Abstract
Premise of the study:
Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding.
Methods and Results:
Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms.
Conclusions:
This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding.
Keywords: Illumina sequencing, Jasminum sambac, microsatellite markers, Oleaceae
Jasminum sambac (L.) Aiton (Oleaceae) is an evergreen vine or shrub that is native to Pakistan and India; this species is cultivated as an ornamental plant worldwide because of its attractive and sweet fragrance (Ruan, 2014). Previous studies on this plant have mainly focused on its aromatic compounds (Edris et al., 2008), medicinal values (Sengar et al., 2015), cultivation physiology (He et al., 2010), and aromatic gene isolation (Ou, 2012; Sun et al., 2014). Only one study has reported the genetic diversity of J. sambac using intersimple sequence repeat (ISSR) markers (Qiu et al., 2008). However, ISSR loci are dominant markers that are difficult to use in the calculation of heterozygosity and paternity analysis. As an important ornamental plant, it is necessary to develop a set of powerful markers for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding.
Microsatellites or simple sequence repeats (SSRs) are powerful markers used in population genetics and molecular marker–assisted breeding because of their high level of polymorphism, ease of genotyping, and codominant inheritance (Li et al., 2002; Oliveira et al., 2006). Emerging high-throughput sequencing platforms make it possible to discover a large number of microsatellite markers in a short time (Suresh et al., 2013). In the present work, transcript-based microsatellite markers were developed for J. sambac by using Illumina sequencing.
METHODS AND RESULTS
Because of the temporal and spatial specificity of gene expression, RNA was isolated from a flower from a single individual of J. sambac to find molecular markers associated with the most important ornamental organs. The extraction was performed using a Quick RNA isolation kit (BioTeke Corporation, Beijing, China) following the manufacturer’s protocol. RNA concentration was measured using a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). The construction of cDNA libraries and RNA-Seq were performed by the Biomarker Biotechnology Corporation (Beijing, China). Sequencing was conducted using an Illumina HiSeq 2500 system (Illumina, San Diego, California, USA). The obtained raw reads were cleaned by removing adapter sequences and then assembled de novo using Trinity (Grabherr et al., 2011). Microsatellite searching was performed using MISA (Thiel et al., 2003), and searching parameters were set as di-, tri-, tetra-, penta-, and hexanucleotide motifs with a minimum of five repeats. Primer pairs were designed with Primer3 (Rozen and Skaletsky, 1999). The product size range was set at 100–400 bp, and the other primer design parameters were set at default values.
Fresh leaves of J. sambac were collected from 24 individuals from two cultivated populations in South China Botanical Garden (SCBG: 23°11′24″N, 113°21′40″E) and Kunming Botanical Garden (KMBG: 25°07′05″N, 102°44′15″E). The leaves were preserved in silica gel and used as the source of DNA. Vouchers were deposited in the herbarium of Henan Agricultural University (HEAC; SCBG population: voucher no. HHAU-3201-3213, KMBG population: voucher no. HHAU-3214-3224). The total genomic DNA (gDNA) of 24 individuals was extracted using a DNA extraction kit (Plant #DP305; Tiangen Biotech, Beijing, China) following the manufacturer’s protocol. PCR was carried out using a 30-μL reaction mixture consisting of 30 ng of gDNA, 3 μL of 10× buffer, 6 mM of each dNTP, 9 μM of each primer, and 1 unit of Taq DNA polymerase (Tiangen Biotech). The PCR reaction consisted of an initial denaturation step at 95°C for 5 min; followed by 35 cycles at 94°C for 40 s, annealing at a specific temperature (see Table 1) for 45 s, and 72°C for 50 s; followed by a final extension at 72°C for 8 min. The amplified fragments were electrophoresed on an 8% native polyacrylamide gel and visualized through silver staining. PCR products were sized relative to a 50-bp DNA ladder (TaKaRa Biotechnology Co., Dalian, Liaoning, China). Number of alleles (A) and inbreeding coefficient (FIS) were calculated using FSTAT 2.9.3.2 (Goudet, 1995). Observed heterozygosity (Ho), expected heterozygosity (He), linkage disequilibrium (LD), and Hardy–Weinberg equilibrium (HWE) were calculated using GENEPOP 4.2 (Rousset, 2008).
Table 1.
Primer sequences and characterization of 31 microsatellite loci isolated from Jasminum sambac.
| Locus | Primer sequences (5′–3′) | Repeat motif | Ta (°C) | Allele size (bp) | A | GenBank accession no. |
| Js004 | F: CCAAATTGTCATTGGGCTCT | (CTT)5 | 48 | 214 | 1 | KR339145 |
| R: GCTAGCTTTGATGGGTTGGA | ||||||
| Js010 | F: TGCGAAGACTCTCAGCAGAA | (AG)6 | 48 | 189 | 1 | KR339151 |
| R: AACAGCTTCACGCTCTCCTC | ||||||
| Js011 | F: AACATCCAAACAGGCCAAAA | (CA)9 | 48 | 206 | 1 | KR339152 |
| R: CAGAAGGAATCCACCCTTCA | ||||||
| Js012 | F: GACGGTCGGTCCTCACTTTA | (GAC)5 | 48 | 228 | 1 | KR339153 |
| R: ACTTGAATGGATCAAACGGC | ||||||
| Js016 | F: CCATTGGCTGGAGAGATGAT | (TAC)6 | 48 | 251 | 1 | KR339157 |
| R: CCCACTGCCAAGTCCTTTTA | ||||||
| Js020 | F: ACATGAATCGAGGAAAACCG | (TTC)5 | 48 | 269 | 1 | KR339161 |
| R: GAATGGCGAAGGAAAATGAA | ||||||
| Js021 | F: GAAGAGGGAACTACCCGGTC | (GT)6 | 48 | 275–285 | 2 | KR339162 |
| R: ATGAGAGCAAAGAGGGGACA | ||||||
| Js029 | F: TTCTCTCACATCGGTGGTTG | (ATGT)5 | 48 | 278 | 1 | KR339170 |
| R: TGACAAGAACCAAACCAATCC | ||||||
| Js030 | F: AACTCCGTGTACTCCGCAAG | (GA)7 | 48 | 245–251 | 2 | KR339171 |
| R: GCGAAAATCAAACTGCCATC | ||||||
| Js033 | F: GAAATCTGATGCTGCAACCA | (AT)7 | 48 | 256–262 | 2 | KR339174 |
| R: AAAGAGTTCATCCATTCGGG | ||||||
| Js035 | F: GACTTTGCGAGGGAAAACAG | (TGG)6 | 48 | 252–254 | 2 | KR339176 |
| R: CCAACCCTTCGACTCCTACA | ||||||
| Js040 | F: GTAGATTCGGCGTTACTCGG | (AAG)6 | 48 | 204–213 | 2 | KR339181 |
| R: CTTTTCTTCATAGCCCGACG | ||||||
| Js041 | F: GGAATTGTGGATGGCTCACT | (CAAA)5 | 48 | 136–142 | 3 | KR339182 |
| R: TGAGAGTTGGATGGGCTTTT | ||||||
| Js042 | F: AGAAATTTTTCCGGCTACGG | (CCG)5 | 48 | 212–218 | 3 | KR339183 |
| R: CCCATGACTAACCCGGTAGA | ||||||
| Js050 | F: TCCAAGAAAATGAACGGGAT | (TAC)5 | 48 | 268 | 1 | KR339191 |
| R: TGAATTGGCCTATCCTTTGG | ||||||
| Js055 | F: TGTTGCTCCTTCACATCAGC | (CTC)6 | 48 | 171–180 | 2 | KR339196 |
| R: GCCCCATCGTAGGGTAAAAT | ||||||
| Js057 | F: CTGATCTCTGCCACGTTCAA | (CCG)5 | 48 | 278 | 1 | KR339198 |
| R: AAAATAACAAAAATCCTCCGCA | ||||||
| Js061 | F: TCTTGGGTTGGCTTCAGAAC | (AGC)5 | 48 | 242 | 1 | KR339202 |
| R: CAGCGAAGTGAGTCTGGTCA | ||||||
| Js062 | F: TGAAACTACCGGGTCTTTGG | (AGA)5 | 48 | 230 | 1 | KR339203 |
| R: ATTAATCGGTCCTGAAGGGG | ||||||
| Js063 | F: CCCATCTCACCCTAACCTCA | (TA)6 | 50 | 188–194 | 2 | KR339204 |
| R: GAAAAATTCTTGGATCTTCTTGC | ||||||
| Js064 | F: TCAACGCCTTAAATTGCTTG | (CT)6 | 48 | 275–281 | 2 | KR339205 |
| R: CCACAAACCTTCGAGGAGAC | ||||||
| Js068 | F: ATAAAGCACAACATCCCGCT | (AG)6 | 48 | 123 | 1 | KR339209 |
| R: TTTCTCACTCCGGCACTTCT | ||||||
| Js073 | F: GCCTCGAAATGTTGGAATGT | (GAA)6 | 48 | 213 | 1 | KR339214 |
| R: CCAAACTACGAAGGGGAAAA | ||||||
| Js075 | F: ACGCAATCTACCCCATTGAG | (GAT)5 | 48 | 266 | 1 | KR339216 |
| R: TCCTTCAGCAACATTGCATC | ||||||
| Js076 | F: TGTAACGCGAAACGGAATTT | (TGG)6 | 48 | 163–172 | 2 | KR339217 |
| R: ACCAACCACGGTGTTTCTTC | ||||||
| Js077 | F: TTTGCCATCAATGTCTCCCT | (GT)9 | 48 | 143 | 1 | KR339218 |
| R: CCTGTTCCTGTTTCCATCAGA | ||||||
| Js079 | F: CAAGAAAATTGACCCCATCG | (TA)7 | 48 | 157–163 | 2 | KR339220 |
| R: GACTTGGTCGCCATTGTTTT | ||||||
| Js084 | F: TCATAACCCCTCGCTTTTTG | (CCA)5 | 48 | 212 | 1 | KR339225 |
| R: AAGCTTGGGGGAGGAAGTTA | ||||||
| Js085 | F: CCATGGACAAACATTGTGGA | (AAC)5(AGC)5 | 48 | 204–207 | 2 | KR339226 |
| R: TTTCAAAGAGCGGAACCAGT | ||||||
| Js086 | F: TCCACCTCTCGGGTTATTTG | (GAA)6 | 48 | 150 | 1 | KR339227 |
| R: AAAGTCTGCAAAAGGGAGCA | ||||||
| Js100 | F: AAGCATCGAGAATCGAGCATA | (AG)6 | 48 | 230 | 1 | KR339241 |
Note: A = number of alleles; Ta = PCR annealing temperature.
A total of 42.35 million reads were obtained from the RNA-Seq data. The assembly of reads resulted in 49,772 unigenes, with a mean size of 846 bp. Out of these unigenes, 1322 microsatellites contained sufficient flanking sequences for primer design and were deposited in GenBank (KR339142–KR340463). A total of 100 primer pairs were randomly selected for further PCR characterization. Among these, 69 primer sets were discarded due to nonspecific amplification. The remaining 31 primer pairs were used for polymorphism verification. Eighteen primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms (Table 1). For these polymorphic primer pairs, the A, Ho, He, and FIS of each population ranged from one to three, 0.000 to 1.000, 0.000 to 0.500, and −1.000 to 0.000, respectively (Table 2). The six primer pairs exhibited low polymorphism. The most likely reason for this phenomenon was the narrow genetic basis of the cultivated populations. The 31 microsatellite sequences were searched in the nonredundant protein database using BLAST (Appendix S1 (49.5KB, doc) ). Nine loci matched significantly with coding regions in the known genes. Loci Js033 and Js063 significantly deviated from HWE (P < 0.05) due to excessive heterozygosity. No significant pairwise LD was observed among these loci. The microsatellite primers reported in this study will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding of J. sambac.
Table 2.
Genetic diversity parameters for six polymorphic microsatellite loci from two cultivated populations of Jasminum sambac.a
| SCBG | KMBG | |||||||
| Locus | A | He | Ho | FIS | A | He | Ho | FIS |
| Js033 | 2 | 0.473 | 0.769 | −0.600 | 2 | 0.500 | 1.000* | −1.000 |
| Js035 | 1 | 0.000 | 0.000 | — | 2 | 0.397 | 0.545 | −0.333 |
| Js041 | 3 | 0.462 | 0.615 | −0.297 | 1 | 0.000 | 0.000 | — |
| Js042 | 3 | 0.349 | 0.308 | −0.103 | 2 | 0.091 | 0.091 | 0.000 |
| Js055 | 2 | 0.426 | 0.615 | −0.412 | 2 | 0.463 | 0.727 | −0.539 |
| Js063 | 2 | 0.497 | 0.923* | −0.846 | 2 | 0.500 | 1.000* | −1.000 |
Note: A = number of alleles; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity.
Locality and voucher information: SCBG (South China Botanical Garden: 23°11′24″N, 113°21′40″E), voucher no. HHAU-3201-3213; KMBG (Kunming Botanical Garden: 25°07′05″N, 102°44′15″E), voucher no. HHAU-3214-3224.
Significant deviation from Hardy–Weinberg equilibrium.
CONCLUSIONS
In this study, 1322 microsatellites were isolated from J. sambac. A total of 100 primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and six displayed polymorphisms. This is the first set of microsatellite markers developed for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding.
Supplementary Material
LITERATURE CITED
- Edris A. E., Chizzola R., Franz C. 2008. Isolation and characterization of the volatile aroma compounds from the concrete headspace and the absolute of Jasminum sambac (L.) Ait. (Oleaceae) flowers grown in Egypt. European Food Research and Technology 226: 621–626. [Google Scholar]
- Goudet J. 1995. FSTAT (version 1.2): A computer program to calculate F-statistics. Journal of Heredity 86: 485–486. [Google Scholar]
- Grabherr M. G., Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29: 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He L. S., Xia B., Meng X. J., Wang C. Y., Peng F., Wang R. 2010. Physiological and biochemical responses of Jasminum sambac L. under natural temperature reduction. Journal of Nanjing Agricultural University 33: 28–32. [Google Scholar]
- Li Y. C., Korol A. B., Fahima T., Beiles A., Nevo E. 2002. Microsatellites: Genomic distribution, putative functions and mutational mechanisms: A review. Molecular Ecology 11: 2453–2465. [DOI] [PubMed] [Google Scholar]
- Oliveira E. J., Pádua J. G., Zucchi M. I., Vencovsky R., Vieira M. L. C. 2006. Origin, evolution and genome distribution of microsatellites. Genetics and Molecular Biology 29: 294–307. [Google Scholar]
- Ou X. F. 2012 Cloning and analysis on HPL and GDS of Jasminum sambac. Master’s thesis, Fujian Agriculture and Forestry University, Fuzhou, China.
- Qiu C. Y., Gao G. Q., Chen B. L., Zhou R. Y., Zhang J. Q. 2008. ISSR analysis on genetic diversity of Jasminum sambac. Hubei Agricultural Sciences 47: 744–747. [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. J. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Ruan Y. J. 2014. Research on the mutation effects of Jasminum sambac (Linn.) Aiton in vitro after colchicine treatment. Master’s thesis, Northwest University, Xi’an, China.
- Sengar N., Joshi A., Prasad S. K., Hemalatha S. 2015. Anti-inflammatory, analgesic and anti-pyretic activities of standardized root extract of Jasminum sambac. Journal of Ethnopharmacology 160: 140–148. [DOI] [PubMed] [Google Scholar]
- Sun J., Chen G. X., Ye N. X., Lü S. H., Liu Z. Q., Huang W., Lin Z. D. 2014. Cloning and expression analysis of deoxyoxylulose-5-phosphate synthase gene related to aroma from Jasminum sambac and isolation of its promoter. Acta Horticulturae Sinica 41: 1236–1244. [Google Scholar]
- Suresh S., Park J. H., Cho G. T., Lee H. S., Baek H. J., Lee S. Y., Chung J. W. 2013. Development and molecular characterization of 55 novel polymorphic cDNA-SSR markers in faba bean (Vicia faba L.) using 454 pyrosequencing. Molecules (Basel, Switzerland) 18: 1844–1856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thiel T., Michalek W., Varshney R. K., Graner A. 2003. Exploiting EST database for the development and characterization of gene-derived SSR markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.