Abstract
Objective: To study the expression and molecular mechanism of long noncoding RNAs (lncRNA) including HEIH and HULC in proliferation and invasion of hepatoma cells. Methods: We detected the expression of HEIH and HULC in hepatocellular carcinoma cell line (MHCC97L and HepG2), as well as in human normal hepatocyte line (cHL-7702) by real-time PCR. Using MTT and transwell, we investigated the effect of HEIH and HULC on proliferation and invasion of hepatoma cells with siRNA and expression plasmid. To explore the molecular mechanism, we use western blot to reveal the role of HEIH and HULC in tumor invasion related gene expression. Results: The expression of HEIH and HULC in hepatocellular carcinoma cell line was significantly increased compared with human normal hepatocyte line (P<0.05). The expression of HULC in HepG2 was higher than that in MHCC97L. The over-expression of HULC could enhance proliferation of MHCC97L and HepG2, however, the over-expression of HEIH could not. The over-expression of HULC and HEIH could promote invasion of MHCC97L and HepG2. Invasion of MHCC97L and HepG2 did not have significant change after down-regulating of HEIH and HULC by siRNA. Over-expression of HULC up-regulated the expression of Snail in HepG2. Conclusions: The expression of HEIH and HULC increased significantly in hepatocellular carcinoma cell line compared with that in human normal hepatocyte line. HULC could promote proliferation of hepatoma cells. HEIH and HULC play an important role in the invasion of hepatocellular carcinoma cell.
Keywords: HEIH, HULC, hepatocellular carcinoma, proliferation, invasion
Introduction
Long non-coding RNA (lncRNA) is a kind of non-coding RNA with more than 200 nucleotides, which is considered to be the “noise” of genome transcription without biological function for a long time. However, recent studies revealed that lncRNA played an important role in dosage compensation effect, epigenetic regulation, cell cycle, differentiation, and some other cell life activities. Thereby lncRNA are widely involved in physiological and pathological process [1,2]. Evidence has shown that lncRNA participates in development and metastasis of tumor [3,4]. Highly up-regulated in liver cancer (HULC) is an lncRNA of 1.6 kb whose gene locates in chromosome 6p24.3 and contains 1 intron and 2 exons. HULC is considered to be the first specially upregulated non-coding RNA in liver cancer tissues [5,6]. HULC can not only be detected in liver cancer tissues, but also in circulation of patients with hepatocellular carcinoma. Therefore, this kind of lncRNA with highly specific expression might be applied to clinic as potential markers of hepatocellular carcinoma [7]. Another lncRNA named lncRNA high expression in hepatocellular carcinoma (lncRNA-HEIH) have been found to be highly expressed in the patients with hepatitis B virus associated primary hepatocellular carcinoma. Researchers found that HEIH could inhibit cell differentiation in G0/G1 and supposed that HEIH might be a cancer-promoting lncRNA which accelerated the carcinogenesis of hepatitis B virus related hepatocellular carcinoma. However, the mechanism remains unknown [8,9].
Further studies found that the width and depth of biological activity that lncRNA involved in were beyond our anticipation. lncRNA can regulate gene transcription by different mechanism, especially the gene close to it. Marten et al. revealed that some kind of lncRNA blocked the combination of transcription factor and promoter to inhibit the expression of this gene [10]. In addition to inhibition of gene expression, the transcriptional inhibited silence of lncRNA was essential in transcription of Hox gene [11]. The mechanism of IncRNA is not only inhibition and promoting, but also a sophisticated biological process. lncRNA-HEIH and lncRNA-HULC are related to hepatocellular carcinoma and were found upregulated in hepatocellular carcinoma [8,12]. This study detected the expression of HEIH and HULC in hepatocellular carcinoma cell line (MHCC97L and HepG2), as well as in human normal hepatocyte line (cHL-7702) by real-time PCR. Using MTT and transwell, we investigated the effect of HEIH and HULC on proliferation and invasion of hepatoma cells with siRNA and expression plasmid. We investigated the expression of HEIH and HULC and its relationship with cell cycle associated protein to reveal the molecular mechanism of HEIH and HULC in tumor invasion of hepatocellular carcinoma.
Materials and methods
Cell line
Hepatocellular carcinoma cell line MHCC97L was purchased from ATCC and preserved in liquid nitrogen. Hepatocellular carcinoma cell line HepG2 and human normal hepatocyte line cHL-7702 was purchased from the Typical Culture Preservation Commission Cell Bank in Chinese Academy of Sciences and preserved in liquid nitrogen.
Reagents and instrument
RNA extraction kit (TRIzol Plus RNA Purification Kit) was purchased from Ambion-12183-555. TaqMan MicroRNA Reverse Transcription Kit was purchased from Applied Biosystems-4366597. SsoAdvanced SYBR Green Supermix was purchased from Bio Rad-172-5264. Primers of HEIH, HULC and GAPDH were synthesized by Sangon Biotech (Shanghai, China). Over-expression plasmid of HEIH and HULC were synthesized by Sagene (Guangzhou, China). Escherichia coli DH5α was preserved in our laboratory. Lipofectamine 3000 Transfection Reagent was purchased from invitrogen-L3000-00. Transwell was purchased from Corning-4395. Matrigel (5 mg/ml): was purchased from BD. MTT Cell Proliferation and Cytotoxicity Assay Kit was purchased from Beyotime (China). HRP-labeled secondary antibody was purchased from life technologies. Chemiluminescent Substrate Reagent Kit was purchased from life technologies. Snail antibody was purchased from Santa Cruz Biotechnology.
CO2 constant temperature unit (SANYO); optical microscope (OLYMPUS, BX53); ultraviolet spectrophotometer (Bio-Rad Headquarters, USA); instrument for polymerase chain reaction (Bio-Rad CFX96 Touch).
Cell culture
Cell line MHCC97L, HepG2 and HL-7702 were preserved in liquid nitrogen and were recovered in DMEM medium (GIBIC) with 10% fetal bovine serum (GIBIC) in 37°C with 5% CO2.
Real-time PCR
After washing with PBS and trypsin digestion, the cells were collected by centrifugation. RNA was isolated from the collected cells and was analyzed using ultraviolet spectrophotometer. Total RNA was reverse transcribed to cDNA using TaqMan MicroRNA Reverse Transcription Kit. According to the gene sequence of HEIH and HULC, primers were designed and synthesized by Sangon Biotech (Shanghai, China). The primer sequences for real-time PCR were showed in Table 1. For real-time PCR, SsoAdvanced SYBR Green Supermix was used according to the manufacturer’s instructions with a Bio-Rad CFX96 Real-Time System. There were 3 replicates for each sample. Experimental cycle threshold (CT) values were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) measured on the same plate, and the fold differences in gene expression were determined using the 2-ΔΔCT method. The melting curves were observed from 72°C to 95°C Tables 2, 3.
Table 1.
The primers used in Real-time PCR
| Gene | Accesion NO. | Primer (5’-3’) |
|---|---|---|
| LncRNA-HEIH | NR_045680.1 | F: CCTCTTGTGCCCCTTTCTT |
| R: ATGGCTTCTCGCATCCTAT | ||
| LncRNA-HULC | AY914050.1 | F: AACCTCCAGAACTGTGAT |
| R: CATAATTCAGGGAGAAAG | ||
| GAPDH | NM_002046 | F: GAAGGTGAAGGTCGGAGTC |
| R: GAAGATGGTGATGGGATTTC |
Table 2.
The synthetic system of inverse transcription
| Components | Volume per Reaction |
|---|---|
| 5×iScript reaction mix | 4 μl |
| iScript reverse transciptase | 1 μl |
| RNA template | 1 μg |
| Nuclease-free water | Up to 20 μl |
Table 3.
The synthetic system of PCR
| Components | Volume per Reaction |
|---|---|
| SsoAdvanced SYBR Green Super mix | 5 μl |
| Forward primer (10 μM) | 0.28-0.45 μl (280-450 nM) |
| Reverse primer (10 μM) | 0.28-0.45 μl (280-450 nM) |
| cDNA template | 100 ng |
| Nuclease-free water | Up to 10 μl |
Plasmid construction and transfection
pcDNA3.1 plasmid was synthesized by Sagene (Guangzhou, China). siRNA was designed and synthesized by Ribobio (Guangzhou, China). Cells were seeded in a 96-well plate (5000 cells/ml). After cell attachment, adjust cell density to 70%-80% when transfection. Transfection solution was prepared according to manufacturer’s instructions and then added to the plate. After 4-6 h, transfection solution was replaced by DMEM medium with 10% FBS.
Cell proliferative and invasive assay
Cell proliferative assay was performed according to manufacturer’s instructions of MTT Cell Proliferation and Cytotoxicity Assay Kit.
Matrigel was diluted to 1 mg/ml with cold DMEM medium without FBS and then diluted matrigel (100 μl) was added to the upper chambers in transwell. Transwell was incubated at 37°C and DMEM medium (200 μl/well) were added to chambers. After trypsinization, cells were suspended with FBS-free medium and then inoculated to the upper chambers in transwell. DMEM medium with 10% FBS was added to the inferior chambers. Non-invading cells were removed by scrubbing gently using a cotton-tipped swab. Each insert was then fixed with 4% formaldehyde for 10 min and stained using 0.1% crystal violet. Micrographs were taken of 3 fields per sample using inverted microscope. The number of cells in each field were counted the passage number was statistical analysis (Mena ± SD).
Western-blot
Western blot was performed using a standard protocol. The lysates (20 μg) were separated in polyacrylamide sodium dodecyl sulfate gel, and transferred onto a PVDF membrane. The PVDF membranes were blocked at room temperature for 1 h with 5% powdered milk in TBST. Primary antibodies were diluted with TBST (1% powdered milk in TBST). Secondary antibodies were diluted with TBST (0.05% powdered milk in TBST). The membranes were incubated with primary antibodies at room temperature for 2 h followed by incubation with secondary antibodies (HRP-labeled, 1:10000) at room temperature for 1 h. There were 3 replicates for each sample. Blots were detected and then quantified using Quantity one v4.62.
Statistical analysis
All data are expressed as means ± standard deviations (SDs). Statistical analyses were conducted using two-sample t test in SPSS (version 11.5). A value of P<0.05 was considered significant.
Results
Expression of HEIH and HULC in different cell line
The expression of HEIH and HULC in hepatoma cell line MHCC97L and HepG2 and in the control normal human liver cell line HL-7702 was detected by real-time PCR with specific primers. The fold differences in gene expression were determined using the 2-ΔΔCT method. We assumed the expression of HEIH and HULC in HL-7702 as 1. We found that the expression of HEIH and HULC notably upregulated in hepatoma cell line compared with that in control group (Figure 1A and 1B, P<0.05). And the expression of HULC in HepG2 cell line was higher than that in MHCC97L cell line (Figure 1B).
Figure 1.

The expression levels of lnc-RNA HEIH and lnc-RNA HULC in different cells. A: lnc-RNA HEIH; B: lnc-RNA HULC.
Effect of HEIH and HULC on cell proliferation and invasion
Figure 2 showed the expression of HEIH and HULC in different cell line after over-expressive plasmid and specific siRNA transfection. The expression of HEIH and HULC obviously increased after over-expressive plasmid transfection compared with that of empty plasmid (Figure 2A and 2B). The expression of HEIH and HULC were obviously inhibited after specific siRNA transfection compared with siRNA of random sequence (Figure 2A and 2B). Over-expression of HULC promoted cell proliferation of MHCC97L and HepG2, however, over-expression of HEIH could not (Figure 3). Over-expression of HULC and HEIH significantly promoted cell invasion of MHCC97L and HepG2, however, inhibition the expression of these two lncRNAs with siRNA could not notably effect cell invasion of MHCC97L and HepG2 (Figure 4, P>0.05).
