotype in cattle, France. Emerg Infect Dis 17:1120–1123. doi: 10.3201/eid/1706.100038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Smiley JR, Hoet AE, Tråvén M, Tsunemitsu H, Saif LJ. 2003. Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J Clin Microbiol 41:3089–3099. doi: 10.1128/JCM.41.7.3089-3099.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Park S-I, Jeong C, Park S-J, Kim H-H, Jeong Y-J, Hyun B-H, Chun Y-H, Kang M-I, Cho K-O. 2008. Molecular detection and characterization of unclassified bovine enteric caliciviruses in South Korea. Vet Microbiol 130:371–379. doi: 10.1016/j.vetmic.2008.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Flynn WT, Saif LJ. 1988. Serial propagation of porcine enteric calicivirus-like virus in primary porcine kidney cell cultures. J Clin Microbiol 26:206–212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Karst SM, Wobus CE, Lay M, Davidson J, Virgin HW. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575–1578. doi: 10.1126/science.1077905. [DOI] [PubMed] [Google Scholar]
  • 15.Bridger JC, Hall GA, Brown JF. 1984. Characterization of a calici-like virus (Newbury agent) found in association with astrovirus in bovine diarrhea. Infect Immun 43:133–138. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES