Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2015 Oct 12;3(10):apps.1500053. doi: 10.3732/apps.1500053

Characterization and transferability of microsatellite markers developed for Carpinus betulus (Betulaceae)1

Kathleen Prinz 2,3,4, Reiner Finkeldey 3
PMCID: PMC4610309  PMID: 26504678

Abstract

Premise of the study:

Carpinus betulus (Betulaceae) is an octoploid, ecologically important, common tree species in European woodlands. We established 11 nuclear microsatellite loci allowing for detailed analyses of genetic diversity and structure.

Methods and Results:

A microsatellite-enriched library was used to develop primers for 11 microsatellite loci that revealed high allele numbers and genetic diversity in a preliminary study.

Conclusions:

All of the loci developed here are informative for C. betulus. In addition, the loci are transferable to several species within the genus, and almost all loci cross-amplified in species of different genera of the Betulaceae.

Keywords: Betulaceae, Carpinus betulus, cross-amplification, microsatellite loci, polyploidy


The European hornbeam, Carpinus betulus L. (Betulaceae), is a common, late-successional, shade-tolerant tree often forming bushes and hedges. These edge communities between forest and pasture are highly valued for conservation due to their biodiversity. In addition, they provide refugia for plants and animals and connect biotopes. Carpinus betulus is also often used as an ornamental planting in gardens and nonforested landscapes.

Genetic analyses in C. betulus are scarce; they were based on universal chloroplast markers (Grivet and Petit, 2003) or anonymous amplified fragment length polymorphisms (AFLPs; Coart et al., 2005). Microsatellite markers were established for several species within the family (e.g., Barbará et al., 2007; Gürcan and Mehlenbacher, 2010), but not for C. betulus.

The species is octoploid and thus complex fragment patterns are expected using codominant microsatellite markers. Recent advances in statistical methods and new software allow for analysis of genetic diversity even in polyploid species (e.g., Wiehle et al., 2014).

METHODS AND RESULTS

Genomic DNA was extracted from young leaves of an adult tree of C. betulus growing in Göttingen, Germany (Appendix 1), using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). A microsatellite-enriched library was generated based on the protocol of Fischer and Bachmann (1998) with some modifications (Prinz et al., 2009). We used biotinylated oligonucleotides with the motif of (GA)10 for hybridization at 60°C. All steps of the enrichment procedure were repeated once. Final PCR products were purified and ligated into the pCR 2.1-TOPO vector (Invitrogen, Carlsbad, California, USA). The vectors were transformed chemically to One Shot TOP10 Competent cells (Invitrogen). Ninety-six positive clones were sequenced forward and reverse in an ABI Prism 3100 automatic sequencer (Applied Biosystems, Foster City, California, USA), and 44 sequences were suitable for primer design. The remaining fragments showed low quality, short sizes of the flanking regions, or were identified as duplicates. A total of 35 primers were designed applying Primer3 version 2.2.3 (Rozen and Skaletsky, 1999) and tested for amplification. PCR assays were conducted in a final volume of 15 μL containing approximately 10 ng of genomic DNA, 1× Hot Start Buffer (0.8 M Tris-HCl [pH 9.0], 0.2 M (NH4)2SO4, 0.2% w/v Tween-20; Solis BioDyne, Tartu, Estonia), 2.5 mM MgCl2, 0.2 mM of each dNTP, 0.1 unit Hot Start DNA Polymerase (5 U/μL HOT FIREPol; Solis BioDyne), and 0.3 pmol of each primer. Forward primers of each pair were labeled with a fluorescent tag. PCR was performed applying a touchdown program adapted to the annealing temperatures (Ta) of each primer provided by Primer3 version 2.2.3 (Rozen and Skaletsky, 1999) and producers. The general protocol contained cycles of 1 min at 94°C, 1 min at Ta + 3–5°C to Ta − 3–5°C reducing the temperature at 1°C in each cycle, 1 min at 72°C, followed by 25 cycles at the final annealing temperature without further touchdown. PCR products were checked for quality and approximate lengths of the fragments. Nineteen primer pairs revealed unambiguously observable fragments in an expected size range. A test for variability was performed in 25 individuals of C. betulus sampled in Germany and Romania as well as in 13 individuals of several species of the Betulaceae (Appendix 1). After amplification, fragments were separated in an ABI Prism 3100 automatic sequencer (Applied Biosystems), and fragment sizes were scored using GeneScan 3.7 analysis software based on the internal standard GeneScan 500 ROX (Applied Biosystems).

Eleven out of 19 loci revealed unambiguously scorable patterns that were polymorphic among samples of C. betulus (Table 1). Eight loci revealed ambiguous and nonvaluable patterns (Appendix 2). The 11 informative loci were resequenced for some samples to verify the specific amplification products. In total, 252 alleles were detected ranging from 15 to 30 per locus (Table 2). Three to six alleles per locus were most frequently observed in each individual polyploid plant. Lower average numbers of alleles for individual plants were observed only at locus Cb_33, but they were not fixed. Thus, genetic diversity is high, ranging from 0.199 to 0.320, calculated from a converted binary data matrix in which present alleles are represented by “1” and absent alleles by “0” (e.g., Sampson and Byrne, 2012).

Table 1.

Characterization of microsatellite loci developed for Carpinus betulus.

Locus Primer sequences (5′–3′) Repeat motifa Allele size range (bp) Ta (°C)b GenBank accession no.
Cb_12b F: CATAATTAGCATCTCCCCACCT (CT)x 97–137 TD 68–58 KP844902
R: AATGCGGCGAAGACACAT
Cb_15b F: CCTCCATTCACGAACCAATC (CT)x 63–115 TD 68–58 KP844903
R: GCCTCTGCATGTTGTGTGAG
Cb_17 F: GCAGGCGGATATGTTTGTG (GA)x 56–100 61 KP844904
R: CGGCGAAGACACATTGAG
Cb_27 F: CTTCACGGCCTCACTGAAAC (GA)x 77–150 64 KP844905
R: CATCGATCATCCCAGTCCTT
Cb_29 F: CTTCGACACAACCTCCCAAC (GA)x 55–95 61 KP844906
R: ATTGCCAATGGACCTTTCTC
Cb_33 F: GACAGTCTAGAGGCTGTACAAGAA (GA)xNx(GA)x 128–172 TD 66–54 KP844907
R: TGGAACAAAATTATGAGAAATTGA
Cb_35 F: TGCGTGTTGGTTTTGTCC (GA)x 77–144 TD 68–60 KP844908
R: TGCAATTAAGGTATGATTGATCG
Cb_37a F: GAAGGTTGTAGCCAGCCTAA (GA)x 70–136 TD 68–58 KP844909
R: ATCTTAAGAGAAAGCGAAACCCTA
Cb_43 F: ACATTGAGTGATCCATACGAGA (GA)x 81–138 TD 66–54 KP844910
R: TCCATTTGCATATGTGTGCTC
Cb_48a F: CAAGAATAAGCTAGAAAGAGAGAAGC (GA)x 130–188 TD 66–57 KP844911
R: TGAAGGTAGACTTTGATGGAACA
Cb_49a F: AATCAGCGATTCTGCCAAAG (GA)xNx(GAG)x 143–182 TD 68–58 KP844912
R: CGTCGTCCTCAGCTGCAC

Note: Ta = annealing temperature.

a

Nx signifies a microsatellite motif interrupted by an ongoing DNA sequence of different lengths.

b

A touchdown (TD) protocol was applied. Annealing starts at the highest temperature and decreases at 1°C in each PCR cycle.

Table 2.

Species-specific genetic diversity of microsatellite loci among 25 Carpinus betulus individuals represented by number of alleles, number of rare alleles (<10%), and unbiased genetic diversity (GenAlEx version 6.4; Peakall and Smouse, 2006).

Locus A No. rare alleles Genetic diversitya
Cb_12b 26 16 0.224
Cb_15b 20 8 0.271
Cb_17 15 5 0.283
Cb_27 30 11 0.278
Cb_29 20 11 0.226
Cb_33 20 13 0.199
Cb_35 29 17 0.200
Cb_37a 27 11 0.263
Cb_43 26 13 0.248
Cb_48a 18 9 0.248
Cb_49a 21 6 0.320

Note: A = number of alleles.

a

The parameter replaces the expected heterozygosity in the polyploid species.

Cross-amplification was successful for almost all loci (Table 3). Thus, six loci amplified in all Carpinus species, and one additional locus was successfully applied in seven out of eight Carpinus samples. The reduced number of transferred loci is likely caused by species-specific taxonomic relationships to the species of origin. Successful cross-amplification among species of different Betulaceae genera was observed for three loci amplified in all individuals and two additional loci amplified in four out of five species. Most alleles were shared with C. betulus, whereas two loci showed more than 50% additional alleles (Table 3). Reduced genetic diversity of transferred loci can be explained by low sample size, the general observation of reduced amplification success and genetic diversity after cross-amplification (e.g., Selkoe and Toonen, 2006; Barbará et al., 2007), and finally by differing ploidy levels, which are not known for all species.