Figure 2.

The expression levels of lnc-RNA HEIH and lnc-RNA HULC before and after siRNA in different cells. A: HEIH in MHCC97L cells; B: HULC in HepG2 cells.
Figure 3.

Cell proliferation determination results by MTT method. A: Over-expression of lnc-RNA HULC in MHCC97L cells; B: Over-expression of lnc-RNA HEIH in MHCC97L cells; C: Over-expression of lnc-RNA HULC in HepG2 cells; D: Over-expression of lnc-RNA HEIH in HepG2 cells.
Figure 4.

The effects of HULC on snail.
The relationship between HULC and the expression of cell cycle associated protein
Studies have showed that there was positive correlation between HULC and proliferation of hepatocellular carcinoma, and between HULC and invasion of hepatocellular carcinoma. Snail not only plays an essential role in EMT of cells, but also is an important protein in the process of EMT in cancer cells. By transfection of overexpression plasmid, HULC over-expressed in hepatocellular carcinoma cell. Over-expression of HULC led to upregulation of Snail.
Discussion
With the completion of the human genome project, scientists found that just a small part of DNA could encode protein, while a large portion of DNA could not. These DNA which could not encode protein might transcript into RNA which was not the so-called “noise of transcription”. Although these RNA could not participate in gene encoding and protein synthesis directly, they are essential for posttranscriptional control, clipping, and modification. These RNA play an important role in a lot of biological activities and have close relation with generation, development, diagnosis and treatment of disease [13]. lncRNA is a kind of non-coding RNA with more than 200 nucleotide, which is considered to be the “noise” of genome transcription without biological function for a long time. However, recent studies revealed that lncRNA played an important role in dosage compensation effect, epigenetic regulation, cell cycle, differentiation, and some other cell life activities. Thereby, lncRNA are widely involved in physiological and pathological process. Now, researches on lncRNA became one of the most interesting research areas in molecular biology [14].
Hepatocellular carcinoma is the third common malignant tumor whose fatality rate only next to stomach carcinoma and esophageal cancer, and endangers the human health. Mechanism of carcinogenesis and development is the research focus in oncology. Long-term accumulation of many factors leads to carcinogenesis. Although the three steps of hepatocarcinogenesis (hepatitis-hepatic cirrhosis-hepatocellular carcinoma) are well known, the molecular mechanism of each process is not clear [15,16]. Therefore, investigation of potential carcinogenic agent and the molecular mechanism is significant for diagnosis and treatment of hepatocellular carcinoma. Though the time to study lncRNA is not long, lncRNA has been confirmed to widely participate in biological activities, especially regulation of the expression of cell cycle related gene, modification of chromatin, dosage compensation effect, and so on. Some kinds of lncRNA have been found abnormally expressed in one or many kinds of tumor. In hepatocellular carcinoma, some related lncRNA has been found, such as HEIH, HULC, HOTAIR, MALAT and MEG3 [17-19].
The above researches suggest that lncRNA might play an important role in the tumorigenesis and development of hepatocellular carcinoma. Our research detected the expression of HEIH and HULC in different hepatoma cell line by real-time PCR and found that the expression of HEIH and HULC notably upregulated in hepatoma cell line MHCC97L and HepG2 compared with that in human normal hepatocyte line cHL-7702. We constructed over-expressive vector and specific siRNA of lncRNA-HEIH and lncRNA-HULC and confirmed that siRNA could inhibit the expression of target gene (lncRNA-HEIH and lncRNA-HULC). The fold differences in gene expression were determined using the 2-ΔΔCT method and we assumed the expression of HEIH and HULC in HL-7702 as 1. The expression of these two kinds of lncRNA significantly upregulated compared with the control group (P<0.05) and the expression of HULC in HepG2 cell line was higher than that in MHCC97L. This result was consistent with previous studies [20]. Further, the effect of lncRNA on proliferation of hepatoma carcinoma cell was analyzed by MTT Cell Proliferation and Cytotoxicity Assay Kit. Results showed that over-expression of lnc-RNA HULC obviously promoted proliferation of MHCC97L and HepG2, while over-expression of HEIH could not. This result suggested that lnc-RNA HULC promoted proliferation of tumor cell by regulating tumor cell proliferation associated gene, especially cell cycle related gene to change cell cycle of tumor cell. Cell invasion assay with transwell showed that Over-expression of HULC and HEIH significantly promoted cell invasion of MHCC97L and HepG2, however, inhibition the expression of these two lncRNAs with siRNA could not notably effect cell invasion of MHCC97L and HepG2.
