Skip to main content
Veterinary Research Forum logoLink to Veterinary Research Forum
. 2015 Sep 15;6(3):223–226.

Prevalence of Listeria monocytogenes in raw milk in Kerman, Iran

Ladan Mansouri-Najand 1,*, Mehrnoush Kianpour 2, Masoud Sami 1, Maziar Jajarmi 3
PMCID: PMC4611976  PMID: 26893812

Abstract

Listeria monocytogenes as one of the most important pathogen in public health concerns is transmitted through consumption of contaminated food. The pathogen has been considered as a potential source of contamination of raw milk and dairy products. This research was aimed to investigate prevalence of L. monocytogenes in raw milk in Kerman region. In the summer of 2011, a total number of one hundred raw milk samples were collected from bulk tanks of some dairy farms and tested for iap and actA genes using polymerase chain reaction. Among the 100 samples, five isolates (5.0%) were detected as L. monocytogenes based on phenotypic and genotypic characteristics. Considering the low frequency of L. monocytogenes in this study, raw milk cannot be omitted as a potential source of food contamination for the population of the region. To achieve more accurate isolation, identification and control of L. monocytogenes in raw milk, it is suggested that new standard laboratory methods be implemented as well as biosafety outreach programs, management techniques and education.

Key Words: Food safety, Kerman, Listeria monocytogenes, Raw milk, Iran

Introduction

Listeria monocytogenes is one of the most important pathogens in public health concerns.1 This type of pathogen is transmitted through food which is particularly challenging for people with immune problems.2,3 Listeriosis (Listeria infection) is relatively rare but statistics show that mortality rates can be high (up to 30.0%).4 The major means of transmission of L. monocytogenes to humans and animals is through consumption of contaminated food.5 The pathogen can be transmitted through various foods such as meat and meat products, fish and fish products, milk and dairy products (raw milk, soft cheeses etc.), vegetables and minimally processed food.1,5

There have been attempts to regulate amounts of L. monocytogenes in foods. In the USA, there should not be a bacterium in each 25 g of food.6 In Europe, this agent must not be above 100 CFU g-1 during the shelf life of food and there should be no L. monocytogenes in products that bacterium may grow in them.7

Listeria monocytogenes can grow and remain in raw milk in a broad range of temperatures, low pH and high salt concentration.8,9 Therefore, the pathogen has been found in sheep, goat and cow milk and is considered as a potential source of contamination of raw milk and dairy products, and outbreaks subsequently.10,11 Incidence of the pathogen has been reported at different rates (3.4% to 6.0%) in raw milk that can be contaminated from infected feces and milk.12,13

There are various methods for rapid detection of L. monocytogenes, one of which is polymerase chain reaction (PCR). It detects virulent genes in a food sample. Therefore, a number of important virulent genes are plcB (encoding phospholipase C), hly (listeriolysin O), prfA (transcriptional regulatory protein), mpl (metalloprotease), actA (Actin assembly-inducing protein A) and iap (Invasion associated protein).14,15

The region of Kerman in southeastern Iran, with a population of more than 700,000 is the case study used to test the prevalence of pathogens that present a concern to public health. In this city, there are several big and small suppliers of milk and milk products. This research was aimed to investigate prevalence of L. monocytogenes in raw milk in this region. In previous years Listeria had been considered as an important foodborne pathogen to threaten public health by many related organizations such as International Dairy Federation (IDF). These tests on milk samples in Kerman province are the first under Iran’s membership of the IDF.

Materials and Methods

Tests were done in the summer of 2011. A total number of one hundred raw milk samples were collected in sterile tubes from bulk tanks of some dairy farms in Kerman province. Once samples had been collected they were immediately transferred to the laboratory in conditions of 4 ˚C.

For each 25 mL sample of milk, 225 mL Listeria enrichment broth (Merck, Darmstadt, Germany) was added and then incubated at 30 ˚C. After 48 hr, 0.1 mL of enriched broth was cultivated on PALCAM Listeria selective agar medium (Merck) containing special supplements, at 37 ˚C for 48 hr. Listeria colonies were detected and confirmed by Gram staining, catalase production, oxidase activity and mobility tests. For identification of species, MicrogenTM Listeria-ID System (Microgen Bioproducts Ltd., Camberley, UK) was used according to the instructions. So Listeria isolates were evaluated in asculin hydrolysis, hemolysis, mannitol, xylose, arabitol, ribose, rhamnose, trehalose, tagatose, glucose-1-phosphate, methyl-D-glucose and methyl-D-mannose fermentation to identify species: L. monocytogenes, L. ivanovii, L. seeligeri, L. inocua, L. welshimeri and L. grayi.

Also, artificially contaminated milk samples were prepared in serial dilution of bacterium. An overnight cultivation of L. monocytogenes ATCC 7644 was prepared in brain-heart infusion broth (BHI; Merck). The bacterium was diluted in raw milk (10-1 to 10-15) and finally, 0.1 mL of each dilution was cultured in three plates of PALCAM agar (Merck) for 24 hr at 37 ˚C.

DNA extraction was done by the boiling method, 3 to 4 pure colonies were suspended in 1 mL distilled water and centrifuged at 14000 rpm for 1 min. Supernatants were eliminated and the remains was washed using by 500 µL NaCl 0.85%. Tubes were boiled at 100 ˚C for 10 min and then immediately placed on ice. Strains were subjected to detecting iap and actA genes for duplex-PCR using primers described previously (Table 1).16,17 Total volume of PCR amplification reaction was 25 μL containing: 10 μLDNA template, 0.2 mM of each primer, 0.2 mM of each dNTP (Cinnagene, Tehran, Iran), 2.5 mM MgCl2 (Cinnagene), 2.5 μL 10x PCR buffer (Cinnagene), 1 unit Taq DNA polymerase(Cinnagene) and distilled water up to reaction volume. Also, the thermal program was 95 ˚C for 5 min (Initial denaturation), 95 ˚C for 1.5 min (Denaturation), 46 ˚C for 80 sec (Annealing), and 72 ˚C for 2 min (Elongation) that 35 cycles were repeated from the second step. Finally, terminal extension was performed at 72 ˚C for 7 min. Electrophoresis was done with 5 μL PCR products on 1.5% agarose gel for 75 min at 100 V in tris borate EDTA (TBE; Cinnagene) buffer (90 mM trisbase, 90 mM boric acid, 20 mM EDTA, pH 8.0) containing 0.5 μg mL-1 ethidium bromide to visualize the amplicons. The electrophoresed gel was analyzed by UV trans-illumination. Listeria monocytogenes ATCC 7644 strain and distilled water was used as the positive and no-template negative controls, respectively, and specific bands were compared with 50-bp DNA ladder (Vivantis, Selangor, Malaysia).

Table 1.

Primers used in the PCR reactions

Tareget Primer Sequence 5'-3' Product size Reference
actA actA-F GTGATAAAATCGACGAAAATCC 400 or 300 bp Vazquez-Boland et al. 16
actA-R CTTGTAAAACTAGAATCTAGCG
iap MAR 1 GGGCTTTATCCATAAAATA 453 bp Manzano et al. 17
MAR 2 TTGGAAGAACCTTGATTA

Results

Among the 100 samples, five isolates (5.0%) were detected as L. monocytogenes based on phenotypic characteristics. Those black with black sunken colonies in PALCAM Listeria selective agar mediums were Gram positive, catalase-positive and oxidase-negative. Also, these isolates possessed β hemolysis in sheep blood agar and tumbling motility at 25 ˚C and 37 ˚C. These strains were confirmed by MicrogenTM Listeria–ID System as L. monocytogenes: asculin hydrolysis, hemolysis, arabitol, rhamnose, trehalose, methyl-D-glucose and methyl-D-mannose fermentation was positive but mannitol, xylose, ribose, tagatose and glucose-1-phosphate fermentation was negative. All five Listeria strains were identified as L. monocytogenes and showed presence of iap and actA genes in PCR. In addition, five colonies were raised from 0.1 mL belonging to 10-13 dilution of bacterium in artificially contaminated milk samples. Thus, this method was determined as sensitive to 50 CFU mL-1.

Discussion

This study determined that prevalence of L. monocytogenes in bulk tank, raw milk samples taken in the Kerman region, was low (5.0%). Results from tests in other areas in Iran have been reported as follows; 20% in Esfahan, 4.0% in Mashhad, 1.7% and 3.3% from two different dairy farms northern Iran.18-20 There have also been reports on prevalence of L. monocytogenes in milk samples from USA determined at 6.5%, Swedish dairy farm 1.0%, Morocco 5.9%, Latvia 1.4% and Syria with a considerably higher rate (41.6%).21-25

Results reported from the tests in this study are in agreement with reports on samples from Mashhad, east northern Iran and Latvia, while the rates of prevalence determined by tests in Esfahan, USA, Morocco and Syria were relatively higher and those in Sweden were lower.18-20 The variable rate of prevalence depends to some extent on hygiene, dairy management, the number of animals on a farm, season, geographical characteristics of a region, sampling technique and laboratory detection method.19,26 The most important risk factors of L. monocytogenes contamination of raw milk include defective disinfection of teats before milking, lack of correct management of barn and silage, insufficient hygiene practice in the environment and a low level of cleanliness among cows.27 Milking system and hygienic control of milking are considerations that have a considerable statistically relationship with risk of Listeria persistent in bulk tank milk.28 Therefore, the most important challenge during milking is exogenous contamination of milk with fecal material due to bad practice of hygiene standards.29 There are also challenges of good practice during transportation and storage of milk that need consideration.30,31

Although, prevalence of L. monocytogenes in this research was low, the importance of pasteurization and processing of dairy products (especially raw milk) should not be overlooked.32 Persons who are related to dairy farms such as producers and workers are at risk of oral infection by contaminated raw milk.25

In this study, all five isolates identified as L. monocytogenes were also positive for iap and actA genes. There is differences in the level of contamination with Listeria species between traditional foods.10 Proteins coded by iap gene are present in Listeria spp., however, they are different in each species and can be used for diagnostic targets by PCR.33 The actA gene is also appropriate for epidemiological approaches. This PCR-based assay can be considered as a specific method for recognize the DNA from different L. monocytogenes strains of raw milk, but it needs to more investigations.

In conclusion, considering the low frequency of L. monocytogenes in this study, raw milk cannot be omitted as a potential source of food contamination for the population of the region. It is recommended that a larger sample size should be employed selected from more dairy farms in order to make better and more precise judgment on pre-valence of L. monocytogenes. Thus, to achieve more accurate isolation, identification and control of L. monocytogenes in raw milk, it is suggested that using new standard laboratory methods be implemented as well as biosafety outreach programs, management techniques and education.