Table 3.

Number of alleles per microsatellite locus resulting from cross-amplification of loci developed for Carpinus betulus and observed in single plants of related species.

Species Cb_12b Cb_15b Cb_17 Cb_27 Cb_29 Cb_33 Cb_35 Cb_37a Cb_43 Cb_48a Cb_49a
Carpinus caroliniana 4 2 1 2 1 2 2 2 2
C. caucasica 3 5 3 5 3 2 4 7 8 1 5
C. koreana 3 1 2 1 3 2 2
C. orientalis 2 1 1 1 1 1 2 1 2
C. turczaninovii_1 3 1 3 3 2 2 2 2
C. turczaninovii_2 4 1 2 1 7 4 3 4
C. turczaninovii_3 2 1 2 1 2 2 2
C. viminea 5 1 2 2 1 2 1 1 2 2 2
Alnus glutinosa 5 3 1 1
Betula pendula 4 3 1 4
Corylus avellana 2 4 7 1 2 1
Ostrya carpinifolia 5 2 3 2 1 2 2 2 3
Ostrya virginiana 3 5 3 2 2 2 1 2
Private for C. betulus 15 13 9 17 13 12 23 16 13 13 11
Absence in C. betulus 3 5 3 9 1 3 4 8 4

Note: — = no cross-amplification.

CONCLUSIONS

In this study, we developed microsatellite markers for C. betulus despite complex fragment patterns resulting from the octoploid nature of the species. We also tested their transferability to other species within Carpinus and other genera of the Betulaceae with ploidy levels that differ and are not known for all species. Highly polymorphic and codominant microsatellite markers allow for detailed analyses of genetic diversity and structure, i.e., gene flow within and among species.

Appendix 1.

Origin and voucher information for all samples included in the establishment of newly developed microsatellite markers for Carpinus betulus.

Species Collection locality Collector Voucher/Plant ID Herbariuma
Carpinus betulus L.b Göttingen-Geismar, Germany Prinz, Müller KP_Cb0002 GOET
Carpinus betulus Göttingen, Germany Prinz, Müller, Dolynska KP_Cb0001, 0003, 0004, 0020, 0022 n.a.
Carpinus betulus Eschwege, Germany Dolynska KP_Cb0021 n.a.
Carpinus betulus Kleve, Germany Prinz KP_Cb0023–0025 n.a.
Carpinus betulus Brasov, Romania Finkeldey KP_Cb0005–0014 n.a.
Carpinus betulus Valley of the beeches, Romania Finkeldey KP_Cb0015–0019 n.a.
Carpinus caroliniana Walter Forest Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0040 GOET
Carpinus caucasica Grossh. Forest Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0029 GOET
Carpinus koreana Nakai Experimental Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0041 GOET
Carpinus orientalis Mill. Greece Vidalis KP_Cb0039 n.a.
Carpinus turczaninovii Hance Experimental Botanical Garden, Göttingen, Germanyc Prinz, Müller KP_Cb0043–0045 GOET
Carpinus viminea Lindl. Experimental Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0042 GOET
Alnus glutinosa (L.) Gaertn. Forest Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0032 GOET
Betula pendula Roth Forest Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0036 GOET
Corylus avellana L. Forest Botanical Garden, Göttingen, Germany Prinz, Müller KP_Cb0030 GOET
Ostrya carpinifolia Scop. Forest Botanical Garden, Göttingen, Germanyc Prinz, Müller KP_Cb0037 n.a.
Ostrya virginiana (Mill.) K. Koch Forest Botanical Garden, Göttingen, Germanyc Prinz, Müller KP_Cb0031 n.a.
a

Frozen leaves from all samples are stored in the Section Forest Genetics and Forest Tree Breeding, Georg-August-Universität Göttingen, Germany. Voucher herbarium specimens from almost all species are deposited in the Herbarium Göttingen (GOET), Georg-August-Universität Göttingen, Germany. German samples from Carpinus betulus are expected to be closely related. Greek and Romanian samples from C. betulus are genetically different from German samples due to geographical distances rather than phylogenetic differences.

b

DNA of the tree was used to generate a microsatellite-enriched library for marker development (51°30.555′N, 09°57.773′E).

c

The two Ostrya species and one individual of Carpinus turczaninovii were recently removed from their respective botanical gardens.