Epithelial-Mesenchymal mesenchymal Transition transition (EMT) is a biological process that polar epithelial cells transformed to cells with interstitial phenotype through some program. EMT plays an important role in genesis and development of tumor, especially changes abilities of cell adhesion and migration to promote invasion and metastasis of tumor cells. Thus EMT also plays an important role in invasion and metastasis of ovarian cancer. Snail is very important in EMT process of tumor cells, and has become research focus in the field of tumor study [21]. Therefore, on the basis of the above results, we observed the effect of lnc-RNA HEIH and lnc-RNA HULC on the expression of Snail in hepatoma carcinoma cell. The results showed that over-expression of lnc-RNA HEIH or lnc-RNA HULC increased the expression of Snail gene in HepG2 at different degree. Nevertheless, it was not clear that whether this upregulation of Snail gene was directly effectedaffected by lnc-RNA HEIH and lnc-RNA HULC. In the successive experiments, we will find proteins interacting with lnc-RNA HEIH and lnc-RNA HULC and reveal the molecular mechanism in regulating cell cycle by RNA pull down experiment.
Disclosure of conflict of interest
None.
References
- 1.Philippen LE, Dirkx E, da Costa-Martins PA, De Windt LJ. Non-coding RNA in control of gene regulatory programs in cardiac development and disease. J Mol Cell Cardiol. 2015 doi: 10.1016/j.yjmcc.2015.03.014. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
- 2.Szafranski K, Abraham KJ, Mekhail K. Non-coding RNA in neural function, disease, and aging. Front Genet. 2015;6:87. doi: 10.3389/fgene.2015.00087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.You J, Zhang Y, Liu B, Li Y, Fang N, Zu L, Li X, Zhou Q. MicroRNA-449a inhibits cell growth in lung cancer and regulates long noncoding RNA nuclear enriched abundant transcript 1. Indian J Cancer. 2014;51(Suppl 3):e77–81. doi: 10.4103/0019-509X.154055. [DOI] [PubMed] [Google Scholar]
- 4.McCarty G, Loeb DM. Hypoxia-Sensitive Epigenetic Regulation of an Antisense-Oriented lncRNA Controls WT1 Expression in Myeloid Leukemia Cells. PLoS One. 2015;10:e0119837. doi: 10.1371/journal.pone.0119837. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Panzitt K, Tschernatsch MM, Guelly C, Moustafa T, Stradner M, Strohmaier HM, Buck CR, Denk H, Schroeder R, Trauner M, Zatloukal K. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology. 2007;132:330–342. doi: 10.1053/j.gastro.2006.08.026. [DOI] [PubMed] [Google Scholar]
- 6.Wang J, Liu X, Wu H, Ni P, Gu Z, Qiao Y, Chen N, Sun F, Fan Q. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. Nucleic Acids Res. 2010;38:5366–5383. doi: 10.1093/nar/gkq285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Panzitt K, Tschernatsch MM, Guelly C, Moustafa T, Stradner M, Strohmaier HM, Buck CR, Denk H, Schroeder R, Trauner M, Zatloukal K. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology. 2007;132:330–342. doi: 10.1053/j.gastro.2006.08.026. [DOI] [PubMed] [Google Scholar]
- 8.Yang F, Zhang L, Huo XS, Yuan JH, Xu D, Yuan SX, Zhu N, Zhou WP, Yang GS, Wang YZ, Shang JL, Gao CF, Zhang FR, Wang F, Sun SH. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology. 2011;54:1679–1689. doi: 10.1002/hep.24563. [DOI] [PubMed] [Google Scholar]
- 9.He Y, Meng XM, Huang C, Wu BM, Zhang L, Lv XW, Li J. Long noncoding RNAs: Novel insights into hepatocelluar carcinoma. Cancer Lett. 2014;344:20–27. doi: 10.1016/j.canlet.2013.10.021. [DOI] [PubMed] [Google Scholar]
- 10.Martens JA, Laprade L, Winston F. Intergenic transcription is required to repress the Saccharomyces cerevisiae SER3 gene. Nature. 2004;429:571–574. doi: 10.1038/nature02538. [DOI] [PubMed] [Google Scholar]
- 11.Hirota K, Miyoshi T, Kugou K, Hoffman CS, Shibata T, Ohta K. Stepwise chromatin remodelling by a cascade of transcription initiation of non-coding RNAs. Nature. 2008;456:130–134. doi: 10.1038/nature07348. [DOI] [PubMed] [Google Scholar]
- 12.Cui M, Xiao Z, Wang Y, Zheng M, Song T, Cai X, Sun B, Ye L, Zhang X. Long Noncoding RNA HULC Modulates Abnormal Lipid Metabolism in Hepatoma Cells through an miR-9-Mediated RXRA Signaling Pathway. Cancer Res. 2015;75:846–857. doi: 10.1158/0008-5472.CAN-14-1192. [DOI] [PubMed] [Google Scholar]
- 13.Feng Y, Fan Y, Huiqing C, Zicai L, Quan D. The emerging landscape of long non-coding RNAs. Yi Chuan. 2014;36:456–468. [PubMed] [Google Scholar]
- 14.Guil S, Esteller M. RNA-RNA interactions in gene regulation: the coding and noncoding players. Trends Biochem Sci. 2015;40:248–256. doi: 10.1016/j.tibs.2015.03.001. [DOI] [PubMed] [Google Scholar]
- 15.Michielsen P, Ho E. Viral hepatitis B and hepatocellular carcinoma. Acta Gastroenterol Belg. 2011;74:4–8. [PubMed] [Google Scholar]
- 16.Yang P, Markowitz GJ, Wang XF. The hepatitis B virus-associated tumor microenvironment in hepatocellular carcinoma. Natl Sci Rev. 2014;1:396–412. doi: 10.1093/nsr/nwu038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Panzitt K, Tschernatsch MM, Guelly C, Moustafa T, Stradner M, Strohmaier HM, Buck CR, Denk H, Schroeder R, Trauner M, Zatloukal K. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology. 2007;132:330–342. doi: 10.1053/j.gastro.2006.08.026. [DOI] [PubMed] [Google Scholar]
- 18.Yang Z, Zhou L, Wu LM, Lai MC, Xie HY, Zhang F, Zheng SS. Overexpression of long non-coding RNA HOTAIR predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation. Ann Surg Oncol. 2011;18:1243–1250. doi: 10.1245/s10434-011-1581-y. [DOI] [PubMed] [Google Scholar]
- 19.Yang F, Zhang L, Huo XS, Yuan JH, Xu D, Yuan SX, Zhu N, Zhou WP, Yang GS, Wang YZ, Shang JL, Gao CF, Zhang FR, Wang F, Sun SH. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology. 2011;54:1679–1689. doi: 10.1002/hep.24563. [DOI] [PubMed] [Google Scholar]
- 20.Matouk IJ, Abbasi I, Hochberg A, Galun E, Dweik H, Akkawi M. Highly upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis. Eur J Gastroenterol Hepatol. 2009;21:688–692. doi: 10.1097/meg.0b013e328306a3a2. [DOI] [PubMed] [Google Scholar]
- 21.Acloque H, Thiery JP, Nieto MA. The physiology and pathology of the EMT. Meeting on the epithelial-mesenchymal transition. EMBO Rep. 2008;9:322–326. doi: 10.1038/embor.2008.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