References

  • 1.Adzitey F, Huda N. Listeria monocytogenes in foods: Incidences and possible control measures. Afr J Microbiol Res. 2010;4(25):2848–2855. [Google Scholar]
  • 2.Schlech WF. Foodborne listeriosis. Clin Infect Dis. 2000;31:770–775. doi: 10.1086/314008. [DOI] [PubMed] [Google Scholar]
  • 3.Liu D. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol. 2006;55:645–659. doi: 10.1099/jmm.0.46495-0. [DOI] [PubMed] [Google Scholar]
  • 4.Ireton K. Listeria monocytogenes. In: Chan VL, Sherman PM, Bourke B (Eds). Bacterial genomes and infectious diseases. 3rd ed. Totowa, USA: Humana Press Inc. 2006:125–149. [Google Scholar]
  • 5.Ramaswamy V, Cresence VM, Rejitha JS, et al. Listeria: Review of epidemiology and pathogenesis. J Microbiol Immunol Infect. 2007;40:4–13. [PubMed] [Google Scholar]
  • 6.Shank FR, Elliot EL, Wachsmuth IK, et al. US position on Listeria monocytogenes in foods. Food Control. 1996;7:229–234. [Google Scholar]
  • 7.EFSA (European Food Safety Authority), 2010 The Community Summary Report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in the European Union in 2008. EFSA J. 2010;8(1):1496. [Google Scholar]
  • 8.Gahan CGM, O’ Driscoll B, Hill C. Acid adaptation of Listeria monocytogenes can enhance survival in acidic foods and during milk fermentation. Appl Environ Microb. 1996;62:3128–3132. doi: 10.1128/aem.62.9.3128-3132.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kim J, Schmidt KA, Phebus RK, et al. Time and temperature of stretching as critical control points for Listeria monocytogenes during production of mozzarella cheese. J Food Protect. 1998;61:116–118. doi: 10.4315/0362-028x-61.1.116. [DOI] [PubMed] [Google Scholar]
  • 10.Rahimi E, Momtaz H, Sharifzadeh A, et al. Prevalence and antimicrobial resistance of Listeria species isolated from traditional dairy products in Chahar Mahal and Bakhtiary, Iran. Bulg J Vet Med. 2012;15(2):115–122. [Google Scholar]
  • 11.De Buyser ML, Dufour B, Maire M, et al. Implication of milk and milk products in foodborne diseases in France and in different industrialized countries. Int J Food Microbiol. 2001;67:1–17. doi: 10.1016/s0168-1605(01)00443-3. [DOI] [PubMed] [Google Scholar]
  • 12.Hunt K, Drummond N, Murphy M, et al. A case of bovine raw milk contamination with Listeria mono-cytogenes. Irish Vet J. 2012;65(13):1–5. doi: 10.1186/2046-0481-65-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ryser ET, Marth EH. Listeria, listeriosis and food safety. New York, USA: Marcel Dekker Inc; pp. 359–503. [Google Scholar]
  • 14.Hein I, Klein D, Lehner A, et al. Detection and quantification of the iap gene of Listeria monocytogenes and Listeriainnocua by a new real-time quantitative PCR assay. Res Microbiol. 2001;152:37–46. doi: 10.1016/s0923-2508(00)01166-9. [DOI] [PubMed] [Google Scholar]
  • 15.Longhi C, Maffeo A, Penta M, et al. Detection of Listeria monocytogenes in Italian-style soft cheeses. J Appl Microbiol. 2003;94:879–885. doi: 10.1046/j.1365-2672.2003.01921.x. [DOI] [PubMed] [Google Scholar]
  • 16.Vazquez-Boland JA, Kocks C, Dramsi S, et al. Nucleotide sequence of the lecithinase operon of Listeria mono-cytogenes and possible role of lecithinase in cell-to-cell spread. Infect Immun.  1992;60(1):219–230. doi: 10.1128/iai.60.1.219-230.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Manzano M, Cocolin L, Cantoni C, et al. A rapid method for the identification and partial serotyping of Listeria monocytogenes in food by PCR and restriction enzyme analysis. Int J Food Microbiol . 1998;42(3):207–12. doi: 10.1016/s0168-1605(98)00086-5. [DOI] [PubMed] [Google Scholar]
  • 18.Shahbazi AM, Rashedi M, Sohrabi R. Comparative contamination of Listeria monocytogenes in traditional dairy products in Esfahan province, Iran. Afr J Microbiol Res. 2013;7(16):1522–1526. [Google Scholar]
  • 19.Jami S, Jamshidi A, Khanzadi S. The presence of Listeria monocytogenes in raw milk samples in Mashhad, Iran. Iran J Vet Res. 2010;11(4):363–367. [Google Scholar]
  • 20.Mahmoudi MM. Occurrence of Listeria monocytogenes in raw milk and dairy products in Noorabad, Iran. J Anim Vet Adv. 2010;9(1):16–19. [Google Scholar]
  • 21.Van Kessel JS, Karns JS, Gorski L, et al. Prevalence of Salmonellae, Listeria monocytogenes, and Fecal Coliforms in bulk tank milk on US dairies. J Dairy Sci. 2004;87:2822–2830. doi: 10.3168/jds.S0022-0302(04)73410-4. [DOI] [PubMed] [Google Scholar]
  • 22.Waak E, Tham W, Danielsson-Tham ML. Prevalence and fingerprinting of Listeria monocytogenes strains isolated from raw whole milk in farm bulk tanks and in dairy plant receiving tanks. Appl Environ Microbiol . 2002;68(7):3366–3370. doi: 10.1128/AEM.68.7.3366-3370.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.El Marnissi B, Bennani L, Cohen N, et al. Presence of Listeria monocytogenes in raw milk and traditional dairy products marketed in the north-central region of Morocco. Afr J Microbiol Res . 2013;7(5):87–91. [Google Scholar]
  • 24.Konosonoka IH, Jemeljanovs A, Osmane B, et al. Incidence of Listeria spp in dairy cows feed and raw milk in Latvia. ISRN Vet Sci .  2012:1–5. doi: 10.5402/2012/435187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Al-mariri A, Abou Younes A, Ramadan L. Prevalence of Listeria spp In raw milk in Syria. Bulg J Vet Med. 2013;16(2):112–122. [Google Scholar]
  • 26.Jayarao BM, Henning DR. Prevalence of foodborne pathogens in bulk tank milk. J Dairy Sci . 2001;84(10):2157–2162. doi: 10.3168/jds.S0022-0302(01)74661-9. [DOI] [PubMed] [Google Scholar]
  • 27.Sanaa M, Poutrel B, Menard JL, et al. Risk factors associated with contamination of raw milk by Listeria monocytogenes in dairy farms. J Dairy Sci. 1993;76:2891–2898. doi: 10.3168/jds.S0022-0302(93)77628-6. [DOI] [PubMed] [Google Scholar]
  • 28.Vilar MJ, Yus E, Sanjua´n ML, et al. Prevalence of and risk factors for Listeria species on dairy farms. J Dairy Sci. 2007;90:5083–5088. doi: 10.3168/jds.2007-0213. [DOI] [PubMed] [Google Scholar]
  • 29.Sanaa M, Audurier A, Poutrel B, et al. Origin of bovine raw milk contamination by Listeria monocytogenes. In Proceedings: Symposium on bacteriological quality of raw milk; Wolfpassing, Austria: 1996. pp. 84–88. [Google Scholar]
  • 30.Bemrah N, M Santa, MH Cassin, et al. Quantitative risk assessment of human listeriosis from consumption of soft cheese made from raw milk. Prev Vet Med. 1998;37:129–145. doi: 10.1016/s0167-5877(98)00112-3. [DOI] [PubMed] [Google Scholar]
  • 31.Atil E, Ertas HB, Ozbey G. Isolation and molecular characterization of Listeria spp from animals, food and environmental samples. Vet Med-Czech. 2011;56(8):386–394. [Google Scholar]
  • 32.O’ Donnell ET. The Incidence of Salmonella and Listeria in raw milk from farm bulk tanks in England and Wales. Int J Dairy Technol. 1995;48:125–129. [Google Scholar]
  • 33.Vazquez-Boland JA, Kuhn M, Berche P, et al. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev. 2001;14:584–640. doi: 10.1128/CMR.14.3.584-640.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary Research Forum are provided here courtesy of Faculty of Veterinary Medicine, Urmia University, Urmia, Iran

RESOURCES