Appendix 2.

Details for additional microsatellite loci developed for Carpinus betulus that revealed ambiguous and nonvaluable patterns.

Locus Primer sequences (5′–3′) Repeat motifa Allele size (bp) Ta (°C)b
Cb_15 F: GCCAACATGATTTTTGATTTAGA (GA)x 102 TD 68–58
R: GCTAGGAAAGTGAAAGAGCTTAAGTG
Cb_16.1 F: GGACCATGAAGCAAGTGGAG (GA)x 133 TD 66–54
R: ATTGTTGTTGGCTTCGCTG
Cb_16.2 F: GGGTGGCTGAAAATGGAT (GA)x 88 TD 66–57
R: GAGACCCAAGGAGTAGTAGAACCA
Cb_29a F: CCCACCTCTTCTCAGTTCTCC (GAx)x 141 61
R: GTGAGCTTAGCAATGGCGAG
Cb_33a F: AGTTGCACCCTGCAATATCT (CT)x 88 TD 66–57
R: TCAGGCGATTCATCGTTATG
Cb_37 F: AACACAAGAAAACTGGAGAGAGA (GA)x 93 60
R: GTTGCTTATTGCGTCTCATG
Cb_39a F: CGAGAATATGGGGCAATGAA [(GA)x(TGx)(GA)x]5 180 58
R: TGCTCATTCTAATCTTATCTGGACT
Cb_46 F: CATTTCTAGAAGTTATTTTAC (GA)x 94 53
R: GTTGATTAATCATTATCTTGG

Note: Ta = annealing temperature.

a

Nx signifies a microsatellite motif interrupted by an ongoing DNA sequence of different lengths.

b

A touchdown (TD) protocol was applied. Annealing starts at the highest temperature and decreases at 1°C in each PCR cycle.

LITERATURE CITED

  1. Barbará T., Palma-Silva C., Paggi G. M., Bered F., Fay M. F., Lexer C. 2007. Cross-species transfer of nuclear microsatellite markers: Potential and limitations. Molecular Ecology 16: 3759–3767. [DOI] [PubMed] [Google Scholar]
  2. Coart E., Van Glabecke S., Petit R. J., Van Bockstaele E., Roldán-Ruiz I. 2005. Range wide versus local patterns of genetic diversity in hornbeam (Carpinus betulus L.). Conservation Genetics 6: 259–273. [Google Scholar]
  3. Fischer D., Bachmann K. 1998. Microsatellite enrichment in organisms with large genomes (Allium cepa). BioTechniques 24: 796–802. [DOI] [PubMed] [Google Scholar]
  4. Grivet D., Petit R. J. 2003. Chloroplast DNA phylogeography of the hornbeam in Europe: Evidence for a bottleneck at the outset of postglacial colonization. Conservation Genetics 4: 47–56. [Google Scholar]
  5. Gürcan K., Mehlenbacher S. A. 2010. Transferability of microsatellite markers in the Betulaceae. Journal of the American Society for Horticultural Science 135: 159–173. [Google Scholar]
  6. Peakall R., Smouse P. E. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Prinz K., Hensen I., Schie S., Debener T., Weising K. 2009. Characterization of polymorphic microsatellite markers in the tetraploid halophyte Suaeda maritima (L.) Dumort. (Chenopodiaceae) and cross-species amplification in related taxa. Molecular Ecology Resources 9: 1247–1249. [DOI] [PubMed] [Google Scholar]
  8. Rozen S., Skaletsky H. J. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
  9. Sampson J. F., Byrne M. 2012. Genetic diversity and multiple origins of polyploid Atriplex nummularia Lindl. (Chenopodiaceae). Biological Journal of the Linnean Society 105: 218–230. [Google Scholar]
  10. Selkoe K. A., Toonen R. J. 2006. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecology Letters 9: 615–629. [DOI] [PubMed] [Google Scholar]
  11. Wiehle M., Prinz K., Kehlenbeck K., Goenster S., Mohamed S. A., Finkeldey R., Buerkert A., Gebauer J. 2014. The African baobab (Adansonia digitata, Malvaceae): Genetic resources in neglected populations of the Nuba Mountains, Sudan. American Journal of Botany 101: 1498–1507. [DOI] [PubMed] [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES